ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf74i17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001055330.1| Oryza sativa (japonica cultivar-group) Os03g... 391 e-105
2dbj|AK099300.1| Oryza sativa (japonica cultivar-group) cDNA clon... 391 e-105
3gb|AY224519.1| Oryza sativa (japonica cultivar-group) isolate 20... 383 e-103
4dbj|AK059982.1| Oryza sativa (japonica cultivar-group) cDNA clon... 383 e-103
5ref|NM_001050511.1| Oryza sativa (japonica cultivar-group) Os01g... 333 7e-88
6gb|AC105363.2| Oryza sativa (japonica cultivar-group) chromosome... 234 5e-58
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 234 5e-58
8dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 192 2e-45
9dbj|AP003254.3| Oryza sativa (japonica cultivar-group) genomic D... 192 2e-45
10dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 161 5e-36
11dbj|AP005438.5| Oryza sativa (japonica cultivar-group) genomic D... 161 5e-36
12gb|BT016475.1| Zea mays clone Contig308 mRNA sequence 117 7e-23
13emb|CT983009.1| partial cDNA sequence from a Lambda ZAP II norma... 92 4e-15
14dbj|AP006123.1| Lotus japonicus genomic DNA, chromosome 1, clone... 82 4e-12
15gb|DQ245285.1| Zea mays clone 14302 mRNA sequence 80 2e-11
16gb|BT016765.1| Zea mays clone Contig598 mRNA sequence 80 2e-11
17gb|AY103873.1| Zea mays PCO094039 mRNA sequence 80 2e-11
18ref|NM_001061904.1| Oryza sativa (japonica cultivar-group) Os05g... 76 3e-10
19gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome... 76 3e-10
20gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome... 76 3e-10
21dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 76 3e-10
22dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for ... 76 3e-10
23dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 3e-10
24gb|DQ245786.1| Zea mays clone 20335 mRNA sequence 70 2e-08
25dbj|AK226309.1| Arabidopsis thaliana mRNA for putative alpha NAC... 68 6e-08
26ref|NM_117116.2| Arabidopsis thaliana unknown protein (AT4G10480... 68 6e-08
27gb|AY096615.1| Arabidopsis thaliana putative alpha NAC protein (... 68 6e-08
28gb|AY045811.1| Arabidopsis thaliana putative alpha NAC protein (... 68 6e-08
29gb|AY114656.1| Arabidopsis thaliana putative alpha NAC (At4g1048... 68 6e-08
30gb|AY062724.1| Arabidopsis thaliana putative alpha NAC (At4g1048... 68 6e-08
31emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, ... 68 6e-08
32emb|AL049524.1|ATF7L13 Arabidopsis thaliana DNA chromosome 4, BA... 68 6e-08
33gb|AF118222.1|F3H7 Arabidopsis thaliana BAC F3H7 68 6e-08
34ref|NM_001051878.1| Oryza sativa (japonica cultivar-group) Os01g... 64 1e-06
35dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clon... 64 1e-06
36dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 1e-06
37dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 1e-06
38dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 1e-06
39dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic D... 62 4e-06
40dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic D... 62 4e-06
41emb|CT982808.1| partial cDNA sequence from a Lambda ZAP II norma... 58 6e-05
42emb|CT982049.1| partial cDNA sequence from a Lambda ZAP II norma... 58 6e-05
43gb|AC119415.13| Medicago truncatula clone mth2-27n2, complete se... 58 6e-05
44dbj|AK110559.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 6e-05
45ref|NW_001081896.1| Leishmania major strain Friedlin chromosome ... 56 2e-04
46gb|AC109219.13| Mus musculus chromosome 1, clone RP23-429I18, co... 56 2e-04
47gb|AC110232.15| Mus musculus chromosome 1, clone RP23-67H24, com... 56 2e-04
48ref|XM_883486.1| Leishmania major strain Friedlin nascent polype... 56 2e-04
49gb|AC109195.27| Mus musculus chromosome 15, clone RP24-212B11, c... 52 0.004
50gb|AC154227.2| Mus musculus BAC clone RP24-142A23 from chromosom... 52 0.004
51gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, co... 52 0.004
52ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent ... 52 0.004
53gb|AC105969.17| Mus musculus chromosome 15, clone RP23-477B23, c... 52 0.004
54emb|AL115467.1|CNS01CFN Botrytis cinerea strain T4 cDNA library 52 0.004
55emb|CT029334.1| Poplar cDNA sequences 50 0.014
56ref|NW_001091929.1| Theileria annulata strain Ankara clone C9 50 0.014
57ref|NM_114807.2| Arabidopsis thaliana unknown protein (AT3G49470... 50 0.014
58gb|AC125081.3| Mus musculus BAC clone RP24-89D17 from chromosome... 50 0.014
59gb|AY072536.1| Arabidopsis thaliana alpha NAC-like protein (At3g... 50 0.014
60emb|AL132964.2|ATT9C5 Arabidopsis thaliana DNA chromosome 3, BAC... 50 0.014
61gb|AF370545.1|AF370545 Arabidopsis thaliana alpha NAC-like prote... 50 0.014
62gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G... 50 0.014
63ref|XM_949594.1| Theileria annulata strain Ankara hypothetical p... 50 0.014
64emb|BX825921.1|CNS0A553 Arabidopsis thaliana Full-length cDNA Co... 50 0.014
65dbj|AP004512.1| Lotus japonicus genomic DNA, chromosome 4, clone... 50 0.014
66gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete s... 48 0.057
67gb|AE014298.4| Drosophila melanogaster chromosome X, complete se... 48 0.057
68ref|XM_362390.1| Magnaporthe grisea 70-15 hypothetical protein (... 48 0.057
69ref|XM_001004040.1| PREDICTED: Mus musculus cDNA sequence AB1822... 48 0.057
70ref|XM_109794.6| PREDICTED: Mus musculus cDNA sequence AB182283,... 48 0.057
71ref|NM_121388.4| Arabidopsis thaliana unknown protein (AT5G13850... 48 0.057
72ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polype... 48 0.057
73gb|BT014875.1| Arabidopsis thaliana At5g13850 gene, complete cds 48 0.057
74ref|NM_167320.1| Drosophila melanogaster CG32655-RA (CG32655), mRNA 48 0.057
75ref|NM_164510.2| Drosophila melanogaster CG2991-RC, transcript v... 48 0.057
76ref|NM_164509.2| Drosophila melanogaster CG2991-RA, transcript v... 48 0.057
77ref|NM_134881.5| Drosophila melanogaster CG2991-RB, transcript v... 48 0.057
78gb|AY070417.1| Arabidopsis thaliana At5g13850 mRNA sequence 48 0.057
79ref|XM_752185.1| Ustilago maydis 521 hypothetical protein (UM011... 48 0.057
80gb|AC105351.2| Drosophila melanogaster X BAC RP98-34B12 (Roswell... 48 0.057
81ref|XM_742602.1| Aspergillus fumigatus Af293 nascent polypeptide... 48 0.057
82gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell ... 48 0.057
83gb|AC023690.3| Drosophila melanogaster X BAC RP98-6M20 (Roswell ... 48 0.057
84dbj|AB182283.1| Mus musculus mKIAA0363 mRNA for mKIAA0363 protei... 48 0.057
85gb|AC009392.6| Drosophila melanogaster, chromosome 2L, region 23... 48 0.057
86gb|AF303741.1|AF303741 Chilo iridescent virus complete genome 48 0.057
87emb|AL121800.1|DMBN5I9 Drosophila melanogaster BAC clone BACN5I9 48 0.057
88ref|NM_204641.1| Gallus gallus FK506 binding protein 3, 25kDa (F... 48 0.057
89gb|BT006012.1| Drosophila melanogaster LD08641 full insert cDNA 48 0.057
90gb|AC154857.2| Mus musculus BAC clone RP23-16K21 from chromosome... 48 0.057
91dbj|AB005230.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... 48 0.057
92emb|BX830689.1|CNS09ZFD Arabidopsis thaliana Full-length cDNA Co... 48 0.057
93gb|BC072589.1| Mus musculus similar to mKIAA0363 protein, mRNA (... 48 0.057
94emb|AJ404610.1|LIN404610 Leishmania infantum mRNA for nascent po... 48 0.057
95ref|XM_722229.1| Plasmodium yoelii yoelii str. 17XNL hypothetica... 48 0.057
96gb|AC007765.1|AC007765 Drosophila melanogaster, chromosome 2L, r... 48 0.057
97ref|XM_883488.1| Leishmania major strain Friedlin nascent polype... 48 0.057
98gb|AC007478.1|AC007478 Arabidopsis thaliana BAC F15A18 from chro... 48 0.057
99emb|AJ871913.1| Coffea canephora subsp. canephora microsatellite... 48 0.057
100gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete s... 46 0.22
101ref|XM_708425.1| Candida albicans SC5314 hypothetical protein (C... 46 0.22
102ref|XM_708386.1| Candida albicans SC5314 hypothetical protein (C... 46 0.22
103gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.22
104dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.22
105gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, r... 46 0.22
106gb|AC008230.4|AC008230 Drosophila melanogaster, chromosome 2R, r... 46 0.22
107ref|XM_001222367.1| Chaetomium globosum CBS 148.51 hypothetical ... 44 0.88
108dbj|AK242375.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 44 0.88
109ref|NM_001074299.1| Oryza sativa (japonica cultivar-group) Os11g... 44 0.88
110gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete s... 44 0.88
111gb|AE014297.2| Drosophila melanogaster chromosome 3R, complete s... 44 0.88
112gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 44 0.88
113ref|NM_202414.1| Arabidopsis thaliana ICS1 (ISOCHORISMATE SYNTHA... 44 0.88
114ref|NM_106129.2| Arabidopsis thaliana ICS1 (ISOCHORISMATE SYNTHA... 44 0.88
115gb|AC146939.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.88
116gb|AY260902.1| Rhodospirillum centenum che2 gene cluster, comple... 44 0.88
117gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete... 44 0.88
118gb|AY317248.1| Mus musculus olfactory receptor Olfr164 (Olfr164)... 44 0.88
119ref|XM_543223.2| PREDICTED: Canis familiaris similar to protease... 44 0.88
120gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequ... 44 0.88
121ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide ass... 44 0.88
122ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide ass... 44 0.88
123gb|AC112681.12| Mus musculus chromosome 16, clone RP23-272P19, c... 44 0.88
124ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide ass... 44 0.88
125gb|AY124864.1| Arabidopsis thaliana At1g74710/F25A4.31 mRNA, com... 44 0.88
126gb|AC010041.7| Drosophila melanogaster 3L BAC RP98-13D12 (Roswel... 44 0.88
127ref|NM_146451.1| Mus musculus olfactory receptor 164 (Olfr164), ... 44 0.88
128gb|AF367342.1| Arabidopsis thaliana F25A4.31/F25A4.31 mRNA, comp... 44 0.88
129gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA 44 0.88
130gb|AY056055.1| Arabidopsis thaliana isochorismate synthase 1 pre... 44 0.88
131emb|BX016202.1|CNS08KNY Single read from an extremity of a full-... 44 0.88
132emb|BX016201.1|CNS08KNX Single read from an extremity of a full-... 44 0.88
133gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, comp... 44 0.88
134gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, r... 44 0.88
135dbj|AP003346.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.88
136dbj|AP003431.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.88
137gb|AC010581.3|AC010581 Drosophila melanogaster, chromosome 3R, r... 44 0.88
138gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033... 44 0.88
139gb|AC018445.21| Homo sapiens chromosome 18, clone RP11-196B3, co... 44 0.88
140gb|AC011765.6|AC011765 Arabidopsis thaliana chromosome 1 BAC F1M... 44 0.88
