| Clone Name | FLbaf74i17 |
|---|---|
| Clone Library Name | barley_pub |
>ref|NM_001055330.1| Oryza sativa (japonica cultivar-group) Os03g0121700 (Os03g0121700) mRNA, complete cds Length = 1062 Score = 391 bits (197), Expect = e-105 Identities = 248/265 (93%) Strand = Plus / Plus Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331 |||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 283 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 342 Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391 ||||| |||||||| || |||||||||||||||||||||||||||||||| || ||||| Sbjct: 343 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 402 Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 403 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 462 Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511 ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 463 ggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcagttcag 522 Query: 512 gatgcaggacctgagcaaggcgatg 536 |||||| ||||||||||||| |||| Sbjct: 523 gatgcaagacctgagcaaggtgatg 547 Score = 210 bits (106), Expect = 7e-51 Identities = 142/154 (92%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||||| | |||||||||||| || || ||| |||||||||||||||||||| Sbjct: 578 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 637 Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695 |||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 638 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 697 Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729 ||||| || |||||||||||||||||||| |||| Sbjct: 698 gacattgtgagcgccatcatggagctcacggcct 731
>dbj|AK099300.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023142E05, full insert sequence Length = 954 Score = 391 bits (197), Expect = e-105 Identities = 248/265 (93%) Strand = Plus / Plus Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331 |||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 268 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 327 Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391 ||||| |||||||| || |||||||||||||||||||||||||||||||| || ||||| Sbjct: 328 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 387 Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 388 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 447 Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511 ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 448 ggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcagttcag 507 Query: 512 gatgcaggacctgagcaaggcgatg 536 |||||| ||||||||||||| |||| Sbjct: 508 gatgcaagacctgagcaaggtgatg 532 Score = 210 bits (106), Expect = 7e-51 Identities = 142/154 (92%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||||| | |||||||||||| || || ||| |||||||||||||||||||| Sbjct: 563 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 622 Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695 |||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 623 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 682 Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729 ||||| || |||||||||||||||||||| |||| Sbjct: 683 gacattgtgagcgccatcatggagctcacggcct 716
>gb|AY224519.1| Oryza sativa (japonica cultivar-group) isolate 20527 putative nascent polypeptide-associated complex alpha chain mRNA, complete cds Length = 666 Score = 383 bits (193), Expect = e-103 Identities = 247/265 (93%) Strand = Plus / Plus Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331 |||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 216 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 275 Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391 ||||| |||||||| || |||||||||||||||||||||||||||||||| || ||||| Sbjct: 276 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 335 Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 336 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 395 Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511 ||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 396 ggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcagttcag 455 Query: 512 gatgcaggacctgagcaaggcgatg 536 |||||| || |||||||||| |||| Sbjct: 456 gatgcaagatctgagcaaggtgatg 480 Score = 210 bits (106), Expect = 7e-51 Identities = 142/154 (92%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||||| | |||||||||||| || || ||| |||||||||||||||||||| Sbjct: 511 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 570 Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695 |||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 571 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 630 Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729 ||||| || |||||||||||||||||||| |||| Sbjct: 631 gacattgtgagcgccatcatggagctcacggcct 664
>dbj|AK059982.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-E10, full insert sequence Length = 1062 Score = 383 bits (193), Expect = e-103 Identities = 247/265 (93%) Strand = Plus / Plus Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331 |||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 283 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 342 Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391 ||||| |||||||| || |||||||||||||||||||||||||||||||| || ||||| Sbjct: 343 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 402 Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451 ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||||||| Sbjct: 403 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 462 Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511 ||||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||| Sbjct: 463 ggaggccaagatcgaggacctgagctcccagctgcaggcgtaggccgcgcagcagttcag 522 Query: 512 gatgcaggacctgagcaaggcgatg 536 |||||| ||||||||||||| |||| Sbjct: 523 gatgcaagacctgagcaaggtgatg 547 Score = 210 bits (106), Expect = 7e-51 Identities = 142/154 (92%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||||| | |||||||||||| || || ||| |||||||||||||||||||| Sbjct: 578 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 637 Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695 |||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 638 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 697 Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729 ||||| || |||||||||||||||||||| |||| Sbjct: 698 gacattgtgagcgccatcatggagctcacggcct 731
>ref|NM_001050511.1| Oryza sativa (japonica cultivar-group) Os01g0698900 (Os01g0698900) mRNA, complete cds Length = 1149 Score = 333 bits (168), Expect = 7e-88 Identities = 236/258 (91%), Gaps = 3/258 (1%) Strand = Plus / Plus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 580 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 639 Query: 342 gtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgttcgtggtgtcg 401 ||||| || |||||||||||||||||| ||||||||||||| || |||||||||||||| Sbjct: 640 gtcacgggagtcagcaggattaccatcgagagagccaagaatatactgttcgtggtgtcc 699 Query: 402 aagccg---gacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 || || ||||| ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 700 aaacctcatgacgtcttcaagagcccgacgtcggagtcgtacgtcatattcggggaggcc 759 Query: 459 aagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgcag 518 |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| Sbjct: 760 aagatcgaggacctgagctcccagctgcaggcgcaggcagcgcagcagttcaggatgcaa 819 Query: 519 gacctgagcaaggcgatg 536 || |||||||||| |||| Sbjct: 820 gatctgagcaaggtgatg 837 Score = 79.8 bits (40), Expect = 2e-11 Identities = 64/72 (88%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||| | | |||||||||||| || || ||| |||||||||||||| ||||| Sbjct: 868 gccgacgaggagcaagaggtggacgagacagggatagagccccgcgacatcgacgtcgtc 927 Query: 636 atgacgcaggcc 647 |||||||||||| Sbjct: 928 atgacgcaggcc 939 Score = 44.1 bits (22), Expect = 0.88 Identities = 45/52 (86%), Gaps = 3/52 (5%) Strand = Plus / Plus Query: 62 catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110 ||||||||||||||| |||||||| |||| ||||| ||||||||| |||| Sbjct: 357 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 408
>gb|AC105363.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1705B08, complete sequence Length = 100986 Score = 234 bits (118), Expect = 5e-58 Identities = 142/150 (94%) Strand = Plus / Plus Query: 387 ctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgata 446 |||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||| Sbjct: 78469 ctgttcgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcata 78528 Query: 447 ttcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcag 506 |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 78529 ttcggggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcag 78588 Query: 507 ttcaggatgcaggacctgagcaaggcgatg 536 ||||||||||| ||||||||||||| |||| Sbjct: 78589 ttcaggatgcaagacctgagcaaggtgatg 78618 Score = 210 bits (106), Expect = 7e-51 Identities = 142/154 (92%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||||| | |||||||||||| || || ||| |||||||||||||||||||| Sbjct: 78649 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 78708 Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695 |||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 78709 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 78768 Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729 ||||| || |||||||||||||||||||| |||| Sbjct: 78769 gacattgtgagcgccatcatggagctcacggcct 78802 Score = 165 bits (83), Expect = 4e-37 Identities = 104/111 (93%) Strand = Plus / Plus Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331 |||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 78267 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 78326 Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaa 382 ||||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 78327 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaa 78377
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3 Length = 36192742 Score = 234 bits (118), Expect = 5e-58 Identities = 142/150 (94%) Strand = Plus / Plus Query: 387 ctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgata 446 |||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||| Sbjct: 1174763 ctgttcgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcata 1174822 Query: 447 ttcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcag 506 |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| Sbjct: 1174823 ttcggggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcag 1174882 Query: 507 ttcaggatgcaggacctgagcaaggcgatg 536 ||||||||||| ||||||||||||| |||| Sbjct: 1174883 ttcaggatgcaagacctgagcaaggtgatg 1174912 Score = 210 bits (106), Expect = 7e-51 Identities = 142/154 (92%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||||| | |||||||||||| || || ||| |||||||||||||||||||| Sbjct: 1174943 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 1175002 Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695 |||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||| Sbjct: 1175003 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 1175062 Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729 ||||| || |||||||||||||||||||| |||| Sbjct: 1175063 gacattgtgagcgccatcatggagctcacggcct 1175096 Score = 165 bits (83), Expect = 4e-37 Identities = 104/111 (93%) Strand = Plus / Plus Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331 |||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1174561 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 1174620 Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaa 382 ||||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 1174621 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaa 1174671 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 cgtcgccgacgaggaggaggtggtgg 597 ||||||||| |||||||||||||||| Sbjct: 28542037 cgtcgccgaggaggaggaggtggtgg 28542012 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 574 tcgccgacgaggaggaggtgg 594 ||||||||||||||||||||| Sbjct: 18338499 tcgccgacgaggaggaggtgg 18338519
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 192 bits (97), Expect = 2e-45 Identities = 121/129 (93%) Strand = Plus / Plus Query: 408 gacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgag 467 ||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| Sbjct: 28908719 gacgtcttcaagagcccgacgtcggagtcgtacgtcatattcggggaggccaagatcgag 28908778 Query: 468 gacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgcaggacctgagc 527 ||||||||||| ||||||||||||||||| |||||||||||||||||||| || |||||| Sbjct: 28908779 gacctgagctcccagctgcaggcgcaggcagcgcagcagttcaggatgcaagatctgagc 28908838 Query: 528 aaggcgatg 536 |||| |||| Sbjct: 28908839 aaggtgatg 28908847 Score = 153 bits (77), Expect = 1e-33 Identities = 95/101 (94%) Strand = Plus / Plus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 28908504 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 28908563 Query: 342 gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382 ||||| || |||||||||||||||||| ||||||||||||| Sbjct: 28908564 gtcacgggagtcagcaggattaccatcgagagagccaagaa 28908604 Score = 79.8 bits (40), Expect = 2e-11 Identities = 64/72 (88%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||| | | |||||||||||| || || ||| |||||||||||||| ||||| Sbjct: 28908878 gccgacgaggagcaagaggtggacgagacagggatagagccccgcgacatcgacgtcgtc 28908937 Query: 636 atgacgcaggcc 647 |||||||||||| Sbjct: 28908938 atgacgcaggcc 28908949 Score = 61.9 bits (31), Expect = 4e-06 Identities = 64/75 (85%) Strand = Plus / Plus Query: 414 ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473 ||||||||||| | || || || ||||| || ||||| ||||| ||||||||||| ||| Sbjct: 41208845 ttcaagagcccaaactcagacacctacgtcatcttcggtgaggcgaagatcgaggatctg 41208904 Query: 474 agctcgcagctgcag 488 ||||||||||||||| Sbjct: 41208905 agctcgcagctgcag 41208919 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 743 tttccgtttccgtttccgtttc 764 |||||||||||||||||||||| Sbjct: 11335843 tttccgtttccgtttccgtttc 11335864 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 11335847 cgtttccgtttccgtttccgtt 11335868 Score = 44.1 bits (22), Expect = 0.88 Identities = 45/52 (86%), Gaps = 3/52 (5%) Strand = Plus / Plus Query: 62 catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110 ||||||||||||||| |||||||| |||| ||||| ||||||||| |||| Sbjct: 28908070 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 28908121 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccg 760 |||||||||||||||||||||| Sbjct: 38588714 ttcgtttccgtttccgtttccg 38588693 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 572 cgtcgccgacgaggaggaggtggtggacg 600 |||||||||||||||||||| || ||||| Sbjct: 40066942 cgtcgccgacgaggaggaggaggaggacg 40066970
>dbj|AP003254.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0454A11 Length = 152240 Score = 192 bits (97), Expect = 2e-45 Identities = 121/129 (93%) Strand = Plus / Plus Query: 408 gacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgag 467 ||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| Sbjct: 21342 gacgtcttcaagagcccgacgtcggagtcgtacgtcatattcggggaggccaagatcgag 21401 Query: 468 gacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgcaggacctgagc 527 ||||||||||| ||||||||||||||||| |||||||||||||||||||| || |||||| Sbjct: 21402 gacctgagctcccagctgcaggcgcaggcagcgcagcagttcaggatgcaagatctgagc 21461 Query: 528 aaggcgatg 536 |||| |||| Sbjct: 21462 aaggtgatg 21470 Score = 153 bits (77), Expect = 1e-33 Identities = 95/101 (94%) Strand = Plus / Plus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 21127 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 21186 Query: 342 gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382 ||||| || |||||||||||||||||| ||||||||||||| Sbjct: 21187 gtcacgggagtcagcaggattaccatcgagagagccaagaa 21227 Score = 79.8 bits (40), Expect = 2e-11 Identities = 64/72 (88%) Strand = Plus / Plus Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635 |||||||||||| | | |||||||||||| || || ||| |||||||||||||| ||||| Sbjct: 21501 gccgacgaggagcaagaggtggacgagacagggatagagccccgcgacatcgacgtcgtc 21560 Query: 636 atgacgcaggcc 647 |||||||||||| Sbjct: 21561 atgacgcaggcc 21572 Score = 44.1 bits (22), Expect = 0.88 Identities = 45/52 (86%), Gaps = 3/52 (5%) Strand = Plus / Plus Query: 62 catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110 ||||||||||||||| |||||||| |||| ||||| ||||||||| |||| Sbjct: 20693 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 20744
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7 Length = 29644043 Score = 161 bits (81), Expect = 5e-36 Identities = 96/101 (95%) Strand = Plus / Minus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 12569215 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 12569156 Query: 342 gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382 ||||| || |||||||||||||||||||||||||||||||| Sbjct: 12569155 gtcacgggagtcagcaggattaccatcaagagagccaagaa 12569115 Score = 63.9 bits (32), Expect = 1e-06 Identities = 32/32 (100%) Strand = Plus / Minus Query: 616 cccgcgacatcgacctcgtcatgacgcaggcc 647 |||||||||||||||||||||||||||||||| Sbjct: 12569062 cccgcgacatcgacctcgtcatgacgcaggcc 12569031 Score = 44.1 bits (22), Expect = 0.88 Identities = 45/52 (86%), Gaps = 3/52 (5%) Strand = Plus / Minus Query: 62 catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110 ||||||||||||||| |||||||| |||| ||||| ||||||||| |||| Sbjct: 12569644 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 12569593 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccg 760 |||||||||||||||||||||| Sbjct: 23924359 ttcgtttccgtttccgtttccg 23924338
>dbj|AP005438.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1723_B06 Length = 136853 Score = 161 bits (81), Expect = 5e-36 Identities = 96/101 (95%) Strand = Plus / Minus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| ||| Sbjct: 53908 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 53849 Query: 342 gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382 ||||| || |||||||||||||||||||||||||||||||| Sbjct: 53848 gtcacgggagtcagcaggattaccatcaagagagccaagaa 53808 Score = 63.9 bits (32), Expect = 1e-06 Identities = 32/32 (100%) Strand = Plus / Minus Query: 616 cccgcgacatcgacctcgtcatgacgcaggcc 647 |||||||||||||||||||||||||||||||| Sbjct: 53755 cccgcgacatcgacctcgtcatgacgcaggcc 53724 Score = 44.1 bits (22), Expect = 0.88 Identities = 45/52 (86%), Gaps = 3/52 (5%) Strand = Plus / Minus Query: 62 catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110 ||||||||||||||| |||||||| |||| ||||| ||||||||| |||| Sbjct: 54337 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 54286
>gb|BT016475.1| Zea mays clone Contig308 mRNA sequence Length = 891 Score = 117 bits (59), Expect = 7e-23 Identities = 173/211 (81%) Strand = Plus / Plus Query: 278 gtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaa 337 ||||||||| ||| |||| |||||||||||||||||||||||| ||||||| || ||||| Sbjct: 249 gtcgaagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaa 308 Query: 338 gcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgttcgtggt 397 |||| |||| || |||||| || | || | |||| | |||||| || || || || | Sbjct: 309 gcccatcactggtgtcagccgggtcactgtgaagaaaagcaagaatatgctttttgtcat 368 Query: 398 gtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggc 457 |||||||| || |||||||||||||| | ||||| || || || |||||||| ||||| Sbjct: 369 ctcgaagccagatgtgttcaagagcccaaactcggacacctatgtcatattcggcgaggc 428 Query: 458 caagatcgaggacctgagctcgcagctgcag 488 |||||||||||||| ||||| ||||||||| Sbjct: 429 gaagatcgaggacctcagctcccagctgcag 459
>emb|CT983009.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 916 Score = 91.7 bits (46), Expect = 4e-15 Identities = 190/238 (79%) Strand = Plus / Plus Query: 279 tcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaag 338 |||||||||||| | ||||||||||||||||||||||| ||| ||||||| || ||||| Sbjct: 284 tcgaagcagagcagaagcgagaagaagagccgcaaggctatgttgaagcttggcatgaaa 343 Query: 339 cccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgttcgtggtg 398 || || | ||| || |||||| | |||||||||||| ||||||| |||| ||| | | Sbjct: 344 cctgtaagcggtgtaagcagggtcaccatcaagagaaccaagaatgtcctattcttcatc 403 Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 || || || || || ||||||||||| || ||||| || | ||||| |||||||| Sbjct: 404 tcaaatcctgatgtcttcaagagccctcactctgagacttatatcatatttggggaggcg 463 Query: 459 aagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgc 516 ||||| || ||| ||||||| || |||||| | || || || |||||||||||||||| Sbjct: 464 aagattgaagacttgagctcacaactgcagacacaagctgcccagcagttcaggatgc 521
>dbj|AP006123.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT41E18, TM0207, complete sequence Length = 115290 Score = 81.8 bits (41), Expect = 4e-12 Identities = 74/85 (87%) Strand = Plus / Plus Query: 432 gagacgtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcaggcg 491 ||||| ||||| |||||||||||||| || || |||||||||||||| ||||||||| | Sbjct: 12186 gagacctacgtcatattcggggaggcgaaaatagaggacctgagctctcagctgcagaca 12245 Query: 492 caggcggcgcagcagttcaggatgc 516 || || || |||||||||||||||| Sbjct: 12246 caagctgctcagcagttcaggatgc 12270
>gb|DQ245285.1| Zea mays clone 14302 mRNA sequence Length = 994 Score = 79.8 bits (40), Expect = 2e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 411 gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470 |||||||||||||||| || || ||||| || |||||||| ||||| |||||||||||| Sbjct: 404 gtgttcaagagcccgaattccgacacgtatgtcatattcggcgaggctaagatcgaggac 463 Query: 471 ctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 || ||||| ||||||||| | ||||| || ||||||||| Sbjct: 464 ctcagctcccagctgcagacccaggcagcagagcagttca 503 Score = 77.8 bits (39), Expect = 6e-11 Identities = 66/75 (88%) Strand = Plus / Plus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||| ||| |||| |||||||||||||||||||||||| ||||||| || ||||||||| Sbjct: 275 aagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaagccc 334 Query: 342 gtcaccggcgtcagc 356 |||| || |||||| Sbjct: 335 atcactggtgtcagc 349 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 661 ccaaggccgtcaaggccctcaaggc 685 ||||||| ||||||||||||||||| Sbjct: 645 ccaaggctgtcaaggccctcaaggc 669
>gb|BT016765.1| Zea mays clone Contig598 mRNA sequence Length = 957 Score = 79.8 bits (40), Expect = 2e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 411 gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470 |||||||||||||||| || || ||||| || |||||||| ||||| |||||||||||| Sbjct: 399 gtgttcaagagcccgaattccgacacgtatgtcatattcggcgaggctaagatcgaggac 458 Query: 471 ctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 || ||||| ||||||||| | ||||| || ||||||||| Sbjct: 459 ctcagctcccagctgcagacccaggcagcagagcagttca 498 Score = 77.8 bits (39), Expect = 6e-11 Identities = 66/75 (88%) Strand = Plus / Plus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||| ||| |||| |||||||||||||||||||||||| ||||||| || ||||||||| Sbjct: 270 aagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaagccc 329 Query: 342 gtcaccggcgtcagc 356 |||| || |||||| Sbjct: 330 atcactggtgtcagc 344 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 661 ccaaggccgtcaaggccctcaaggc 685 ||||||| ||||||||||||||||| Sbjct: 640 ccaaggctgtcaaggccctcaaggc 664
>gb|AY103873.1| Zea mays PCO094039 mRNA sequence Length = 984 Score = 79.8 bits (40), Expect = 2e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 411 gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470 |||||||||||||||| || || ||||| || |||||||| ||||| |||||||||||| Sbjct: 400 gtgttcaagagcccgaattccgacacgtatgtcatattcggcgaggctaagatcgaggac 459 Query: 471 ctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 || ||||| ||||||||| | ||||| || ||||||||| Sbjct: 460 ctcagctcccagctgcagacccaggcagcagagcagttca 499 Score = 77.8 bits (39), Expect = 6e-11 Identities = 66/75 (88%) Strand = Plus / Plus Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341 ||||| ||| |||| |||||||||||||||||||||||| ||||||| || ||||||||| Sbjct: 271 aagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaagccc 330 Query: 342 gtcaccggcgtcagc 356 |||| || |||||| Sbjct: 331 atcactggtgtcagc 345 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Plus Query: 661 ccaaggccgtcaaggccctcaaggc 685 ||||||| ||||||||||||||||| Sbjct: 641 ccaaggctgtcaaggccctcaaggc 665