141dbj|AP005149.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.88
142gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacyl... 44 0.88
143gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa004... 44 0.88
144dbj|AP002873.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.88
145dbj|AP002871.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.88
146gb|AC023696.4| Drosophila melanogaster X BAC RP98-17J10 (Roswell... 44 0.88
147dbj|AK106317.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.88
148emb|AL113807.1|CNS01B5J Botrytis cinerea strain T4 cDNA library 44 0.88
149emb|BX814970.1|CNS0ADXM Arabidopsis thaliana Full-length cDNA Co... 44 0.88
150gb|AC158405.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.88
151gb|AF177464.1|AF177464 Drosophila melanogaster Tob homolog (Tob)... 44 0.88
152gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F25A4 ... 44 0.88
153gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, r... 44 0.88
154gb|AY817623.1| Drosophila biarmipes Yellow gene, complete cds 44 0.88
155emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha... 44 0.88
156gb|CP000462.1| Aeromonas hydrophila subsp. hydrophila ATCC 7966,... 42 3.5
157ref|NM_001051743.1| Oryza sativa (japonica cultivar-group) Os01g... 42 3.5
158gb|CP000384.1| Mycobacterium sp. MCS, complete genome 42 3.5
159emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 42 3.5
160gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete... 42 3.5
161gb|AC106887.3| Oryza sativa chromosome 3 BAC OSJNBa0054H04 genom... 42 3.5
162ref|NM_131964.1| Drosophila melanogaster CG15470-RA (CG15470), mRNA 42 3.5
163gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 42 3.5
164ref|NM_001000041.1| Rattus norvegicus olfactory receptor 1570 (p... 42 3.5
165gb|AC023711.5| Drosophila melanogaster X BAC RP98-6C4 (Roswell P... 42 3.5
166ref|XM_756736.1| Ustilago maydis 521 hypothetical protein (UM056... 42 3.5
167gb|AC023685.4| Drosophila melanogaster 3L BAC RP98-20N12 (Roswel... 42 3.5
168gb|AE012227.1| Xanthomonas campestris pv. campestris str. ATCC 3... 42 3.5
169dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 3.5
170ref|NM_001043571.1| Bombyx mori allatostatin preprohormone (LOC6... 42 3.5
171emb|BX072038.1|CNS09RQY Single read from an extremity of a full-... 42 3.5
172emb|BX072037.1|CNS09RQX Single read from an extremity of a full-... 42 3.5
173emb|BX071074.1|CNS09R06 Single read from an extremity of a full-... 42 3.5
174emb|BX071073.1|CNS09R05 Single read from an extremity of a full-... 42 3.5
175emb|BX069043.1|CNS09PFR Single read from an extremity of a full-... 42 3.5
176emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-... 42 3.5
177emb|BX065975.1|CNS09N2J Single read from an extremity of a full-... 42 3.5
178emb|BX064684.1|CNS09M2O Single read from an extremity of a full-... 42 3.5
179emb|BX063673.1|CNS09LAL Single read from an extremity of a full-... 42 3.5
180emb|BX061993.1|CNS09JZX Single read from an extremity of a full-... 42 3.5
181emb|BX061992.1|CNS09JZW Single read from an extremity of a full-... 42 3.5
182emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-... 42 3.5
183emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-... 42 3.5
184gb|AF336804.1|AF336804 Bombyx mori bombystatin mRNA, partial cds 42 3.5
185emb|BX054844.1|CNS09EHC Single read from an extremity of a full-... 42 3.5
186emb|BX054383.1|CNS09E4J Single read from an extremity of a full-... 42 3.5
187emb|BX054382.1|CNS09E4I Single read from an extremity of a full-... 42 3.5
188emb|BX052598.1|CNS09CQY Single read from an extremity of a full-... 42 3.5
189emb|BX052597.1|CNS09CQX Single read from an extremity of a full-... 42 3.5
190emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-... 42 3.5
191emb|BX051766.1|CNS09C3U Single read from an extremity of a full-... 42 3.5
192emb|BX051765.1|CNS09C3T Single read from an extremity of a full-... 42 3.5
193emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-... 42 3.5
194emb|BX050825.1|CNS09BDP Single read from an extremity of a full-... 42 3.5
195emb|BX049822.1|CNS09ALU Single read from an extremity of a full-... 42 3.5
196emb|BX049821.1|CNS09ALT Single read from an extremity of a full-... 42 3.5
197emb|BX045807.1|CNS097IB Single read from an extremity of a full-... 42 3.5
198emb|BX045806.1|CNS097IA Single read from an extremity of a full-... 42 3.5
199emb|BX042049.1|CNS094LX Single read from an extremity of a full-... 42 3.5
200emb|BX042048.1|CNS094LW Single read from an extremity of a full-... 42 3.5
201emb|BX040221.1|CNS09375 Single read from an extremity of a full-... 42 3.5
202emb|BX040220.1|CNS09374 Single read from an extremity of a full-... 42 3.5
203emb|BX037502.1|CNS0913M Single read from an extremity of a full-... 42 3.5
204emb|BX037471.1|CNS0912R Single read from an extremity of a full-... 42 3.5
205emb|BX036960.1|CNS090OK Single read from an extremity of a full-... 42 3.5
206emb|BX036959.1|CNS090OJ Single read from an extremity of a full-... 42 3.5
207emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-... 42 3.5
208emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-... 42 3.5
209emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-... 42 3.5
210emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-... 42 3.5
211emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-... 42 3.5
212emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-... 42 3.5
213emb|BX034217.1|CNS08YKD Single read from an extremity of a full-... 42 3.5
214emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-... 42 3.5
215emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-... 42 3.5
216emb|BX033034.1|CNS08XNI Single read from an extremity of a full-... 42 3.5
217emb|BX030920.1|CNS08W0S Single read from an extremity of a full-... 42 3.5
218emb|BX030919.1|CNS08W0R Single read from an extremity of a full-... 42 3.5
219emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-... 42 3.5
220emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-... 42 3.5
221emb|BX029669.1|CNS08V21 Single read from an extremity of a full-... 42 3.5
222emb|BX029668.1|CNS08V20 Single read from an extremity of a full-... 42 3.5
223emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-... 42 3.5
224emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-... 42 3.5
225emb|BX027756.1|CNS08TKW Single read from an extremity of a full-... 42 3.5
226emb|BX028005.1|CNS08TRT Single read from an extremity of a full-... 42 3.5
227emb|BX028004.1|CNS08TRS Single read from an extremity of a full-... 42 3.5
228emb|BX019149.1|CNS08MXT Single read from an extremity of a full-... 42 3.5
229emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-... 42 3.5
230emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-... 42 3.5
231emb|BX022052.1|CNS08P6G Single read from an extremity of a full-... 42 3.5
232emb|BX022051.1|CNS08P6F Single read from an extremity of a full-... 42 3.5
233emb|BX020483.1|CNS08NYV Single read from an extremity of a full-... 42 3.5
234emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-... 42 3.5
235emb|BX019569.1|CNS08N9H Single read from an extremity of a full-... 42 3.5
236emb|BX018722.1|CNS08MLY Single read from an extremity of a full-... 42 3.5
237emb|BX018239.1|CNS08M8J Single read from an extremity of a full-... 42 3.5
238emb|BX018238.1|CNS08M8I Single read from an extremity of a full-... 42 3.5
239emb|BX017233.1|CNS08LGL Single read from an extremity of a full-... 42 3.5
240emb|BX017232.1|CNS08LGK Single read from an extremity of a full-... 42 3.5
241emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-... 42 3.5
242emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-... 42 3.5
243emb|BX016618.1|CNS08KZI Single read from an extremity of a full-... 42 3.5
244dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic D... 42 3.5
245emb|BX016072.1|CNS08KKC Single read from an extremity of a full-... 42 3.5
246emb|BX016071.1|CNS08KKB Single read from an extremity of a full-... 42 3.5
247emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-... 42 3.5
248emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-... 42 3.5
249dbj|AP003437.3| Oryza sativa (japonica cultivar-group) genomic D... 42 3.5
250emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-... 42 3.5
251emb|BX014835.1|CNS08JLZ Single read from an extremity of a full-... 42 3.5
252emb|BX014834.1|CNS08JLY Single read from an extremity of a full-... 42 3.5
253emb|BX014823.1|CNS08JLN Single read from an extremity of a full-... 42 3.5
254emb|BX012788.1|CNS08I14 Single read from an extremity of a full-... 42 3.5
255emb|BX011620.1|CNS08H4O Single read from an extremity of a full-... 42 3.5
256emb|BX009503.1|CNS08FHV Single read from an extremity of a full-... 42 3.5
257emb|BX009502.1|CNS08FHU Single read from an extremity of a full-... 42 3.5
258emb|BX009476.1|CNS08FH4 Single read from an extremity of a full-... 42 3.5
259emb|BX007868.1|CNS08E8G Single read from an extremity of a full-... 42 3.5
260emb|BX007867.1|CNS08E8F Single read from an extremity of a full-... 42 3.5
261emb|BX007827.1|CNS08E7B Single read from an extremity of a full-... 42 3.5
262emb|BX007826.1|CNS08E7A Single read from an extremity of a full-... 42 3.5
263emb|BX007030.1|CNS08DL6 Single read from an extremity of a full-... 42 3.5
264emb|BX007029.1|CNS08DL5 Single read from an extremity of a full-... 42 3.5
265emb|BX006166.1|CNS08CX6 Single read from an extremity of a full-... 42 3.5
266emb|BX006165.1|CNS08CX5 Single read from an extremity of a full-... 42 3.5
267emb|BX640440.1| Bordetella bronchiseptica strain RB50, complete ... 42 3.5
268emb|BX640425.1| Bordetella parapertussis strain 12822, complete ... 42 3.5
269gb|AE006470.1| Chlorobium tepidum TLS, complete genome 42 3.5
270gb|AC007891.8|AC007891 Drosophila melanogaster, chromosome 3R, r... 42 3.5
271gb|AC007814.6|AC007814 Drosophila melanogaster, chromosome 3R, r... 42 3.5
272gb|AC084474.1|CBRG01A7 Caenorhabditis briggsae cosmid G01A7, com... 42 3.5
273dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 3.5
274dbj|AP005532.3| Oryza sativa (japonica cultivar-group) genomic D... 42 3.5
275gb|AC023701.4| Drosophila melanogaster X BAC RP98-29B16 (Roswell... 42 3.5
276gb|AC023695.4| Drosophila melanogaster X BAC RP98-25I9 (Roswell ... 42 3.5
277dbj|AK072446.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 3.5
278ref|XM_565436.1| Anopheles gambiae str. PEST ENSANGP00000028147 ... 42 3.5
279ref|XM_308979.2| Anopheles gambiae str. PEST ENSANGP00000020323 ... 42 3.5
280gb|CP000196.1| Drosophila melanogaster genomic scaffold 21100002... 42 3.5
281gb|U10338.1|IOU10338 Ilyanassa obsoleta RNA polymerase II larges... 42 3.5