>ref|NM_001061904.1| Oryza sativa (japonica cultivar-group) Os05g0373700 (Os05g0373700) mRNA, partial cds Length = 930 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 |||||||||||||||||||||||||||||||||||| | ||||| || ||||||||| Sbjct: 431 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 488 Score = 48.1 bits (24), Expect = 0.057 Identities = 84/104 (80%) Strand = Plus / Plus Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680 |||||||| || || ||||| ||||||| |||||| | ||||||| || ||||| ||| Sbjct: 587 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 646 Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724 ||||| | | ||||||||||||| ||||||||||| ||||| Sbjct: 647 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 690
>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09, complete sequence Length = 167318 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 |||||||||||||||||||||||||||||||||||| | ||||| || ||||||||| Sbjct: 129421 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 129478 Score = 48.1 bits (24), Expect = 0.057 Identities = 84/104 (80%) Strand = Plus / Plus Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680 |||||||| || || ||||| ||||||| |||||| | ||||||| || ||||| ||| Sbjct: 129577 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 129636 Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724 ||||| | | ||||||||||||| ||||||||||| ||||| Sbjct: 129637 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 129680
>gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1005_E12, complete sequence Length = 121293 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 |||||||||||||||||||||||||||||||||||| | ||||| || ||||||||| Sbjct: 216 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 273 Score = 48.1 bits (24), Expect = 0.057 Identities = 84/104 (80%) Strand = Plus / Plus Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680 |||||||| || || ||||| ||||||| |||||| | ||||||| || ||||| ||| Sbjct: 372 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 431 Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724 ||||| | | ||||||||||||| ||||||||||| ||||| Sbjct: 432 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 475
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5 Length = 29737217 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 |||||||||||||||||||||||||||||||||||| | ||||| || ||||||||| Sbjct: 17869467 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 17869524 Score = 48.1 bits (24), Expect = 0.057 Identities = 84/104 (80%) Strand = Plus / Plus Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680 |||||||| || || ||||| ||||||| |||||| | ||||||| || ||||| ||| Sbjct: 17869623 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 17869682 Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724 ||||| | | ||||||||||||| ||||||||||| ||||| Sbjct: 17869683 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 17869726
>dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for nascent polypeptide associated complex alpha chain, complete cds, clone: 13YPG044 Length = 878 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 |||||||||||||||||||||||||||||||||||| | ||||| || ||||||||| Sbjct: 369 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 426 Score = 48.1 bits (24), Expect = 0.057 Identities = 84/104 (80%) Strand = Plus / Plus Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680 |||||||| || || ||||| ||||||| |||||| | ||||||| || ||||| ||| Sbjct: 525 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 584 Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724 ||||| | | ||||||||||||| ||||||||||| ||||| Sbjct: 585 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 628
>dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-D09, full insert sequence Length = 930 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510 |||||||||||||||||||||||||||||||||||| | ||||| || ||||||||| Sbjct: 431 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 488 Score = 48.1 bits (24), Expect = 0.057 Identities = 84/104 (80%) Strand = Plus / Plus Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680 |||||||| || || ||||| ||||||| |||||| | ||||||| || ||||| ||| Sbjct: 587 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 646 Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724 ||||| | | ||||||||||||| ||||||||||| ||||| Sbjct: 647 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 690
>gb|DQ245786.1| Zea mays clone 20335 mRNA sequence Length = 856 Score = 69.9 bits (35), Expect = 2e-08 Identities = 172/215 (80%), Gaps = 2/215 (0%) Strand = Plus / Plus Query: 297 gagaagaagagccgcaaggccatgatgaagctcgggatgaagcccgtcaccggcgtcagc 356 ||||||||||| || || |||||| | |||||||||||||||||| |||| || |||||| Sbjct: 233 gagaagaagagtcgtaaagccatgctcaagctcgggatgaagcccatcactggtgtcagc 292 Query: 357 aggattaccatcaaga-gagccaagaacatcctgttcgtggtgtcgaagccggacgtgtt 415 | | ||| |||| | |||| |||||||| ||||||| | || || || || || || Sbjct: 293 cgtgtcaccgtcaaaaagagc-aagaacataatgttcgtcatctctaaacccgatgtctt 351 Query: 416 caagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctgag 475 ||||||||| | || || || ||||| || || || |||||||||||||| ||| |||| Sbjct: 352 caagagcccagcatcagacacctacgtcatctttggagaggccaagatcgaagacttgag 411 Query: 476 ctcgcagctgcaggcgcaggcggcgcagcagttca 510 ||||||| ||||| ||||||| || ||||||||| Sbjct: 412 ctcgcagatgcagtcgcaggccgcagagcagttca 446
>dbj|AK226309.1| Arabidopsis thaliana mRNA for putative alpha NAC, complete cds, clone: RAFL05-12-D01 Length = 922 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 391 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 450 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 451 aagattgatgacatgagctctcagct 476
>ref|NM_117116.2| Arabidopsis thaliana unknown protein (AT4G10480) mRNA, complete cds Length = 937 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 389 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 448 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 449 aagattgatgacatgagctctcagct 474
>gb|AY096615.1| Arabidopsis thaliana putative alpha NAC protein (AT4g10480) mRNA, complete cds Length = 670 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 304 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 363 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 364 aagattgatgacatgagctctcagct 389
>gb|AY045811.1| Arabidopsis thaliana putative alpha NAC protein (At4g10480) mRNA, complete cds Length = 923 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 375 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 434 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 435 aagattgatgacatgagctctcagct 460
>gb|AY114656.1| Arabidopsis thaliana putative alpha NAC (At4g10480) mRNA, complete cds Length = 701 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 304 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 363 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 364 aagattgatgacatgagctctcagct 389
>gb|AY062724.1| Arabidopsis thaliana putative alpha NAC (At4g10480; F7L13.60) mRNA, complete cds Length = 932 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 384 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 443 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 444 aagattgatgacatgagctctcagct 469
>emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 29 Length = 199861 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 110655 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 110596 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 110595 aagattgatgacatgagctctcagct 110570
>emb|AL049524.1|ATF7L13 Arabidopsis thaliana DNA chromosome 4, BAC clone F7L13 (ESSA project) Length = 95076 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Minus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 50692 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 50633 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 50632 aagattgatgacatgagctctcagct 50607
>gb|AF118222.1|F3H7 Arabidopsis thaliana BAC F3H7 Length = 102216 Score = 67.9 bits (34), Expect = 6e-08 Identities = 73/86 (84%) Strand = Plus / Plus Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458 ||||||||||| ||||||||||| |||| || ||||| || ||||||||||| ||||| Sbjct: 95971 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 96030 Query: 459 aagatcgaggacctgagctcgcagct 484 ||||| || ||| ||||||| ||||| Sbjct: 96031 aagattgatgacatgagctctcagct 96056
>ref|NM_001051878.1| Oryza sativa (japonica cultivar-group) Os01g0938900 (Os01g0938900) mRNA, complete cds Length = 974 Score = 63.9 bits (32), Expect = 1e-06 Identities = 92/112 (82%) Strand = Plus / Plus Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436 ||||||||| |||||||| | || || || || || ||||||||||| | || || || Sbjct: 360 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 419 Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488 ||||| || ||||| ||||| ||||||||||| |||||||||||||||||| Sbjct: 420 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 471
>dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-F04, full insert sequence Length = 909 Score = 63.9 bits (32), Expect = 1e-06 Identities = 92/112 (82%) Strand = Plus / Plus Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436 ||||||||| |||||||| | || || || || || ||||||||||| | || || || Sbjct: 382 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 441 Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488 ||||| || ||||| ||||| ||||||||||| |||||||||||||||||| Sbjct: 442 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 493
>dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L24, full insert sequence Length = 976 Score = 63.9 bits (32), Expect = 1e-06 Identities = 92/112 (82%) Strand = Plus / Plus Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436 ||||||||| |||||||| | || || || || || ||||||||||| | || || || Sbjct: 361 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 420 Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488 ||||| || ||||| ||||| ||||||||||| |||||||||||||||||| Sbjct: 421 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 472
>dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055N09, full insert sequence Length = 3171 Score = 63.9 bits (32), Expect = 1e-06 Identities = 92/112 (82%) Strand = Plus / Plus Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436 ||||||||| |||||||| | || || || || || ||||||||||| | || || || Sbjct: 2640 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 2699 Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488 ||||| || ||||| ||||| ||||||||||| |||||||||||||||||| Sbjct: 2700 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 2751
>dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G10, full insert sequence Length = 873 Score = 63.9 bits (32), Expect = 1e-06 Identities = 92/112 (82%) Strand = Plus / Plus Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436 ||||||||| |||||||| | || || || || || ||||||||||| | || || || Sbjct: 360 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 419 Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488 ||||| || ||||| ||||| ||||||||||| |||||||||||||||||| Sbjct: 420 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 471
>dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1150F11 Length = 130355 Score = 61.9 bits (31), Expect = 4e-06 Identities = 64/75 (85%) Strand = Plus / Plus Query: 414 ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473 ||||||||||| | || || || ||||| || ||||| ||||| ||||||||||| ||| Sbjct: 25760 ttcaagagcccaaactcagacacctacgtcatcttcggtgaggcgaagatcgaggatctg 25819 Query: 474 agctcgcagctgcag 488 ||||||||||||||| Sbjct: 25820 agctcgcagctgcag 25834
>dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0504E02 Length = 137468 Score = 61.9 bits (31), Expect = 4e-06 Identities = 64/75 (85%) Strand = Plus / Plus Query: 414 ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473 ||||||||||| | || || || ||||| || ||||| ||||| ||||||||||| ||| Sbjct: 105900 ttcaagagcccaaactcagacacctacgtcatcttcggtgaggcgaagatcgaggatctg 105959 Query: 474 agctcgcagctgcag 488 ||||||||||||||| Sbjct: 105960 agctcgcagctgcag 105974
>emb|CT982808.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 493 Score = 58.0 bits (29), Expect = 6e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcag 503 |||||||||||||| ||||| |||||| ||||||| |||||||| | || || || ||| Sbjct: 71 atattcggggaggcaaagattgaggacttgagctctcagctgcaaacacaagctgctcag 130 Query: 504 cagttcaggatgc 516 |||||| |||||| Sbjct: 131 cagttccggatgc 143
>emb|CT982049.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 520 Score = 58.0 bits (29), Expect = 6e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcag 503 |||||||||||||| ||||| |||||| ||||||| |||||||| | || || || ||| Sbjct: 65 atattcggggaggcaaagattgaggacttgagctctcagctgcaaacacaagctgctcag 124 Query: 504 cagttcaggatgc 516 |||||| |||||| Sbjct: 125 cagttccggatgc 137
>gb|AC119415.13| Medicago truncatula clone mth2-27n2, complete sequence Length = 139330 Score = 58.0 bits (29), Expect = 6e-05 Identities = 62/73 (84%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcag 503 ||||| |||||||| || || |||||||||||||| ||| ||||| |||| || || || Sbjct: 36446 atatttggggaggcaaaaatagaggacctgagctctcagttgcagacgcaagctgctcaa 36505 Query: 504 cagttcaggatgc 516 ||||||||||||| Sbjct: 36506 cagttcaggatgc 36518 Score = 46.1 bits (23), Expect = 0.22 Identities = 53/63 (84%) Strand = Plus / Plus Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721 ||||||||||||||| |||||| | ||| | || ||||| || | |||||||||||||| Sbjct: 33363 caaggccgtcaaggctctcaagactcacaatggggacattgttggtgccatcatggagct 33422 Query: 722 cac 724 ||| Sbjct: 33423 cac 33425 Score = 44.1 bits (22), Expect = 0.88 Identities = 85/106 (80%) Strand = Plus / Plus Query: 411 gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470 |||||||||||||| | || ||||| ||| | ||||| ||||| || || || ||||| Sbjct: 33109 gtgttcaagagcccaaattctgagacctacataatatttggggaagctaaaatagaggat 33168 Query: 471 ctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgc 516 | ||||| ||||||||| | || || || |||||||||||||||| Sbjct: 33169 ttaagctctcagctgcagacacaagctgctcagcagttcaggatgc 33214
>dbj|AK110559.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-C10, full insert sequence Length = 1032 Score = 58.0 bits (29), Expect = 6e-05 Identities = 92/113 (81%) Strand = Plus / Plus Query: 378 aagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacg 437 |||||||| |||||||| | || |||||||||||||||||| || |||| || ||| Sbjct: 377 aagaacattctgttcgtcatctctaagccggacgtgttcaagtcgcctgcgtctgatacg 436 Query: 438 tacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcaggc 490 ||| | || ||||| ||||| ||||| |||||| | | ||||||||||||||| Sbjct: 437 tacatcatcttcggtgaggcgaagattgaggacatcaactcgcagctgcaggc 489
>ref|NW_001081896.1| Leishmania major strain Friedlin chromosome 4, right end emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end Length = 247462 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Minus Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721 ||||||| |||||||||||||| || ||||||||||||||| | ||||||||||||| Sbjct: 79401 caaggccatcaaggccctcaagaacaacaacggcgacatcgtcaacaccatcatggagct 79342 Score = 48.1 bits (24), Expect = 0.057 Identities = 51/60 (85%) Strand = Plus / Minus Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721 ||||||| |||||||||||||| || |||||||||| |||| | ||||||||||||| Sbjct: 81208 caaggccatcaaggccctcaagaacaacaacggcgacattgtcaacaccatcatggagct 81149
>gb|AC109219.13| Mus musculus chromosome 1, clone RP23-429I18, complete sequence Length = 204942 Score = 56.0 bits (28), Expect = 2e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||||| ||||| Sbjct: 135033 ttcgtttccgtttccgtttccgtttccgtttc 135002 Score = 50.1 bits (25), Expect = 0.014 Identities = 28/29 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcggttt 769 |||||||||||||||||||||||| |||| Sbjct: 135025 cgtttccgtttccgtttccgtttccgttt 134997 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccgtttcggtttc 770 ||||||| |||||||||||||||||| ||||| Sbjct: 135039 ttcgttttcgtttccgtttccgtttccgtttc 135008
>gb|AC110232.15| Mus musculus chromosome 1, clone RP23-67H24, complete sequence Length = 209668 Score = 56.0 bits (28), Expect = 2e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 739 ttcgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||||| ||||| Sbjct: 152144 ttcgtttccgtttccgtttccgtttccgtttc 152175 Score = 50.1 bits (25), Expect = 0.014 Identities = 28/29 (96%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtttcggttt 769 |||||||||||||||||||||||| |||| Sbjct: 152152 cgtttccgtttccgtttccgtttccgttt 152180 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Plus Query: 739 ttcgtttccgtttccgtttccgtttcggtttc 770 ||||||| |||||||||||||||||| ||||| Sbjct: 152138 ttcgttttcgtttccgtttccgtttccgtttc 152169
>ref|XM_883486.1| Leishmania major strain Friedlin nascent polypeptide associated complex subunit (L4830.08) partial mRNA Length = 735 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721 ||||||| |||||||||||||| || ||||||||||||||| | ||||||||||||| Sbjct: 666 caaggccatcaaggccctcaagaacaacaacggcgacatcgtcaacaccatcatggagct 725
>gb|AC109195.27| Mus musculus chromosome 15, clone RP24-212B11, complete sequence Length = 168270 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 140827 cgtttccgtttccgtttccgtttccgtttc 140798 Score = 48.1 bits (24), Expect = 0.057 Identities = 27/28 (96%) Strand = Plus / Minus Query: 743 tttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||| ||||| Sbjct: 140831 tttccgtttccgtttccgtttccgtttc 140804
>gb|AC154227.2| Mus musculus BAC clone RP24-142A23 from chromosome 14, complete sequence Length = 156644 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 144787 cgtttccgtttccgtttccgtttccgtttc 144816 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 144793 cgtttccgtttccgtttccgtttccgtttc 144822 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 144799 cgtttccgtttccgtttccgtttccgtttc 144828 Score = 48.1 bits (24), Expect = 0.057 Identities = 27/28 (96%) Strand = Plus / Plus Query: 743 tttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||| ||||| Sbjct: 144783 tttccgtttccgtttccgtttccgtttc 144810
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 2914889 cgtttccgtttccgtttccgtttccgtttc 2914918 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 2914895 cgtttccgtttccgtttccgtttccgtttc 2914924 Score = 48.1 bits (24), Expect = 0.057 Identities = 27/28 (96%) Strand = Plus / Plus Query: 743 tttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||| ||||| Sbjct: 2914885 tttccgtttccgtttccgtttccgtttc 2914912 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 2914907 cgtttccgtttccgtttccgtt 2914928
>ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent polypeptide-associated complex alpha polypeptide (LOC609875), mRNA Length = 360 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagctcacc 725 |||||||||| ||||||||||||||||||| Sbjct: 325 gacatcgtcaacgccatcatggagctcacc 354
>gb|AC105969.17| Mus musculus chromosome 15, clone RP23-477B23, complete sequence Length = 189238 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 177726 cgtttccgtttccgtttccgtttccgtttc 177755 Score = 48.1 bits (24), Expect = 0.057 Identities = 27/28 (96%) Strand = Plus / Plus Query: 743 tttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||| ||||| Sbjct: 177722 tttccgtttccgtttccgtttccgtttc 177749
>emb|AL115467.1|CNS01CFN Botrytis cinerea strain T4 cDNA library Length = 660 Score = 52.0 bits (26), Expect = 0.004 Identities = 29/30 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||||| ||||| Sbjct: 562 cgtttccgtttccgtttccgtttccgtttc 533 Score = 46.1 bits (23), Expect = 0.22 Identities = 26/27 (96%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttcggtttc 770 ||||||||||||||||||||| ||||| Sbjct: 565 ttccgtttccgtttccgtttccgtttc 539
>emb|CT029334.1| Poplar cDNA sequences Length = 743 Score = 50.1 bits (25), Expect = 0.014 Identities = 55/65 (84%) Strand = Plus / Plus Query: 414 ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473 ||||||||||| || || || || || ||||| || |||||||| |||||||||||| || Sbjct: 413 ttcaagagcccaacatctgacacatatgtgatctttggggaggcgaagatcgaggacttg 472 Query: 474 agctc 478 ||||| Sbjct: 473 agctc 477
>ref|NW_001091929.1| Theileria annulata strain Ankara clone C9 Length = 2592520 Score = 50.1 bits (25), Expect = 0.014 Identities = 28/29 (96%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttcggtttc 770 ||||||||||||||||||||||| ||||| Sbjct: 2533885 gtttccgtttccgtttccgtttccgtttc 2533857 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 2533880 cgtttccgtttccgtttccgtttc 2533857 Score = 46.1 bits (23), Expect = 0.22 Identities = 26/27 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcggt 767 ||||||||||||||||||||| ||||| Sbjct: 2533874 cgtttccgtttccgtttccgtatcggt 2533848
>ref|NM_114807.2| Arabidopsis thaliana unknown protein (AT3G49470) mRNA, complete cds Length = 938 Score = 50.1 bits (25), Expect = 0.014 Identities = 37/41 (90%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484 |||||||| ||||||||||||||||| ||||||| ||||| Sbjct: 447 atattcggtgaggccaagatcgaggatttgagctctcagct 487
>gb|AC125081.3| Mus musculus BAC clone RP24-89D17 from chromosome 3, complete sequence Length = 220895 Score = 50.1 bits (25), Expect = 0.014 Identities = 31/33 (93%) Strand = Plus / Plus Query: 738 cttcgtttccgtttccgtttccgtttcggtttc 770 |||| |||||||||||||||||||||| ||||| Sbjct: 157668 cttcttttccgtttccgtttccgtttccgtttc 157700
>gb|AY072536.1| Arabidopsis thaliana alpha NAC-like protein (At3g49470; T9C5.70) mRNA, complete cds Length = 706 Score = 50.1 bits (25), Expect = 0.014 Identities = 37/41 (90%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484 |||||||| ||||||||||||||||| ||||||| ||||| Sbjct: 364 atattcggtgaggccaagatcgaggatttgagctctcagct 404
>emb|AL132964.2|ATT9C5 Arabidopsis thaliana DNA chromosome 3, BAC clone T9C5 Length = 104204 Score = 50.1 bits (25), Expect = 0.014 Identities = 37/41 (90%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484 |||||||| ||||||||||||||||| ||||||| ||||| Sbjct: 17635 atattcggtgaggccaagatcgaggatttgagctctcagct 17675
>gb|AF370545.1|AF370545 Arabidopsis thaliana alpha NAC-like protein (T9C5.70) mRNA, complete cds Length = 966 Score = 50.1 bits (25), Expect = 0.014 Identities = 37/41 (90%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484 |||||||| ||||||||||||||||| ||||||| ||||| Sbjct: 447 atattcggtgaggccaagatcgaggatttgagctctcagct 487
>gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete sequence Length = 80367 Score = 50.1 bits (25), Expect = 0.014 Identities = 37/41 (90%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484 |||||||| ||||||||||||||||| ||||||| ||||| Sbjct: 62775 atattcggtgaggccaagatcgaggatttgagctctcagct 62815
>ref|XM_949594.1| Theileria annulata strain Ankara hypothetical protein (TA19445) partial mRNA Length = 1881 Score = 50.1 bits (25), Expect = 0.014 Identities = 28/29 (96%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttcggtttc 770 ||||||||||||||||||||||| ||||| Sbjct: 494 gtttccgtttccgtttccgtttccgtttc 466 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 489 cgtttccgtttccgtttccgtttc 466 Score = 46.1 bits (23), Expect = 0.22 Identities = 26/27 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcggt 767 ||||||||||||||||||||| ||||| Sbjct: 483 cgtttccgtttccgtttccgtatcggt 457
>emb|BX825921.1|CNS0A553 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL72ZG01 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 923 Score = 50.1 bits (25), Expect = 0.014 Identities = 37/41 (90%) Strand = Plus / Plus Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484 |||||||| ||||||||||||||||| ||||||| ||||| Sbjct: 425 atattcggtgaggccaagatcgaggatttgagctctcagct 465