>ref|NM_001055330.1| Oryza sativa (japonica cultivar-group) Os03g0121700 (Os03g0121700)
           mRNA, complete cds
          Length = 1062
 Score =  391 bits (197), Expect = e-105
 Identities = 248/265 (93%)
 Strand = Plus / Plus

                                                                       
Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331
           |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 342

                                                                       
Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391
            ||||| |||||||| || |||||||||||||||||||||||||||||||| || |||||
Sbjct: 343 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 402

                                                                       
Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 403 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 462

                                                                       
Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511
           ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 463 ggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcagttcag 522

                                    
Query: 512 gatgcaggacctgagcaaggcgatg 536
           |||||| ||||||||||||| ||||
Sbjct: 523 gatgcaagacctgagcaaggtgatg 547



 Score =  210 bits (106), Expect = 7e-51
 Identities = 142/154 (92%)
 Strand = Plus / Plus

                                                                       
Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
           |||||||||||||| | |||||||||||| || || ||| ||||||||||||||||||||
Sbjct: 578 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 637

                                                                       
Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695
           |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 638 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 697

                                             
Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729
           ||||| || |||||||||||||||||||| ||||
Sbjct: 698 gacattgtgagcgccatcatggagctcacggcct 731



to top

>dbj|AK099300.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023142E05, full
           insert sequence
          Length = 954

 Score =  391 bits (197), Expect = e-105
 Identities = 248/265 (93%)
 Strand = Plus / Plus

                                                                       
Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331
           |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 268 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 327

                                                                       
Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391
            ||||| |||||||| || |||||||||||||||||||||||||||||||| || |||||
Sbjct: 328 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 387

                                                                       
Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 388 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 447

                                                                       
Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511
           ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 448 ggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcagttcag 507

                                    
Query: 512 gatgcaggacctgagcaaggcgatg 536
           |||||| ||||||||||||| ||||
Sbjct: 508 gatgcaagacctgagcaaggtgatg 532



 Score =  210 bits (106), Expect = 7e-51
 Identities = 142/154 (92%)
 Strand = Plus / Plus

                                                                       
Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
           |||||||||||||| | |||||||||||| || || ||| ||||||||||||||||||||
Sbjct: 563 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 622

                                                                       
Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695
           |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 623 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 682

                                             
Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729
           ||||| || |||||||||||||||||||| ||||
Sbjct: 683 gacattgtgagcgccatcatggagctcacggcct 716



to top

>gb|AY224519.1| Oryza sativa (japonica cultivar-group) isolate 20527 putative
           nascent polypeptide-associated complex alpha chain mRNA,
           complete cds
          Length = 666

 Score =  383 bits (193), Expect = e-103
 Identities = 247/265 (93%)
 Strand = Plus / Plus

                                                                       
Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331
           |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 216 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 275

                                                                       
Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391
            ||||| |||||||| || |||||||||||||||||||||||||||||||| || |||||
Sbjct: 276 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 335

                                                                       
Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 336 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 395

                                                                       
Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511
           ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 396 ggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcagttcag 455

                                    
Query: 512 gatgcaggacctgagcaaggcgatg 536
           |||||| || |||||||||| ||||
Sbjct: 456 gatgcaagatctgagcaaggtgatg 480



 Score =  210 bits (106), Expect = 7e-51
 Identities = 142/154 (92%)
 Strand = Plus / Plus

                                                                       
Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
           |||||||||||||| | |||||||||||| || || ||| ||||||||||||||||||||
Sbjct: 511 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 570

                                                                       
Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695
           |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 571 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 630