>dbj|AP004512.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10L16, TM0042, complete sequence Length = 85815 Score = 50.1 bits (25), Expect = 0.014 Identities = 28/29 (96%) Strand = Plus / Minus Query: 735 tttcttcgtttccgtttccgtttccgttt 763 ||||| ||||||||||||||||||||||| Sbjct: 45017 tttctccgtttccgtttccgtttccgttt 44989 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 745 tccgtttccgtttccgtttcggttt 769 |||||||||||||||||||| |||| Sbjct: 45013 tccgtttccgtttccgtttccgttt 44989
>gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete sequence Length = 23011544 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Minus Query: 740 tcgtttccgtttccgtttccgtttcggtttcg 771 ||||||| |||||||||||||||||| ||||| Sbjct: 2868026 tcgtttctgtttccgtttccgtttcgctttcg 2867995
>gb|AE014298.4| Drosophila melanogaster chromosome X, complete sequence Length = 22422827 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccgtt 762 |||||||||||||||||||||||| Sbjct: 3237280 ttcgtttccgtttccgtttccgtt 3237257 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Plus Query: 742 gtttccgtttccgtttccgtttcg 765 |||||||||||||||||||||||| Sbjct: 12128711 gtttccgtttccgtttccgtttcg 12128734 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgttt 763 |||||||||||||||||||||| Sbjct: 8410184 gtttccgtttccgtttccgttt 8410163 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 agaagaagagccgcaaggcca 318 ||||||||||||||||||||| Sbjct: 4789776 agaagaagagccgcaaggcca 4789796 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 743 tttccgtttccgtttccgttt 763 ||||||||||||||||||||| Sbjct: 12979475 tttccgtttccgtttccgttt 12979455
>ref|XM_362390.1| Magnaporthe grisea 70-15 hypothetical protein (MG04836.4) partial mRNA Length = 1464 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 115 cgtttccgtttccgtttccgtttc 92 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 746 ccgtttccgtttccgtttcggtttc 770 ||||||||||||||||||| ||||| Sbjct: 116 ccgtttccgtttccgtttccgtttc 92
>ref|XM_001004040.1| PREDICTED: Mus musculus cDNA sequence AB182283 (AB182283), mRNA Length = 4896 Score = 48.1 bits (24), Expect = 0.057 Identities = 60/72 (83%) Strand = Plus / Plus Query: 402 aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461 |||||||| || ||||||||||| | || || || |||||| | || || ||||||||| Sbjct: 4480 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4539 Query: 462 atcgaggacctg 473 |||||||||||| Sbjct: 4540 atcgaggacctg 4551
>ref|XM_109794.6| PREDICTED: Mus musculus cDNA sequence AB182283, transcript variant 1 (AB182283), mRNA Length = 4896 Score = 48.1 bits (24), Expect = 0.057 Identities = 60/72 (83%) Strand = Plus / Plus Query: 402 aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461 |||||||| || ||||||||||| | || || || |||||| | || || ||||||||| Sbjct: 4480 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4539 Query: 462 atcgaggacctg 473 |||||||||||| Sbjct: 4540 atcgaggacctg 4551
>ref|NM_121388.4| Arabidopsis thaliana unknown protein (AT5G13850) mRNA, complete cds Length = 842 Score = 48.1 bits (24), Expect = 0.057 Identities = 33/36 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488 ||||||||||| ||||| ||||||||||||||||| Sbjct: 380 gaggccaagatagaggatttgagctcgcagctgcag 415
>ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polypeptide-associated complex alpha subunit, muscle-specific form (Alpha-NAC, muscle-specific form) (LOC531208), mRNA Length = 8513 Score = 48.1 bits (24), Expect = 0.057 Identities = 33/36 (91%) Strand = Plus / Plus Query: 438 tacgtgatattcggggaggccaagatcgaggacctg 473 |||||| | ||||| ||||||||||||||||||||| Sbjct: 7960 tacgtggtcttcggcgaggccaagatcgaggacctg 7995 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 8236 gacatcgtcaacgccatcatggagct 8261
>gb|BT014875.1| Arabidopsis thaliana At5g13850 gene, complete cds Length = 615 Score = 48.1 bits (24), Expect = 0.057 Identities = 33/36 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488 ||||||||||| ||||| ||||||||||||||||| Sbjct: 331 gaggccaagatagaggatttgagctcgcagctgcag 366
>ref|NM_167320.1| Drosophila melanogaster CG32655-RA (CG32655), mRNA Length = 993 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttcg 765 |||||||||||||||||||||||| Sbjct: 986 gtttccgtttccgtttccgtttcg 963
>ref|NM_164510.2| Drosophila melanogaster CG2991-RC, transcript variant C (CG2991), mRNA Length = 2892 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Minus Query: 740 tcgtttccgtttccgtttccgtttcggtttcg 771 ||||||| |||||||||||||||||| ||||| Sbjct: 2365 tcgtttctgtttccgtttccgtttcgctttcg 2334
>ref|NM_164509.2| Drosophila melanogaster CG2991-RA, transcript variant A (CG2991), mRNA Length = 3098 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Minus Query: 740 tcgtttccgtttccgtttccgtttcggtttcg 771 ||||||| |||||||||||||||||| ||||| Sbjct: 2571 tcgtttctgtttccgtttccgtttcgctttcg 2540
>ref|NM_134881.5| Drosophila melanogaster CG2991-RB, transcript variant B (CG2991), mRNA Length = 3008 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Minus Query: 740 tcgtttccgtttccgtttccgtttcggtttcg 771 ||||||| |||||||||||||||||| ||||| Sbjct: 2481 tcgtttctgtttccgtttccgtttcgctttcg 2450
>gb|AY070417.1| Arabidopsis thaliana At5g13850 mRNA sequence Length = 818 Score = 48.1 bits (24), Expect = 0.057 Identities = 33/36 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488 ||||||||||| ||||| ||||||||||||||||| Sbjct: 374 gaggccaagatagaggatttgagctcgcagctgcag 409
>ref|XM_752185.1| Ustilago maydis 521 hypothetical protein (UM01131.1) partial mRNA Length = 2646 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 2557 cgtttccgtttccgtttccgtttc 2534 Score = 44.1 bits (22), Expect = 0.88 Identities = 28/30 (93%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||| ||||||||||||||||||| ||||| Sbjct: 2563 cgttgccgtttccgtttccgtttccgtttc 2534
>gb|AC105351.2| Drosophila melanogaster X BAC RP98-34B12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179795 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Plus Query: 739 ttcgtttccgtttccgtttccgtt 762 |||||||||||||||||||||||| Sbjct: 29815 ttcgtttccgtttccgtttccgtt 29838
>ref|XM_742602.1| Aspergillus fumigatus Af293 nascent polypeptide-associated complex subunit (Afu6g03820) partial mRNA Length = 615 Score = 48.1 bits (24), Expect = 0.057 Identities = 27/28 (96%) Strand = Plus / Plus Query: 447 ttcggggaggccaagatcgaggacctga 474 ||||| |||||||||||||||||||||| Sbjct: 295 ttcggtgaggccaagatcgaggacctga 322
>gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185848 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttcg 765 |||||||||||||||||||||||| Sbjct: 132602 gtttccgtttccgtttccgtttcg 132579
>gb|AC023690.3| Drosophila melanogaster X BAC RP98-6M20 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 176233 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Plus Query: 742 gtttccgtttccgtttccgtttcg 765 |||||||||||||||||||||||| Sbjct: 176102 gtttccgtttccgtttccgtttcg 176125
>dbj|AB182283.1| Mus musculus mKIAA0363 mRNA for mKIAA0363 protein, partial cds Length = 4409 Score = 48.1 bits (24), Expect = 0.057 Identities = 60/72 (83%) Strand = Plus / Plus Query: 402 aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461 |||||||| || ||||||||||| | || || || |||||| | || || ||||||||| Sbjct: 3997 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4056 Query: 462 atcgaggacctg 473 |||||||||||| Sbjct: 4057 atcgaggacctg 4068
>gb|AC009392.6| Drosophila melanogaster, chromosome 2L, region 23A-23E, BAC clone BACR42J13, complete sequence Length = 179125 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Minus Query: 740 tcgtttccgtttccgtttccgtttcggtttcg 771 ||||||| |||||||||||||||||| ||||| Sbjct: 143867 tcgtttctgtttccgtttccgtttcgctttcg 143836
>gb|AF303741.1|AF303741 Chilo iridescent virus complete genome Length = 212482 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 110544 cgtttccgtttccgtttccgtttc 110521 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Minus Query: 745 tccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||| ||||| Sbjct: 110546 tccgtttccgtttccgtttccgtttc 110521
>emb|AL121800.1|DMBN5I9 Drosophila melanogaster BAC clone BACN5I9 Length = 96433 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Plus Query: 739 ttcgtttccgtttccgtttccgtt 762 |||||||||||||||||||||||| Sbjct: 53348 ttcgtttccgtttccgtttccgtt 53371
>ref|NM_204641.1| Gallus gallus FK506 binding protein 3, 25kDa (FKBP3), mRNA emb|AJ312905.1|GGA312905 Gallus gallus mRNA for putative FK506-binding protein (FKBP25 gene) Length = 893 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Plus Query: 132 aaggccgaggagcccgcggaggacggggcgcc 163 ||||||||||||||||||||||| ||| |||| Sbjct: 323 aaggccgaggagcccgcggaggaggggccgcc 354
>gb|BT006012.1| Drosophila melanogaster LD08641 full insert cDNA Length = 3111 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Minus Query: 740 tcgtttccgtttccgtttccgtttcggtttcg 771 ||||||| |||||||||||||||||| ||||| Sbjct: 2571 tcgtttctgtttccgtttccgtttcgctttcg 2540
>gb|AC154857.2| Mus musculus BAC clone RP23-16K21 from chromosome 13, complete sequence Length = 214859 Score = 48.1 bits (24), Expect = 0.057 Identities = 27/28 (96%) Strand = Plus / Minus Query: 743 tttccgtttccgtttccgtttcggtttc 770 |||||||||||||||||||||| ||||| Sbjct: 159687 tttccgtttccgtttccgtttccgtttc 159660 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 159683 cgtttccgtttccgtttccgtttc 159660
>dbj|AB005230.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAC12 Length = 74613 Score = 48.1 bits (24), Expect = 0.057 Identities = 33/36 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488 ||||||||||| ||||| ||||||||||||||||| Sbjct: 22865 gaggccaagatagaggatttgagctcgcagctgcag 22900
>emb|BX830689.1|CNS09ZFD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS14ZE05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 678 Score = 48.1 bits (24), Expect = 0.057 Identities = 33/36 (91%) Strand = Plus / Plus Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488 ||||||||||| ||||| ||||||||||||||||| Sbjct: 380 gaggccaagatagaggatttgagctcgcagctgcag 415
>gb|BC072589.1| Mus musculus similar to mKIAA0363 protein, mRNA (cDNA clone IMAGE:5721236) Length = 4914 Score = 48.1 bits (24), Expect = 0.057 Identities = 60/72 (83%) Strand = Plus / Plus Query: 402 aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461 |||||||| || ||||||||||| | || || || |||||| | || || ||||||||| Sbjct: 4480 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4539 Query: 462 atcgaggacctg 473 |||||||||||| Sbjct: 4540 atcgaggacctg 4551
>emb|AJ404610.1|LIN404610 Leishmania infantum mRNA for nascent polypeptide associated complex homologue, alpha chain Length = 1321 Score = 48.1 bits (24), Expect = 0.057 Identities = 51/60 (85%) Strand = Plus / Plus Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721 ||||||| ||||||| |||||| || ||||||||||||||| | ||||||||||||| Sbjct: 567 caaggccatcaaggcgctcaagaacaacaacggcgacatcgtcaacaccatcatggagct 626
>ref|XM_722229.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06639) partial mRNA Length = 681 Score = 48.1 bits (24), Expect = 0.057 Identities = 27/28 (96%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttcggttt 769 ||||||||||||||||||||||| |||| Sbjct: 471 gtttccgtttccgtttccgtttccgttt 444 Score = 46.1 bits (23), Expect = 0.22 Identities = 23/23 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgttt 763 ||||||||||||||||||||||| Sbjct: 466 cgtttccgtttccgtttccgttt 444
>gb|AC007765.1|AC007765 Drosophila melanogaster, chromosome 2L, region 23C1-23C5, P1 clones DS02190 and DS00906, complete sequence Length = 163403 Score = 48.1 bits (24), Expect = 0.057 Identities = 30/32 (93%) Strand = Plus / Plus Query: 740 tcgtttccgtttccgtttccgtttcggtttcg 771 ||||||| |||||||||||||||||| ||||| Sbjct: 162428 tcgtttctgtttccgtttccgtttcgctttcg 162459
>ref|XM_883488.1| Leishmania major strain Friedlin nascent polypeptide associated complex subunit (L4830.07) partial mRNA Length = 519 Score = 48.1 bits (24), Expect = 0.057 Identities = 51/60 (85%) Strand = Plus / Plus Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721 ||||||| |||||||||||||| || |||||||||| |||| | ||||||||||||| Sbjct: 450 caaggccatcaaggccctcaagaacaacaacggcgacattgtcaacaccatcatggagct 509
>gb|AC007478.1|AC007478 Arabidopsis thaliana BAC F15A18 from chromosome V near 68.5 cM, complete sequence Length = 107931 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 50300 cgtttccgtttccgtttccgtttc 50277
>emb|AJ871913.1| Coffea canephora subsp. canephora microsatellite DNA, clone rev 95C05 Length = 1155 Score = 48.1 bits (24), Expect = 0.057 Identities = 24/24 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttc 764 |||||||||||||||||||||||| Sbjct: 800 cgtttccgtttccgtttccgtttc 777 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 746 ccgtttccgtttccgtttcggtttc 770 ||||||||||||||||||| ||||| Sbjct: 801 ccgtttccgtttccgtttccgtttc 777
>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence Length = 21146708 Score = 46.1 bits (23), Expect = 0.22 Identities = 26/27 (96%) Strand = Plus / Minus Query: 746 ccgtttccgtttccgtttcggtttcga 772 ||||||||||||||||||| ||||||| Sbjct: 12215713 ccgtttccgtttccgtttcagtttcga 12215687 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 737 tcttcgtttccgtttccgtttc 758 |||||||||||||||||||||| Sbjct: 6885842 tcttcgtttccgtttccgtttc 6885821 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Minus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 8647405 gacatcgtcaacgccatcatggagct 8647380 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcg 765 |||||||||||||||||| |||||| Sbjct: 12215712 cgtttccgtttccgtttcagtttcg 12215688
>ref|XM_708425.1| Candida albicans SC5314 hypothetical protein (CaO19.11329), mRNA Length = 1293 Score = 46.1 bits (23), Expect = 0.22 Identities = 23/23 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttc 764 ||||||||||||||||||||||| Sbjct: 1202 gtttccgtttccgtttccgtttc 1180
>ref|XM_708386.1| Candida albicans SC5314 hypothetical protein (CaO19.3848), mRNA Length = 1293 Score = 46.1 bits (23), Expect = 0.22 Identities = 23/23 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttc 764 ||||||||||||||||||||||| Sbjct: 1202 gtttccgtttccgtttccgtttc 1180
>gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0034O04, complete sequence Length = 164882 Score = 46.1 bits (23), Expect = 0.22 Identities = 23/23 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttc 764 ||||||||||||||||||||||| Sbjct: 51676 gtttccgtttccgtttccgtttc 51654
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11 Length = 28386948 Score = 46.1 bits (23), Expect = 0.22 Identities = 23/23 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgtttc 764 ||||||||||||||||||||||| Sbjct: 5841792 gtttccgtttccgtttccgtttc 5841770 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 582 gaggaggaggtggtggacgaga 603 |||||||||||||||||||||| Sbjct: 12643585 gaggaggaggtggtggacgaga 12643564
>gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, region 52E-53A, BAC clone BACR25I17, complete sequence Length = 157835 Score = 46.1 bits (23), Expect = 0.22 Identities = 26/27 (96%) Strand = Plus / Minus Query: 746 ccgtttccgtttccgtttcggtttcga 772 ||||||||||||||||||| ||||||| Sbjct: 89548 ccgtttccgtttccgtttcagtttcga 89522 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcg 765 |||||||||||||||||| |||||| Sbjct: 89547 cgtttccgtttccgtttcagtttcg 89523
>gb|AC008230.4|AC008230 Drosophila melanogaster, chromosome 2R, region 53A-53C, BAC clone BACR17I17, complete sequence Length = 159640 Score = 46.1 bits (23), Expect = 0.22 Identities = 26/27 (96%) Strand = Plus / Minus Query: 746 ccgtttccgtttccgtttcggtttcga 772 ||||||||||||||||||| ||||||| Sbjct: 66098 ccgtttccgtttccgtttcagtttcga 66072 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcg 765 |||||||||||||||||| |||||| Sbjct: 66097 cgtttccgtttccgtttcagtttcg 66073
>ref|XM_001222367.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_06273) mRNA, complete cds Length = 570 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 447 ttcggggaggccaagatcgaggacct 472 ||||| |||||||||||||||||||| Sbjct: 304 ttcggcgaggccaagatcgaggacct 329
>dbj|AK242375.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J080039F09, full insert sequence Length = 1373 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 572 cgtcgccgacgaggaggaggtggtgg 597 ||||||||| |||||||||||||||| Sbjct: 677 cgtcgccgaggaggaggaggtggtgg 702
>ref|NM_001074299.1| Oryza sativa (japonica cultivar-group) Os11g0421800 (Os11g0421800) mRNA, complete cds Length = 1154 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 582 gaggaggaggtggtggacgaga 603 |||||||||||||||||||||| Sbjct: 311 gaggaggaggtggtggacgaga 332
>gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete sequence Length = 24543557 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 742 gtttccgtttccgtttccgttt 763 |||||||||||||||||||||| Sbjct: 8463803 gtttccgtttccgtttccgttt 8463824
>gb|AE014297.2| Drosophila melanogaster chromosome 3R, complete sequence Length = 27905053 Score = 44.1 bits (22), Expect = 0.88 Identities = 31/34 (91%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccgtttcggtttcga 772 ||||||| |||||||||||||| ||| ||||||| Sbjct: 5290150 ttcgttttcgtttccgtttccgcttctgtttcga 5290117 Score = 42.1 bits (21), Expect = 3.5 Identities = 30/33 (90%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccgtttcggtttcg 771 ||||||||| ||||| ||||| ||||||||||| Sbjct: 10334251 ttcgtttccatttccatttccatttcggtttcg 10334219 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 742 gtttccgtttccgtttccgtttcggtttc 770 ||||| ||||||||||| ||||||||||| Sbjct: 14757162 gtttcagtttccgtttcagtttcggtttc 14757190
>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome Length = 3696649 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 682 aggcgcacgacggcgacatcgt 703 |||||||||||||||||||||| Sbjct: 3021226 aggcgcacgacggcgacatcgt 3021205
>ref|NM_202414.1| Arabidopsis thaliana ICS1 (ISOCHORISMATE SYNTHASEI); isochorismate synthase (ICS1) mRNA, complete cds Length = 2120 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 552 cgtttccgtttccgtttccgtt 531 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 555 ttccgtttccgtttccgtttc 535
>ref|NM_106129.2| Arabidopsis thaliana ICS1 (ISOCHORISMATE SYNTHASEI); isochorismate synthase (ICS1) mRNA, complete cds Length = 2051 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 553 cgtttccgtttccgtttccgtt 532 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 556 ttccgtttccgtttccgtttc 536
>gb|AC146939.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0064M09 map near S6115, complete sequence Length = 215240 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 582 gaggaggaggtggtggacgaga 603 |||||||||||||||||||||| Sbjct: 26261 gaggaggaggtggtggacgaga 26240
>gb|AY260902.1| Rhodospirillum centenum che2 gene cluster, complete sequence Length = 11332 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 674 ggccctcaaggcgcacgacggc 695 |||||||||||||||||||||| Sbjct: 10747 ggccctcaaggcgcacgacggc 10726
>gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete sequence Length = 182105 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Minus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 23159 gacatcgtcaacgccatcatggagct 23134
>gb|AY317248.1| Mus musculus olfactory receptor Olfr164 (Olfr164) gene, complete cds Length = 942 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 362 taccatcaagagagccaagaac 383 |||||||||||||||||||||| Sbjct: 472 taccatcaagagagccaagaac 451
>ref|XM_543223.2| PREDICTED: Canis familiaris similar to protease, serine, 12, transcript variant 1 (LOC486097), mRNA Length = 1835 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 482 gctgcaggcgcaggcggcgcag 503 |||||||||||||||||||||| Sbjct: 815 gctgcaggcgcaggcggcgcag 836
>gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequence Length = 198 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 163 gacatcgtcaacgccatcatggagct 188
>ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide associated complex protein alpha subunit CG8759-RC, transcript variant C (Nacalpha), mRNA Length = 874 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 672 gacatcgtcaacgccatcatggagct 697
>ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide associated complex protein alpha subunit CG8759-RA, transcript variant A (Nacalpha), mRNA Length = 870 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 663 gacatcgtcaacgccatcatggagct 688
>gb|AC112681.12| Mus musculus chromosome 16, clone RP23-272P19, complete sequence Length = 228367 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 362 taccatcaagagagccaagaac 383 |||||||||||||||||||||| Sbjct: 115271 taccatcaagagagccaagaac 115292
>ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide associated complex protein alpha subunit CG8759-RB, transcript variant B (Nacalpha), mRNA Length = 897 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 690 gacatcgtcaacgccatcatggagct 715
>gb|AY124864.1| Arabidopsis thaliana At1g74710/F25A4.31 mRNA, complete cds Length = 1710 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 457 cgtttccgtttccgtttccgtt 436 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 460 ttccgtttccgtttccgtttc 440
>gb|AC010041.7| Drosophila melanogaster 3L BAC RP98-13D12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174712 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 742 gtttccgtttccgtttccgttt 763 |||||||||||||||||||||| Sbjct: 108289 gtttccgtttccgtttccgttt 108310
>ref|NM_146451.1| Mus musculus olfactory receptor 164 (Olfr164), mRNA gb|AY073647.1| Mus musculus olfactory receptor MOR279-2 gene, complete cds Length = 948 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 362 taccatcaagagagccaagaac 383 |||||||||||||||||||||| Sbjct: 478 taccatcaagagagccaagaac 457
>gb|AF367342.1| Arabidopsis thaliana F25A4.31/F25A4.31 mRNA, complete cds Length = 2023 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 551 cgtttccgtttccgtttccgtt 530 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 554 ttccgtttccgtttccgtttc 534
>gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA Length = 890 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 661 gacatcgtcaacgccatcatggagct 686
>gb|AY056055.1| Arabidopsis thaliana isochorismate synthase 1 precursor (ICS1) mRNA, complete cds; nuclear gene for plastid product Length = 2057 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 553 cgtttccgtttccgtttccgtt 532 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 556 ttccgtttccgtttccgtttc 536
>emb|BX016202.1|CNS08KNY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 44.1 bits (22), Expect = 0.88 Identities = 46/54 (85%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtcatg 638 ||||||| ||||||||| ||||||||||| | | | |||||||| || |||||| Sbjct: 687 gaggaggaggtggacgataccggcatcgacgacagggacatcgatctggtcatg 634
>emb|BX016201.1|CNS08KNX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 44.1 bits (22), Expect = 0.88 Identities = 46/54 (85%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtcatg 638 ||||||| ||||||||| ||||||||||| | | | |||||||| || |||||| Sbjct: 540 gaggaggaggtggacgataccggcatcgacgacagggacatcgatctggtcatg 593
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 743 tttccgtttccgtttccgtttc 764 |||||||||||||||||||||| Sbjct: 688031 tttccgtttccgtttccgtttc 688052 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 688035 cgtttccgtttccgtttccgtt 688056
>gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, region 47D-47D, BAC clone BACR24G16, complete sequence Length = 165974 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 737 tcttcgtttccgtttccgtttc 758 |||||||||||||||||||||| Sbjct: 79526 tcttcgtttccgtttccgtttc 79505