                                             
Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729
           ||||| || |||||||||||||||||||| ||||
Sbjct: 631 gacattgtgagcgccatcatggagctcacggcct 664



to top

>dbj|AK059982.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-E10, full
           insert sequence
          Length = 1062

 Score =  383 bits (193), Expect = e-103
 Identities = 247/265 (93%)
 Strand = Plus / Plus

                                                                       
Query: 272 cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331
           |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 283 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 342

                                                                       
Query: 332 gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgtt 391
            ||||| |||||||| || |||||||||||||||||||||||||||||||| || |||||
Sbjct: 343 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaatatactgtt 402

                                                                       
Query: 392 cgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcgg 451
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 403 cgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcatattcgg 462

                                                                       
Query: 452 ggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcag 511
           ||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||
Sbjct: 463 ggaggccaagatcgaggacctgagctcccagctgcaggcgtaggccgcgcagcagttcag 522

                                    
Query: 512 gatgcaggacctgagcaaggcgatg 536
           |||||| ||||||||||||| ||||
Sbjct: 523 gatgcaagacctgagcaaggtgatg 547



 Score =  210 bits (106), Expect = 7e-51
 Identities = 142/154 (92%)
 Strand = Plus / Plus

                                                                       
Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
           |||||||||||||| | |||||||||||| || || ||| ||||||||||||||||||||
Sbjct: 578 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 637

                                                                       
Query: 636 atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695
           |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 638 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 697

                                             
Query: 696 gacatcgtcagcgccatcatggagctcaccgcct 729
           ||||| || |||||||||||||||||||| ||||
Sbjct: 698 gacattgtgagcgccatcatggagctcacggcct 731



to top

>ref|NM_001050511.1| Oryza sativa (japonica cultivar-group) Os01g0698900 (Os01g0698900)
           mRNA, complete cds
          Length = 1149

 Score =  333 bits (168), Expect = 7e-88
 Identities = 236/258 (91%), Gaps = 3/258 (1%)
 Strand = Plus / Plus

                                                                       
Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
           ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||
Sbjct: 580 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 639

                                                                       
Query: 342 gtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgttcgtggtgtcg 401
           ||||| || |||||||||||||||||| ||||||||||||| || |||||||||||||| 
Sbjct: 640 gtcacgggagtcagcaggattaccatcgagagagccaagaatatactgttcgtggtgtcc 699

                                                                       
Query: 402 aagccg---gacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           || ||    ||||| ||||||||||||||||||||| ||||||| |||||||||||||||
Sbjct: 700 aaacctcatgacgtcttcaagagcccgacgtcggagtcgtacgtcatattcggggaggcc 759

                                                                       
Query: 459 aagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgcag 518
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| 
Sbjct: 760 aagatcgaggacctgagctcccagctgcaggcgcaggcagcgcagcagttcaggatgcaa 819

                             
Query: 519 gacctgagcaaggcgatg 536
           || |||||||||| ||||
Sbjct: 820 gatctgagcaaggtgatg 837



 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                       
Query: 576 gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
           |||||||||||| | | |||||||||||| || || ||| |||||||||||||| |||||
Sbjct: 868 gccgacgaggagcaagaggtggacgagacagggatagagccccgcgacatcgacgtcgtc 927

                       
Query: 636 atgacgcaggcc 647
           ||||||||||||
Sbjct: 928 atgacgcaggcc 939



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 45/52 (86%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                               
Query: 62  catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110
           ||||||||||||||| ||||||||   |||| ||||| ||||||||| ||||
Sbjct: 357 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 408



to top

>gb|AC105363.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1705B08,
             complete sequence
          Length = 100986

 Score =  234 bits (118), Expect = 5e-58
 Identities = 142/150 (94%)
 Strand = Plus / Plus

                                                                         
Query: 387   ctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgata 446
             |||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 78469 ctgttcgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcata 78528

                                                                         
Query: 447   ttcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcag 506
             |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 78529 ttcggggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcag 78588

                                           
Query: 507   ttcaggatgcaggacctgagcaaggcgatg 536
             ||||||||||| ||||||||||||| ||||
Sbjct: 78589 ttcaggatgcaagacctgagcaaggtgatg 78618



 Score =  210 bits (106), Expect = 7e-51
 Identities = 142/154 (92%)
 Strand = Plus / Plus

                                                                         
Query: 576   gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
             |||||||||||||| | |||||||||||| || || ||| ||||||||||||||||||||
Sbjct: 78649 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 78708

                                                                         
Query: 636   atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695
             |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 78709 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 78768

                                               
Query: 696   gacatcgtcagcgccatcatggagctcaccgcct 729
             ||||| || |||||||||||||||||||| ||||
Sbjct: 78769 gacattgtgagcgccatcatggagctcacggcct 78802



 Score =  165 bits (83), Expect = 4e-37
 Identities = 104/111 (93%)
 Strand = Plus / Plus

                                                                         
Query: 272   cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331
             |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 78267 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 78326

                                                                
Query: 332   gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaa 382
              ||||| |||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 78327 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaa 78377



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score =  234 bits (118), Expect = 5e-58
 Identities = 142/150 (94%)
 Strand = Plus / Plus

                                                                           
Query: 387     ctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgata 446
               |||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||| |||
Sbjct: 1174763 ctgttcgtggtgtccaagcctgacgtcttcaagagcccgacgtcggagacgtacgtcata 1174822

                                                                           
Query: 447     ttcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcag 506
               |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 1174823 ttcggggaggccaagatcgaggacctgagctcccagctgcaggcgcaggccgcgcagcag 1174882

                                             
Query: 507     ttcaggatgcaggacctgagcaaggcgatg 536
               ||||||||||| ||||||||||||| ||||
Sbjct: 1174883 ttcaggatgcaagacctgagcaaggtgatg 1174912



 Score =  210 bits (106), Expect = 7e-51
 Identities = 142/154 (92%)
 Strand = Plus / Plus

                                                                           
Query: 576     gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
               |||||||||||||| | |||||||||||| || || ||| ||||||||||||||||||||
Sbjct: 1174943 gccgacgaggaggaagaggtggacgagacagggatagagccccgcgacatcgacctcgtc 1175002

                                                                           
Query: 636     atgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctcaaggcgcacgacggc 695
               |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 1175003 atgacgcaggccagcgtgtcgcgggccaaggccgtcaaggcgctcaaggcgcacgacggc 1175062

                                                 
Query: 696     gacatcgtcagcgccatcatggagctcaccgcct 729
               ||||| || |||||||||||||||||||| ||||
Sbjct: 1175063 gacattgtgagcgccatcatggagctcacggcct 1175096



 Score =  165 bits (83), Expect = 4e-37
 Identities = 104/111 (93%)
 Strand = Plus / Plus

                                                                           
Query: 272     cgaggggtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgg 331
               |||||| || ||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1174561 cgagggctccaagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcgg 1174620

                                                                  
Query: 332     gatgaagcccgtcaccggcgtcagcaggattaccatcaagagagccaagaa 382
                ||||| |||||||| || ||||||||||||||||||||||||||||||||
Sbjct: 1174621 aatgaaacccgtcacgggagtcagcaggattaccatcaagagagccaagaa 1174671



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 572      cgtcgccgacgaggaggaggtggtgg 597
                ||||||||| ||||||||||||||||
Sbjct: 28542037 cgtcgccgaggaggaggaggtggtgg 28542012



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 574      tcgccgacgaggaggaggtgg 594
                |||||||||||||||||||||
Sbjct: 18338499 tcgccgacgaggaggaggtgg 18338519



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  192 bits (97), Expect = 2e-45
 Identities = 121/129 (93%)
 Strand = Plus / Plus

                                                                            
Query: 408      gacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgag 467
                ||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||
Sbjct: 28908719 gacgtcttcaagagcccgacgtcggagtcgtacgtcatattcggggaggccaagatcgag 28908778

                                                                            
Query: 468      gacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgcaggacctgagc 527
                ||||||||||| ||||||||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 28908779 gacctgagctcccagctgcaggcgcaggcagcgcagcagttcaggatgcaagatctgagc 28908838

                         
Query: 528      aaggcgatg 536
                |||| ||||
Sbjct: 28908839 aaggtgatg 28908847



 Score =  153 bits (77), Expect = 1e-33
 Identities = 95/101 (94%)
 Strand = Plus / Plus

                                                                            
Query: 282      aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
                ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||
Sbjct: 28908504 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 28908563

                                                         
Query: 342      gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382
                ||||| || |||||||||||||||||| |||||||||||||
Sbjct: 28908564 gtcacgggagtcagcaggattaccatcgagagagccaagaa 28908604



 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                            
Query: 576      gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
                |||||||||||| | | |||||||||||| || || ||| |||||||||||||| |||||
Sbjct: 28908878 gccgacgaggagcaagaggtggacgagacagggatagagccccgcgacatcgacgtcgtc 28908937