>dbj|AP003346.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0434C04 Length = 150064 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccg 760 |||||||||||||||||||||| Sbjct: 109395 ttcgtttccgtttccgtttccg 109374
>dbj|AP003431.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1099D03 Length = 191022 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccg 760 |||||||||||||||||||||| Sbjct: 46687 ttcgtttccgtttccgtttccg 46666
>gb|AC010581.3|AC010581 Drosophila melanogaster, chromosome 3R, region 85D-85D, BAC clone BACR19J06, complete sequence Length = 175053 Score = 44.1 bits (22), Expect = 0.88 Identities = 31/34 (91%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccgtttcggtttcga 772 ||||||| |||||||||||||| ||| ||||||| Sbjct: 100083 ttcgttttcgtttccgtttccgcttctgtttcga 100050
>gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete sequence Length = 143681 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Minus Query: 572 cgtcgccgacgaggaggaggtggtgg 597 ||||||||| |||||||||||||||| Sbjct: 44843 cgtcgccgaggaggaggaggtggtgg 44818
>gb|AC018445.21| Homo sapiens chromosome 18, clone RP11-196B3, complete sequence Length = 162265 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 584 ggaggaggtggtggacgagacc 605 |||||||||||||||||||||| Sbjct: 57491 ggaggaggtggtggacgagacc 57470
>gb|AC011765.6|AC011765 Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete sequence Length = 134402 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 128016 cgtttccgtttccgtttccgtt 127995 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 128019 ttccgtttccgtttccgtttc 127999
>dbj|AP005149.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0005G07 Length = 142850 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccg 760 |||||||||||||||||||||| Sbjct: 79286 ttcgtttccgtttccgtttccg 79265
>gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacylglycerol kinase epsilon and ubiquinol-cytochrome C reductase complex genes, complete cds; and unknown gene Length = 4728 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 756 gacatcgtcaacgccatcatggagct 781
>gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa0048I01, complete sequence Length = 193444 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccg 760 |||||||||||||||||||||| Sbjct: 181795 ttcgtttccgtttccgtttccg 181774
>dbj|AP002873.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0552C05 Length = 136586 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 743 tttccgtttccgtttccgtttc 764 |||||||||||||||||||||| Sbjct: 49428 tttccgtttccgtttccgtttc 49449 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 49432 cgtttccgtttccgtttccgtt 49453
>dbj|AP002871.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0475H04 Length = 143337 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 743 tttccgtttccgtttccgtttc 764 |||||||||||||||||||||| Sbjct: 123248 tttccgtttccgtttccgtttc 123269 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 123252 cgtttccgtttccgtttccgtt 123273
>gb|AC023696.4| Drosophila melanogaster X BAC RP98-17J10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174367 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgttt 763 |||||||||||||||||||||| Sbjct: 106420 gtttccgtttccgtttccgttt 106399
>dbj|AK106317.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-101-E02, full insert sequence Length = 1154 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 582 gaggaggaggtggtggacgaga 603 |||||||||||||||||||||| Sbjct: 311 gaggaggaggtggtggacgaga 332
>emb|AL113807.1|CNS01B5J Botrytis cinerea strain T4 cDNA library Length = 679 Score = 44.1 bits (22), Expect = 0.88 Identities = 28/30 (93%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtttcggtttc 770 |||||||| ||||||||||||||| ||||| Sbjct: 562 cgtttccggttccgtttccgtttccgtttc 533
>emb|BX814970.1|CNS0ADXM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS20ZG02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2101 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 535 cgtttccgtttccgtttccgtt 514 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 538 ttccgtttccgtttccgtttc 518
>gb|AC158405.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone B1366F05, complete sequence Length = 171022 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccg 760 |||||||||||||||||||||| Sbjct: 71396 ttcgtttccgtttccgtttccg 71375 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Minus Query: 739 ttcgtttccgtttccgtttccgtttc 764 ||||||| |||||||||||||||||| Sbjct: 71402 ttcgttttcgtttccgtttccgtttc 71377
>gb|AF177464.1|AF177464 Drosophila melanogaster Tob homolog (Tob) mRNA, partial cds Length = 1759 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 743 tttccgtttccgtttccgtttc 764 |||||||||||||||||||||| Sbjct: 1567 tttccgtttccgtttccgtttc 1546
>gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F25A4 sequence, complete sequence Length = 115721 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Plus Query: 741 cgtttccgtttccgtttccgtt 762 |||||||||||||||||||||| Sbjct: 103334 cgtttccgtttccgtttccgtt 103355 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 744 ttccgtttccgtttccgtttc 764 ||||||||||||||||||||| Sbjct: 103331 ttccgtttccgtttccgtttc 103351
>gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, region 49C1-49D3, P1 clones DS04499, DS06146, and DS00455, complete sequence Length = 145055 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Minus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 59922 gacatcgtcaacgccatcatggagct 59897
>gb|AY817623.1| Drosophila biarmipes Yellow gene, complete cds Length = 14704 Score = 44.1 bits (22), Expect = 0.88 Identities = 22/22 (100%) Strand = Plus / Minus Query: 742 gtttccgtttccgtttccgttt 763 |||||||||||||||||||||| Sbjct: 300 gtttccgtttccgtttccgttt 279
>emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha subunit Length = 829 Score = 44.1 bits (22), Expect = 0.88 Identities = 25/26 (96%) Strand = Plus / Plus Query: 696 gacatcgtcagcgccatcatggagct 721 |||||||||| ||||||||||||||| Sbjct: 623 gacatcgtcaacgccatcatggagct 648
>gb|CP000462.1| Aeromonas hydrophila subsp. hydrophila ATCC 7966, complete genome Length = 4744448 Score = 42.1 bits (21), Expect = 3.5 Identities = 24/25 (96%) Strand = Plus / Minus Query: 689 cgacggcgacatcgtcagcgccatc 713 |||| |||||||||||||||||||| Sbjct: 581984 cgacagcgacatcgtcagcgccatc 581960
>ref|NM_001051743.1| Oryza sativa (japonica cultivar-group) Os01g0918500 (Os01g0918500) mRNA, partial cds Length = 2834 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 572 cgtcgccgacgaggaggaggtggtggacg 600 |||||||||||||||||||| || ||||| Sbjct: 71 cgtcgccgacgaggaggaggaggaggacg 43
>gb|CP000384.1| Mycobacterium sp. MCS, complete genome Length = 5705448 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 688 acgacggcgacatcgtcagcg 708 ||||||||||||||||||||| Sbjct: 499392 acgacggcgacatcgtcagcg 499412
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 485 gcaggcgcaggcggcgcagca 505 ||||||||||||||||||||| Sbjct: 1858842 gcaggcgcaggcggcgcagca 1858862
>gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete sequence Length = 176395 Score = 42.1 bits (21), Expect = 3.5 Identities = 30/33 (90%) Strand = Plus / Plus Query: 739 ttcgtttccgtttccgtttccgtttcggtttcg 771 ||||||||| ||||| ||||| ||||||||||| Sbjct: 57267 ttcgtttccatttccatttccatttcggtttcg 57299
>gb|AC106887.3| Oryza sativa chromosome 3 BAC OSJNBa0054H04 genomic sequence, complete sequence Length = 159579 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 574 tcgccgacgaggaggaggtgg 594 ||||||||||||||||||||| Sbjct: 110889 tcgccgacgaggaggaggtgg 110909
>ref|NM_131964.1| Drosophila melanogaster CG15470-RA (CG15470), mRNA Length = 1038 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 298 agaagaagagccgcaaggcca 318 ||||||||||||||||||||| Sbjct: 932 agaagaagagccgcaaggcca 952
>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence Length = 2726152 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 489 gcgcaggcggcgcagcagttc 509 ||||||||||||||||||||| Sbjct: 830521 gcgcaggcggcgcagcagttc 830501
>ref|NM_001000041.1| Rattus norvegicus olfactory receptor 1570 (predicted) (Olr1570_predicted), mRNA Length = 942 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 362 taccatcaagagagccaagaa 382 ||||||||||||||||||||| Sbjct: 472 taccatcaagagagccaagaa 452
>gb|AC023711.5| Drosophila melanogaster X BAC RP98-6C4 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174157 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 743 tttccgtttccgtttccgttt 763 ||||||||||||||||||||| Sbjct: 72783 tttccgtttccgtttccgttt 72763
>ref|XM_756736.1| Ustilago maydis 521 hypothetical protein (UM05682.1) partial mRNA Length = 2328 Score = 42.1 bits (21), Expect = 3.5 Identities = 31/33 (93%), Gaps = 1/33 (3%) Strand = Plus / Minus Query: 740 tcgtttccgtttccg-tttccgtttcggtttcg 771 ||||||||||||||| |||| |||||||||||| Sbjct: 1976 tcgtttccgtttccgttttcggtttcggtttcg 1944
>gb|AC023685.4| Drosophila melanogaster 3L BAC RP98-20N12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 167926 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Minus Query: 743 tttccgtttccgtttccgttt 763 ||||||||||||||||||||| Sbjct: 102197 tttccgtttccgtttccgttt 102177
>gb|AE012227.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 135 of 460 of the complete genome Length = 10155 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 478 cgcagctgcaggcgcaggcgg 498 ||||||||||||||||||||| Sbjct: 8072 cgcagctgcaggcgcaggcgg 8092
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2 Length = 35954743 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 575 cgccgacgaggaggaggtggt 595 ||||||||||||||||||||| Sbjct: 11646383 cgccgacgaggaggaggtggt 11646403
>ref|NM_001043571.1| Bombyx mori allatostatin preprohormone (LOC692588), mRNA gb|AF309090.1|AF309090 Bombyx mori allatostatin preprohormone mRNA, complete cds Length = 2066 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 gccgaggagcccgcggaggac 155 ||||||||||||||||||||| Sbjct: 481 gccgaggagcccgcggaggac 501
>emb|BX072038.1|CNS09RQY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 689 gaggaggaggtggacgataccggcatcga 661
>emb|BX072037.1|CNS09RQX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 543 gaggaggaggtggacgataccggcatcga 571
>emb|BX071074.1|CNS09R06 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 727 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 696 gaggaggaggtggacgataccggcatcga 668
>emb|BX071073.1|CNS09R05 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 996 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 546 gaggaggaggtggacgataccggcatcga 574
>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 937 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 230 gaggaggaggtggacgataccggcatcga 202
>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1008 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 723 gaggaggaggtggacgataccggcatcga 751
>emb|BX065975.1|CNS09N2J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 505 gaggaggaggtggacgataccggcatcga 533
>emb|BX064684.1|CNS09M2O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48AF01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 567 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 518 gaggaggaggtggacgataccggcatcga 546
>emb|BX063673.1|CNS09LAL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 797 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 491 gaggaggaggtggacgataccggcatcga 519
>emb|BX061993.1|CNS09JZX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1002 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 711 gaggaggaggtggacgataccggcatcga 683
>emb|BX061992.1|CNS09JZW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1057 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 544 gaggaggaggtggacgataccggcatcga 572
>emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 692 gaggaggaggtggacgataccggcatcga 664
>emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 531 gaggaggaggtggacgataccggcatcga 559