                            
Query: 636      atgacgcaggcc 647
                ||||||||||||
Sbjct: 28908938 atgacgcaggcc 28908949



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                            
Query: 414      ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473
                ||||||||||| |  || || || ||||| || ||||| ||||| ||||||||||| |||
Sbjct: 41208845 ttcaagagcccaaactcagacacctacgtcatcttcggtgaggcgaagatcgaggatctg 41208904

                               
Query: 474      agctcgcagctgcag 488
                |||||||||||||||
Sbjct: 41208905 agctcgcagctgcag 41208919



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 743      tttccgtttccgtttccgtttc 764
                ||||||||||||||||||||||
Sbjct: 11335843 tttccgtttccgtttccgtttc 11335864



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 741      cgtttccgtttccgtttccgtt 762
                ||||||||||||||||||||||
Sbjct: 11335847 cgtttccgtttccgtttccgtt 11335868



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 45/52 (86%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                    
Query: 62       catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110
                ||||||||||||||| ||||||||   |||| ||||| ||||||||| ||||
Sbjct: 28908070 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 28908121



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 739      ttcgtttccgtttccgtttccg 760
                ||||||||||||||||||||||
Sbjct: 38588714 ttcgtttccgtttccgtttccg 38588693



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 572      cgtcgccgacgaggaggaggtggtggacg 600
                |||||||||||||||||||| || |||||
Sbjct: 40066942 cgtcgccgacgaggaggaggaggaggacg 40066970



to top

>dbj|AP003254.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0454A11
          Length = 152240

 Score =  192 bits (97), Expect = 2e-45
 Identities = 121/129 (93%)
 Strand = Plus / Plus

                                                                         
Query: 408   gacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgag 467
             ||||| ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||
Sbjct: 21342 gacgtcttcaagagcccgacgtcggagtcgtacgtcatattcggggaggccaagatcgag 21401

                                                                         
Query: 468   gacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgcaggacctgagc 527
             ||||||||||| ||||||||||||||||| |||||||||||||||||||| || ||||||
Sbjct: 21402 gacctgagctcccagctgcaggcgcaggcagcgcagcagttcaggatgcaagatctgagc 21461

                      
Query: 528   aaggcgatg 536
             |||| ||||
Sbjct: 21462 aaggtgatg 21470



 Score =  153 bits (77), Expect = 1e-33
 Identities = 95/101 (94%)
 Strand = Plus / Plus

                                                                         
Query: 282   aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
             ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||
Sbjct: 21127 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 21186

                                                      
Query: 342   gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382
             ||||| || |||||||||||||||||| |||||||||||||
Sbjct: 21187 gtcacgggagtcagcaggattaccatcgagagagccaagaa 21227



 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                         
Query: 576   gccgacgaggaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtc 635
             |||||||||||| | | |||||||||||| || || ||| |||||||||||||| |||||
Sbjct: 21501 gccgacgaggagcaagaggtggacgagacagggatagagccccgcgacatcgacgtcgtc 21560

                         
Query: 636   atgacgcaggcc 647
             ||||||||||||
Sbjct: 21561 atgacgcaggcc 21572



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 45/52 (86%), Gaps = 3/52 (5%)
 Strand = Plus / Plus

                                                                 
Query: 62    catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110
             ||||||||||||||| ||||||||   |||| ||||| ||||||||| ||||
Sbjct: 20693 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 20744



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score =  161 bits (81), Expect = 5e-36
 Identities = 96/101 (95%)
 Strand = Plus / Minus

                                                                            
Query: 282      aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
                ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||
Sbjct: 12569215 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 12569156

                                                         
Query: 342      gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382
                ||||| || ||||||||||||||||||||||||||||||||
Sbjct: 12569155 gtcacgggagtcagcaggattaccatcaagagagccaagaa 12569115



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                                
Query: 616      cccgcgacatcgacctcgtcatgacgcaggcc 647
                ||||||||||||||||||||||||||||||||
Sbjct: 12569062 cccgcgacatcgacctcgtcatgacgcaggcc 12569031



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 45/52 (86%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                    
Query: 62       catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110
                ||||||||||||||| ||||||||   |||| ||||| ||||||||| ||||
Sbjct: 12569644 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 12569593



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 739      ttcgtttccgtttccgtttccg 760
                ||||||||||||||||||||||
Sbjct: 23924359 ttcgtttccgtttccgtttccg 23924338



to top

>dbj|AP005438.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1723_B06
          Length = 136853

 Score =  161 bits (81), Expect = 5e-36
 Identities = 96/101 (95%)
 Strand = Plus / Minus

                                                                         
Query: 282   aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
             ||||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||
Sbjct: 53908 aagcagagcaggagcgagaagaagagccgcaaggccatgatgaagctcggaatgaaaccc 53849

                                                      
Query: 342   gtcaccggcgtcagcaggattaccatcaagagagccaagaa 382
             ||||| || ||||||||||||||||||||||||||||||||
Sbjct: 53848 gtcacgggagtcagcaggattaccatcaagagagccaagaa 53808



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 32/32 (100%)
 Strand = Plus / Minus

                                             
Query: 616   cccgcgacatcgacctcgtcatgacgcaggcc 647
             ||||||||||||||||||||||||||||||||
Sbjct: 53755 cccgcgacatcgacctcgtcatgacgcaggcc 53724



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 45/52 (86%), Gaps = 3/52 (5%)
 Strand = Plus / Minus

                                                                 
Query: 62    catggtcagcgagcagacgccggt---gaccaccgagccggagctggagagc 110
             ||||||||||||||| ||||||||   |||| ||||| ||||||||| ||||
Sbjct: 54337 catggtcagcgagcaaacgccggtggcgaccgccgaggcggagctggtgagc 54286



to top

>gb|BT016475.1| Zea mays clone Contig308 mRNA sequence
          Length = 891

 Score =  117 bits (59), Expect = 7e-23
 Identities = 173/211 (81%)
 Strand = Plus / Plus

                                                                       
Query: 278 gtcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaa 337
           ||||||||| ||| |||| |||||||||||||||||||||||| ||||||| || |||||
Sbjct: 249 gtcgaagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaa 308

                                                                       
Query: 338 gcccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgttcgtggt 397
           |||| |||| || |||||| || | ||  | |||| |  |||||| || || || ||  |
Sbjct: 309 gcccatcactggtgtcagccgggtcactgtgaagaaaagcaagaatatgctttttgtcat 368

                                                                       
Query: 398 gtcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggc 457
            |||||||| || |||||||||||||| |  ||||| || || || |||||||| |||||
Sbjct: 369 ctcgaagccagatgtgttcaagagcccaaactcggacacctatgtcatattcggcgaggc 428

                                          
Query: 458 caagatcgaggacctgagctcgcagctgcag 488
            |||||||||||||| ||||| |||||||||
Sbjct: 429 gaagatcgaggacctcagctcccagctgcag 459



to top

>emb|CT983009.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 916

 Score = 91.7 bits (46), Expect = 4e-15
 Identities = 190/238 (79%)
 Strand = Plus / Plus

                                                                       
Query: 279 tcgaagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaag 338
           |||||||||||| | ||||||||||||||||||||||| ||| ||||||| || ||||| 
Sbjct: 284 tcgaagcagagcagaagcgagaagaagagccgcaaggctatgttgaagcttggcatgaaa 343

                                                                       
Query: 339 cccgtcaccggcgtcagcaggattaccatcaagagagccaagaacatcctgttcgtggtg 398
           || || | ||| || |||||| | |||||||||||| |||||||  |||| ||| |  | 
Sbjct: 344 cctgtaagcggtgtaagcagggtcaccatcaagagaaccaagaatgtcctattcttcatc 403

                                                                       
Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           || || || || || |||||||||||    || ||||| ||  | ||||| |||||||| 
Sbjct: 404 tcaaatcctgatgtcttcaagagccctcactctgagacttatatcatatttggggaggcg 463

                                                                     
Query: 459 aagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgc 516
           ||||| || ||| ||||||| || |||||| | || || || ||||||||||||||||
Sbjct: 464 aagattgaagacttgagctcacaactgcagacacaagctgcccagcagttcaggatgc 521



to top

>dbj|AP006123.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT41E18, TM0207,
             complete sequence
          Length = 115290

 Score = 81.8 bits (41), Expect = 4e-12
 Identities = 74/85 (87%)
 Strand = Plus / Plus

                                                                         
Query: 432   gagacgtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcaggcg 491
             ||||| ||||| |||||||||||||| || || |||||||||||||| ||||||||| | 
Sbjct: 12186 gagacctacgtcatattcggggaggcgaaaatagaggacctgagctctcagctgcagaca 12245

                                      
Query: 492   caggcggcgcagcagttcaggatgc 516
             || || || ||||||||||||||||
Sbjct: 12246 caagctgctcagcagttcaggatgc 12270



to top

>gb|DQ245285.1| Zea mays clone 14302 mRNA sequence
          Length = 994

 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470
           ||||||||||||||||  || || ||||| || |||||||| ||||| ||||||||||||
Sbjct: 404 gtgttcaagagcccgaattccgacacgtatgtcatattcggcgaggctaagatcgaggac 463

                                                   
Query: 471 ctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
           || ||||| ||||||||| | ||||| ||  |||||||||
Sbjct: 464 ctcagctcccagctgcagacccaggcagcagagcagttca 503



 Score = 77.8 bits (39), Expect = 6e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
           ||||| ||| |||| |||||||||||||||||||||||| ||||||| || |||||||||
Sbjct: 275 aagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaagccc 334

                          
Query: 342 gtcaccggcgtcagc 356
            |||| || ||||||
Sbjct: 335 atcactggtgtcagc 349



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 661 ccaaggccgtcaaggccctcaaggc 685
           ||||||| |||||||||||||||||
Sbjct: 645 ccaaggctgtcaaggccctcaaggc 669



to top

>gb|BT016765.1| Zea mays clone Contig598 mRNA sequence
          Length = 957

 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470
           ||||||||||||||||  || || ||||| || |||||||| ||||| ||||||||||||
Sbjct: 399 gtgttcaagagcccgaattccgacacgtatgtcatattcggcgaggctaagatcgaggac 458

                                                   
Query: 471 ctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
           || ||||| ||||||||| | ||||| ||  |||||||||
Sbjct: 459 ctcagctcccagctgcagacccaggcagcagagcagttca 498



 Score = 77.8 bits (39), Expect = 6e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
           ||||| ||| |||| |||||||||||||||||||||||| ||||||| || |||||||||
Sbjct: 270 aagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaagccc 329

                          
Query: 342 gtcaccggcgtcagc 356
            |||| || ||||||
Sbjct: 330 atcactggtgtcagc 344



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 661 ccaaggccgtcaaggccctcaaggc 685
           ||||||| |||||||||||||||||
Sbjct: 640 ccaaggctgtcaaggccctcaaggc 664



to top

>gb|AY103873.1| Zea mays PCO094039 mRNA sequence
          Length = 984

 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 85/100 (85%)
 Strand = Plus / Plus

                                                                       
Query: 411 gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470
           ||||||||||||||||  || || ||||| || |||||||| ||||| ||||||||||||
Sbjct: 400 gtgttcaagagcccgaattccgacacgtatgtcatattcggcgaggctaagatcgaggac 459

                                                   
Query: 471 ctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
           || ||||| ||||||||| | ||||| ||  |||||||||
Sbjct: 460 ctcagctcccagctgcagacccaggcagcagagcagttca 499



 Score = 77.8 bits (39), Expect = 6e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                       
Query: 282 aagcagagccggagcgagaagaagagccgcaaggccatgatgaagctcgggatgaagccc 341
           ||||| ||| |||| |||||||||||||||||||||||| ||||||| || |||||||||
Sbjct: 271 aagcaaagcaggagtgagaagaagagccgcaaggccatgctgaagcttggcatgaagccc 330

                          
Query: 342 gtcaccggcgtcagc 356
            |||| || ||||||
Sbjct: 331 atcactggtgtcagc 345



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 661 ccaaggccgtcaaggccctcaaggc 685
           ||||||| |||||||||||||||||
Sbjct: 641 ccaaggctgtcaaggccctcaaggc 665



to top

>ref|NM_001061904.1| Oryza sativa (japonica cultivar-group) Os05g0373700 (Os05g0373700)
           mRNA, partial cds
          Length = 930

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
           |||||||||||||||||||||||||||||||||||| | ||||| ||  |||||||||
Sbjct: 431 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 488



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680
           |||||||| || || ||||| ||||||| ||||||  |  ||||||| || ||||| |||
Sbjct: 587 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 646

                                                       
Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724
           |||||   | | |||||||||||||  ||||||||||| |||||
Sbjct: 647 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 690



to top

>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09,
              complete sequence
          Length = 167318

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                        
Query: 453    gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
              |||||||||||||||||||||||||||||||||||| | ||||| ||  |||||||||
Sbjct: 129421 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 129478



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                          
Query: 621    gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680
              |||||||| || || ||||| ||||||| ||||||  |  ||||||| || ||||| |||
Sbjct: 129577 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 129636

                                                          
Query: 681    aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724
              |||||   | | |||||||||||||  ||||||||||| |||||
Sbjct: 129637 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 129680



to top

>gb|AC108874.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
           OJ1005_E12, complete sequence
          Length = 121293

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
           |||||||||||||||||||||||||||||||||||| | ||||| ||  |||||||||
Sbjct: 216 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 273



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680
           |||||||| || || ||||| ||||||| ||||||  |  ||||||| || ||||| |||
Sbjct: 372 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 431

                                                       
Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724
           |||||   | | |||||||||||||  ||||||||||| |||||
Sbjct: 432 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 475



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                          
Query: 453      gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
                |||||||||||||||||||||||||||||||||||| | ||||| ||  |||||||||
Sbjct: 17869467 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 17869524



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                            
Query: 621      gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680
                |||||||| || || ||||| ||||||| ||||||  |  ||||||| || ||||| |||
Sbjct: 17869623 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 17869682

                                                            
Query: 681      aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724
                |||||   | | |||||||||||||  ||||||||||| |||||
Sbjct: 17869683 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 17869726



to top

>dbj|AB110178.1| Oryza sativa (japonica cultivar-group) mRNA for nascent polypeptide
           associated complex alpha chain, complete cds, clone:
           13YPG044
          Length = 878

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
           |||||||||||||||||||||||||||||||||||| | ||||| ||  |||||||||
Sbjct: 369 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 426



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680
           |||||||| || || ||||| ||||||| ||||||  |  ||||||| || ||||| |||
Sbjct: 525 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 584

                                                       
Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724
           |||||   | | |||||||||||||  ||||||||||| |||||
Sbjct: 585 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 628



to top

>dbj|AK058906.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-D09, full
           insert sequence
          Length = 930

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 53/58 (91%)
 Strand = Plus / Plus

                                                                     
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcagcagttca 510
           |||||||||||||||||||||||||||||||||||| | ||||| ||  |||||||||
Sbjct: 431 gaggccaagatcgaggacctgagctcgcagctgcagacccaggctgcagagcagttca 488



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 621 gacatcgacctcgtcatgacgcaggccagcgtgtcccgcgccaaggccgtcaaggccctc 680
           |||||||| || || ||||| ||||||| ||||||  |  ||||||| || ||||| |||
Sbjct: 587 gacatcgagctggtgatgacccaggccaccgtgtcgaggtccaaggcggtgaaggcactc 646

                                                       
Query: 681 aaggcgcacgacggcgacatcgtcagcgccatcatggagctcac 724
           |||||   | | |||||||||||||  ||||||||||| |||||
Sbjct: 647 aaggctgccaatggcgacatcgtcacagccatcatggaactcac 690



to top

>gb|DQ245786.1| Zea mays clone 20335 mRNA sequence
          Length = 856

 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 172/215 (80%), Gaps = 2/215 (0%)
 Strand = Plus / Plus

                                                                       
Query: 297 gagaagaagagccgcaaggccatgatgaagctcgggatgaagcccgtcaccggcgtcagc 356
           ||||||||||| || || |||||| | |||||||||||||||||| |||| || ||||||
Sbjct: 233 gagaagaagagtcgtaaagccatgctcaagctcgggatgaagcccatcactggtgtcagc 292

                                                                       
Query: 357 aggattaccatcaaga-gagccaagaacatcctgttcgtggtgtcgaagccggacgtgtt 415
            |  | ||| |||| | |||| ||||||||  |||||||  | || || || || || ||
Sbjct: 293 cgtgtcaccgtcaaaaagagc-aagaacataatgttcgtcatctctaaacccgatgtctt 351

                                                                       
Query: 416 caagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctgag 475
           |||||||||  | || || || ||||| || || || |||||||||||||| ||| ||||
Sbjct: 352 caagagcccagcatcagacacctacgtcatctttggagaggccaagatcgaagacttgag 411

                                              
Query: 476 ctcgcagctgcaggcgcaggcggcgcagcagttca 510
           ||||||| ||||| ||||||| ||  |||||||||
Sbjct: 412 ctcgcagatgcagtcgcaggccgcagagcagttca 446



to top

>dbj|AK226309.1| Arabidopsis thaliana mRNA for putative alpha NAC, complete cds,
           clone: RAFL05-12-D01
          Length = 922

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 391 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 450

                                     
Query: 459 aagatcgaggacctgagctcgcagct 484
           ||||| || ||| ||||||| |||||
Sbjct: 451 aagattgatgacatgagctctcagct 476



to top

>ref|NM_117116.2| Arabidopsis thaliana unknown protein (AT4G10480) mRNA, complete cds
          Length = 937