>gb|AF336804.1|AF336804 Bombyx mori bombystatin mRNA, partial cds Length = 686 Score = 42.1 bits (21), Expect = 3.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 135 gccgaggagcccgcggaggac 155 ||||||||||||||||||||| Sbjct: 232 gccgaggagcccgcggaggac 252
>emb|BX054844.1|CNS09EHC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33AG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 454 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 348 gaggaggaggtggacgacaccggcatcga 376
>emb|BX054383.1|CNS09E4J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 717 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 128 gaggaggaggtggacgataccggcatcga 100
>emb|BX054382.1|CNS09E4I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 470 gaggaggaggtggacgataccggcatcga 498
>emb|BX052598.1|CNS09CQY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 789 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 702 gaggaggaggtggacgataccggcatcga 674
>emb|BX052597.1|CNS09CQX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 747 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 205 gaggaggaggtggacgataccggcatcga 233
>emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3AC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 562 gaggaggaggtggacgataccggcatcga 590
>emb|BX051766.1|CNS09C3U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 952 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 694 gaggaggaggtggacgataccggcatcga 666
>emb|BX051765.1|CNS09C3T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 897 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 543 gaggaggaggtggacgataccggcatcga 571
>emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 868 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 694 gaggaggaggtggacgataccggcatcga 666
>emb|BX050825.1|CNS09BDP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 536 gaggaggaggtggacgataccggcatcga 564
>emb|BX049822.1|CNS09ALU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 702 gaggaggaggtggacgataccggcatcga 674
>emb|BX049821.1|CNS09ALT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1007 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 540 gaggaggaggtggacgataccggcatcga 568
>emb|BX045807.1|CNS097IB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 998 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 699 gaggaggaggtggacgataccggcatcga 671
>emb|BX045806.1|CNS097IA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1005 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 539 gaggaggaggtggacgataccggcatcga 567
>emb|BX042049.1|CNS094LX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 697 gaggaggaggtggacgataccggcatcga 669
>emb|BX042048.1|CNS094LW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 535 gaggaggaggtggacgataccggcatcga 563
>emb|BX040221.1|CNS09375 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 696 gaggaggaggtggacgataccggcatcga 668
>emb|BX040220.1|CNS09374 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 700 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 505 gaggaggaggtggacgataccggcatcga 533
>emb|BX037502.1|CNS0913M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1AA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 397 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 247 gaggaggaggtggacgataccggcatcga 219
>emb|BX037471.1|CNS0912R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9DG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 897 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 553 gaggaggaggtggacgataccggcatcga 581
>emb|BX036960.1|CNS090OK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 970 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 709 gaggaggaggtggacgataccggcatcga 681
>emb|BX036959.1|CNS090OJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 565 gaggaggaggtggacgataccggcatcga 593
>emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 805 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 702 gaggaggaggtggacgataccggcatcga 674
>emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 557 gaggaggaggtggacgataccggcatcga 585
>emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 985 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 706 gaggaggaggtggacgataccggcatcga 678
>emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 991 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 556 gaggaggaggtggacgataccggcatcga 584
>emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 692 gaggaggaggtggacgataccggcatcga 664
>emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 542 gaggaggaggtggacgataccggcatcga 570
>emb|BX034217.1|CNS08YKD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA50AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 581 gaggaggaggtggacgataccggcatcga 609
>emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5CH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 634 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 543 gaggaggaggtggacgataccggcatcga 571
>emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 468 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 218 gaggaggaggtggacgataccggcatcga 190
>emb|BX033034.1|CNS08XNI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 785 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 575 gaggaggaggtggacgataccggcatcga 603
>emb|BX030920.1|CNS08W0S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 984 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 710 gaggaggaggtggacgataccggcatcga 682
>emb|BX030919.1|CNS08W0R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1036 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 585 gaggaggaggtggacgataccggcatcga 613
>emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 989 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 563 gaggaggaggtggacgataccggcatcga 591
>emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 971 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 552 gaggaggaggtggacgataccggcatcga 580
>emb|BX029669.1|CNS08V21 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 776 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 589 gaggaggaggtggacgataccggcatcga 561
>emb|BX029668.1|CNS08V20 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44BD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 637 gaggaggaggtggacgataccggcatcga 665
>emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 762 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 589 gaggaggaggtggacgataccggcatcga 561
>emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 567 gaggaggaggtggacgataccggcatcga 595
>emb|BX027756.1|CNS08TKW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41CB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 311 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 226 gaggaggaggtggacgataccggcatcga 198
>emb|BX028005.1|CNS08TRT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 711 gaggaggaggtggacgataccggcatcga 683
>emb|BX028004.1|CNS08TRS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 552 gaggaggaggtggacgataccggcatcga 580
>emb|BX019149.1|CNS08MXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29AE03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 261 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 96 gaggaggaggtggacgataccggcatcga 124
>emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 698 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 533 gaggaggaggtggacgataccggcatcga 505
>emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 998 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 547 gaggaggaggtggacgataccggcatcga 575
>emb|BX022052.1|CNS08P6G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 618 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 591 gaggaggaggtggacgataccggcatcga 563
>emb|BX022051.1|CNS08P6F Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 710 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 554 gaggaggaggtggacgataccggcatcga 582
>emb|BX020483.1|CNS08NYV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30AF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 836 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| || |||||||||||||||||| Sbjct: 561 gaggaggagggggacgagaccggcatcga 589
>emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30AE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 838 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 552 gaggaggaggtggacgataccggcatcga 580
>emb|BX019569.1|CNS08N9H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 828 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 708 gaggaggaggtggacgataccggcatcga 680
>emb|BX018722.1|CNS08MLY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28BG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 563 gaggaggaggtggacgataccggcatcga 591
>emb|BX018239.1|CNS08M8J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 758 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 695 gaggaggaggtggacgataccggcatcga 667
>emb|BX018238.1|CNS08M8I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 843 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 576 gaggaggaggtggacgataccggcatcga 604
>emb|BX017233.1|CNS08LGL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 704 gaggaggaggtggacgataccggcatcga 676
>emb|BX017232.1|CNS08LGK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 893 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 577 gaggaggaggtggacgataccggcatcga 605
>emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25AD02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 811 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 224 gaggaggaggtggacgataccggcatcga 196
>emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 898 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 719 gaggaggaggtggacgataccggcatcga 691
>emb|BX016618.1|CNS08KZI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 569 gaggaggaggtggacgataccggcatcga 597
>dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0413C03 Length = 162161 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 572 cgtcgccgacgaggaggaggtggtggacg 600 |||||||||||||||||||| || ||||| Sbjct: 158393 cgtcgccgacgaggaggaggaggaggacg 158421
>emb|BX016072.1|CNS08KKC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 544 gaggaggaggtggacgataccggcatcga 516
>emb|BX016071.1|CNS08KKB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 446 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 287 gaggaggaggtggacgataccggcatcga 315
>emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 728 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 700 gaggaggaggtggacgataccggcatcga 672
>emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 986 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 539 gaggaggaggtggacgataccggcatcga 567
>dbj|AP003437.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0678F11 Length = 154292 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 572 cgtcgccgacgaggaggaggtggtggacg 600 |||||||||||||||||||| || ||||| Sbjct: 10026 cgtcgccgacgaggaggaggaggaggacg 10054
>emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA22BC11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 42.1 bits (21), Expect = 3.5 Identities = 27/29 (93%) Strand = Plus / Minus Query: 585 gaggaggtggtggacgagaccggcatcga 613 ||||||| ||||||||| ||||||||||| Sbjct: 697 gaggaggaggtggacgataccggcatcga 669 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 106,860,001 Number of extensions: 5988805 Number of successful extensions: 158202 Number of sequences better than 10.0: 281 Number of HSP's gapped: 158118 Number of HSP's successfully gapped: 378 Length of query: 927 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 904 Effective length of database: 18,503,978,556 Effective search space: 16727596614624 Effective search space used: 16727596614624 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)