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 389 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 448

                                     
Query: 459 aagatcgaggacctgagctcgcagct 484
           ||||| || ||| ||||||| |||||
Sbjct: 449 aagattgatgacatgagctctcagct 474



to top

>gb|AY096615.1| Arabidopsis thaliana putative alpha NAC protein (AT4g10480) mRNA,
           complete cds
          Length = 670

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 304 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 363

                                     
Query: 459 aagatcgaggacctgagctcgcagct 484
           ||||| || ||| ||||||| |||||
Sbjct: 364 aagattgatgacatgagctctcagct 389



to top

>gb|AY045811.1| Arabidopsis thaliana putative alpha NAC protein (At4g10480) mRNA,
           complete cds
          Length = 923

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 375 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 434

                                     
Query: 459 aagatcgaggacctgagctcgcagct 484
           ||||| || ||| ||||||| |||||
Sbjct: 435 aagattgatgacatgagctctcagct 460



to top

>gb|AY114656.1| Arabidopsis thaliana putative alpha NAC (At4g10480) mRNA, complete
           cds
          Length = 701

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 304 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 363

                                     
Query: 459 aagatcgaggacctgagctcgcagct 484
           ||||| || ||| ||||||| |||||
Sbjct: 364 aagattgatgacatgagctctcagct 389



to top

>gb|AY062724.1| Arabidopsis thaliana putative alpha NAC (At4g10480; F7L13.60) mRNA,
           complete cds
          Length = 932

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                       
Query: 399 tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
           ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 384 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 443

                                     
Query: 459 aagatcgaggacctgagctcgcagct 484
           ||||| || ||| ||||||| |||||
Sbjct: 444 aagattgatgacatgagctctcagct 469



to top

>emb|AL161517.2|ATCHRIV29 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 29
          Length = 199861

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                          
Query: 399    tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
              ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 110655 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 110596

                                        
Query: 459    aagatcgaggacctgagctcgcagct 484
              ||||| || ||| ||||||| |||||
Sbjct: 110595 aagattgatgacatgagctctcagct 110570



to top

>emb|AL049524.1|ATF7L13 Arabidopsis thaliana DNA chromosome 4, BAC clone  F7L13 (ESSA project)
          Length = 95076

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                         
Query: 399   tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
             ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 50692 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 50633

                                       
Query: 459   aagatcgaggacctgagctcgcagct 484
             ||||| || ||| ||||||| |||||
Sbjct: 50632 aagattgatgacatgagctctcagct 50607



to top

>gb|AF118222.1|F3H7 Arabidopsis thaliana BAC F3H7
          Length = 102216

 Score = 67.9 bits (34), Expect = 6e-08
 Identities = 73/86 (84%)
 Strand = Plus / Plus

                                                                         
Query: 399   tcgaagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggcc 458
             ||||||||||| ||||||||||| ||||  || ||||| || ||||||||||| ||||| 
Sbjct: 95971 tcgaagccggatgtgttcaagagtccgaactctgagacctatgtgatattcggtgaggct 96030

                                       
Query: 459   aagatcgaggacctgagctcgcagct 484
             ||||| || ||| ||||||| |||||
Sbjct: 96031 aagattgatgacatgagctctcagct 96056



to top

>ref|NM_001051878.1| Oryza sativa (japonica cultivar-group) Os01g0938900 (Os01g0938900)
           mRNA, complete cds
          Length = 974

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436
           ||||||||| ||||||||  | || || || || || ||||||||||| |  || || ||
Sbjct: 360 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 419

                                                               
Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488
            ||||| || ||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 420 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 471



to top

>dbj|AK109341.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-F04, full
           insert sequence
          Length = 909

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436
           ||||||||| ||||||||  | || || || || || ||||||||||| |  || || ||
Sbjct: 382 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 441

                                                               
Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488
            ||||| || ||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 442 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 493



to top

>dbj|AK101971.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076L24, full
           insert sequence
          Length = 976

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436
           ||||||||| ||||||||  | || || || || || ||||||||||| |  || || ||
Sbjct: 361 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 420

                                                               
Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488
            ||||| || ||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 421 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 472



to top

>dbj|AK070627.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055N09, full
            insert sequence
          Length = 3171

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                        
Query: 377  caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436
            ||||||||| ||||||||  | || || || || || ||||||||||| |  || || ||
Sbjct: 2640 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 2699

                                                                
Query: 437  gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488
             ||||| || ||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 2700 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 2751



to top

>dbj|AK059437.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G10, full
           insert sequence
          Length = 873

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 92/112 (82%)
 Strand = Plus / Plus

                                                                       
Query: 377 caagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagac 436
           ||||||||| ||||||||  | || || || || || ||||||||||| |  || || ||
Sbjct: 360 caagaacattctgttcgtcatctctaaaccagatgtcttcaagagcccaaactcagacac 419

                                                               
Query: 437 gtacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcag 488
            ||||| || ||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 420 ctacgtcatcttcggtgaggcgaagatcgaggatctgagctcgcagctgcag 471



to top

>dbj|AP003412.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1150F11
          Length = 130355

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                         
Query: 414   ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473
             ||||||||||| |  || || || ||||| || ||||| ||||| ||||||||||| |||
Sbjct: 25760 ttcaagagcccaaactcagacacctacgtcatcttcggtgaggcgaagatcgaggatctg 25819

                            
Query: 474   agctcgcagctgcag 488
             |||||||||||||||
Sbjct: 25820 agctcgcagctgcag 25834



to top

>dbj|AP003269.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0504E02
          Length = 137468

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 64/75 (85%)
 Strand = Plus / Plus

                                                                          
Query: 414    ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473
              ||||||||||| |  || || || ||||| || ||||| ||||| ||||||||||| |||
Sbjct: 105900 ttcaagagcccaaactcagacacctacgtcatcttcggtgaggcgaagatcgaggatctg 105959

                             
Query: 474    agctcgcagctgcag 488
              |||||||||||||||
Sbjct: 105960 agctcgcagctgcag 105974



to top

>emb|CT982808.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 493

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcag 503
           |||||||||||||| ||||| |||||| ||||||| ||||||||  | || || || |||
Sbjct: 71  atattcggggaggcaaagattgaggacttgagctctcagctgcaaacacaagctgctcag 130

                        
Query: 504 cagttcaggatgc 516
           |||||| ||||||
Sbjct: 131 cagttccggatgc 143



to top

>emb|CT982049.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 520

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                       
Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcag 503
           |||||||||||||| ||||| |||||| ||||||| ||||||||  | || || || |||
Sbjct: 65  atattcggggaggcaaagattgaggacttgagctctcagctgcaaacacaagctgctcag 124

                        
Query: 504 cagttcaggatgc 516
           |||||| ||||||
Sbjct: 125 cagttccggatgc 137



to top

>gb|AC119415.13| Medicago truncatula clone mth2-27n2, complete sequence
          Length = 139330

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                         
Query: 444   atattcggggaggccaagatcgaggacctgagctcgcagctgcaggcgcaggcggcgcag 503
             ||||| |||||||| || || |||||||||||||| ||| ||||| |||| || || || 
Sbjct: 36446 atatttggggaggcaaaaatagaggacctgagctctcagttgcagacgcaagctgctcaa 36505

                          
Query: 504   cagttcaggatgc 516
             |||||||||||||
Sbjct: 36506 cagttcaggatgc 36518



 Score = 46.1 bits (23), Expect = 0.22
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                         
Query: 662   caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721
             ||||||||||||||| |||||| | ||| | || ||||| ||  | ||||||||||||||
Sbjct: 33363 caaggccgtcaaggctctcaagactcacaatggggacattgttggtgccatcatggagct 33422

                
Query: 722   cac 724
             |||
Sbjct: 33423 cac 33425



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 85/106 (80%)
 Strand = Plus / Plus

                                                                         
Query: 411   gtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggac 470
             |||||||||||||| |  || ||||| ||| | ||||| ||||| || || || ||||| 
Sbjct: 33109 gtgttcaagagcccaaattctgagacctacataatatttggggaagctaaaatagaggat 33168

                                                           
Query: 471   ctgagctcgcagctgcaggcgcaggcggcgcagcagttcaggatgc 516
              | ||||| ||||||||| | || || || ||||||||||||||||
Sbjct: 33169 ttaagctctcagctgcagacacaagctgctcagcagttcaggatgc 33214



to top

>dbj|AK110559.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-168-C10, full
           insert sequence
          Length = 1032

 Score = 58.0 bits (29), Expect = 6e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                       
Query: 378 aagaacatcctgttcgtggtgtcgaagccggacgtgttcaagagcccgacgtcggagacg 437
           |||||||| ||||||||  | || ||||||||||||||||||   ||  |||| || |||
Sbjct: 377 aagaacattctgttcgtcatctctaagccggacgtgttcaagtcgcctgcgtctgatacg 436

                                                                
Query: 438 tacgtgatattcggggaggccaagatcgaggacctgagctcgcagctgcaggc 490
           ||| | || ||||| ||||| ||||| |||||| | | |||||||||||||||
Sbjct: 437 tacatcatcttcggtgaggcgaagattgaggacatcaactcgcagctgcaggc 489



to top

>ref|NW_001081896.1| Leishmania major strain Friedlin chromosome 4, right end
 emb|AL139794.3|LMFLCHR4B Leishmania major Friedlin chromosome 4, right end
          Length = 247462

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Minus

                                                                         
Query: 662   caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721
             ||||||| ||||||||||||||    || ||||||||||||||| | |||||||||||||
Sbjct: 79401 caaggccatcaaggccctcaagaacaacaacggcgacatcgtcaacaccatcatggagct 79342



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                         
Query: 662   caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721
             ||||||| ||||||||||||||    || |||||||||| |||| | |||||||||||||
Sbjct: 81208 caaggccatcaaggccctcaagaacaacaacggcgacattgtcaacaccatcatggagct 81149



to top

>gb|AC109219.13| Mus musculus chromosome 1, clone RP23-429I18, complete sequence
          Length = 204942

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                              
Query: 739    ttcgtttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||||||| |||||
Sbjct: 135033 ttcgtttccgtttccgtttccgtttccgtttc 135002



 Score = 50.1 bits (25), Expect = 0.014
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 741    cgtttccgtttccgtttccgtttcggttt 769
              |||||||||||||||||||||||| ||||
Sbjct: 135025 cgtttccgtttccgtttccgtttccgttt 134997



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 739    ttcgtttccgtttccgtttccgtttcggtttc 770
              ||||||| |||||||||||||||||| |||||
Sbjct: 135039 ttcgttttcgtttccgtttccgtttccgtttc 135008



to top

>gb|AC110232.15| Mus musculus chromosome 1, clone RP23-67H24, complete sequence
          Length = 209668

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                              
Query: 739    ttcgtttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||||||| |||||
Sbjct: 152144 ttcgtttccgtttccgtttccgtttccgtttc 152175



 Score = 50.1 bits (25), Expect = 0.014
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 741    cgtttccgtttccgtttccgtttcggttt 769
              |||||||||||||||||||||||| ||||
Sbjct: 152152 cgtttccgtttccgtttccgtttccgttt 152180



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 739    ttcgtttccgtttccgtttccgtttcggtttc 770
              ||||||| |||||||||||||||||| |||||
Sbjct: 152138 ttcgttttcgtttccgtttccgtttccgtttc 152169



to top

>ref|XM_883486.1| Leishmania major strain Friedlin nascent polypeptide associated
           complex subunit (L4830.08) partial mRNA
          Length = 735

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 52/60 (86%)
 Strand = Plus / Plus

                                                                       
Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721
           ||||||| ||||||||||||||    || ||||||||||||||| | |||||||||||||
Sbjct: 666 caaggccatcaaggccctcaagaacaacaacggcgacatcgtcaacaccatcatggagct 725



to top

>gb|AC109195.27| Mus musculus chromosome 15, clone RP24-212B11, complete sequence
          Length = 168270

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                            
Query: 741    cgtttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||||| |||||
Sbjct: 140827 cgtttccgtttccgtttccgtttccgtttc 140798



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 743    tttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||| |||||
Sbjct: 140831 tttccgtttccgtttccgtttccgtttc 140804



to top

>gb|AC154227.2| Mus musculus BAC clone RP24-142A23 from chromosome 14, complete sequence
          Length = 156644

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 741    cgtttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||||| |||||
Sbjct: 144787 cgtttccgtttccgtttccgtttccgtttc 144816



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 741    cgtttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||||| |||||
Sbjct: 144793 cgtttccgtttccgtttccgtttccgtttc 144822



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 741    cgtttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||||| |||||
Sbjct: 144799 cgtttccgtttccgtttccgtttccgtttc 144828



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 743    tttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||| |||||
Sbjct: 144783 tttccgtttccgtttccgtttccgtttc 144810



to top

>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence
          Length = 3181762

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                             
Query: 741     cgtttccgtttccgtttccgtttcggtttc 770
               |||||||||||||||||||||||| |||||
Sbjct: 2914889 cgtttccgtttccgtttccgtttccgtttc 2914918



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                             
Query: 741     cgtttccgtttccgtttccgtttcggtttc 770
               |||||||||||||||||||||||| |||||
Sbjct: 2914895 cgtttccgtttccgtttccgtttccgtttc 2914924



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 743     tttccgtttccgtttccgtttcggtttc 770
               |||||||||||||||||||||| |||||
Sbjct: 2914885 tttccgtttccgtttccgtttccgtttc 2914912



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 741     cgtttccgtttccgtttccgtt 762
               ||||||||||||||||||||||
Sbjct: 2914907 cgtttccgtttccgtttccgtt 2914928



to top

>ref|XM_847221.1| PREDICTED: Canis familiaris similar to nascent
           polypeptide-associated complex alpha polypeptide
           (LOC609875), mRNA
          Length = 360

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                         
Query: 696 gacatcgtcagcgccatcatggagctcacc 725
           |||||||||| |||||||||||||||||||
Sbjct: 325 gacatcgtcaacgccatcatggagctcacc 354



to top

>gb|AC105969.17| Mus musculus chromosome 15, clone RP23-477B23, complete sequence
          Length = 189238

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 741    cgtttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||||| |||||
Sbjct: 177726 cgtttccgtttccgtttccgtttccgtttc 177755



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 743    tttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||| |||||
Sbjct: 177722 tttccgtttccgtttccgtttccgtttc 177749



to top

>emb|AL115467.1|CNS01CFN Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 741 cgtttccgtttccgtttccgtttcggtttc 770
           |||||||||||||||||||||||| |||||
Sbjct: 562 cgtttccgtttccgtttccgtttccgtttc 533



 Score = 46.1 bits (23), Expect = 0.22
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 744 ttccgtttccgtttccgtttcggtttc 770
           ||||||||||||||||||||| |||||
Sbjct: 565 ttccgtttccgtttccgtttccgtttc 539



to top

>emb|CT029334.1| Poplar cDNA sequences
          Length = 743

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 55/65 (84%)
 Strand = Plus / Plus

                                                                       
Query: 414 ttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaagatcgaggacctg 473
           ||||||||||| || || || || || ||||| || |||||||| |||||||||||| ||
Sbjct: 413 ttcaagagcccaacatctgacacatatgtgatctttggggaggcgaagatcgaggacttg 472

                
Query: 474 agctc 478
           |||||
Sbjct: 473 agctc 477



to top

>ref|NW_001091929.1| Theileria annulata strain Ankara clone C9
          Length = 2592520

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 742     gtttccgtttccgtttccgtttcggtttc 770
               ||||||||||||||||||||||| |||||
Sbjct: 2533885 gtttccgtttccgtttccgtttccgtttc 2533857



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 741     cgtttccgtttccgtttccgtttc 764
               ||||||||||||||||||||||||
Sbjct: 2533880 cgtttccgtttccgtttccgtttc 2533857



 Score = 46.1 bits (23), Expect = 0.22
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                          
Query: 741     cgtttccgtttccgtttccgtttcggt 767
               ||||||||||||||||||||| |||||
Sbjct: 2533874 cgtttccgtttccgtttccgtatcggt 2533848



to top

>ref|NM_114807.2| Arabidopsis thaliana unknown protein (AT3G49470) mRNA, complete cds
          Length = 938

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484
           |||||||| |||||||||||||||||  ||||||| |||||
Sbjct: 447 atattcggtgaggccaagatcgaggatttgagctctcagct 487



to top

>gb|AC125081.3| Mus musculus BAC clone RP24-89D17 from chromosome 3, complete sequence
          Length = 220895

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 738    cttcgtttccgtttccgtttccgtttcggtttc 770
              |||| |||||||||||||||||||||| |||||
Sbjct: 157668 cttcttttccgtttccgtttccgtttccgtttc 157700



to top

>gb|AY072536.1| Arabidopsis thaliana alpha NAC-like protein (At3g49470; T9C5.70)
           mRNA, complete cds
          Length = 706

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484
           |||||||| |||||||||||||||||  ||||||| |||||
Sbjct: 364 atattcggtgaggccaagatcgaggatttgagctctcagct 404



to top

>emb|AL132964.2|ATT9C5 Arabidopsis thaliana DNA chromosome 3, BAC clone T9C5
          Length = 104204

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 444   atattcggggaggccaagatcgaggacctgagctcgcagct 484
             |||||||| |||||||||||||||||  ||||||| |||||
Sbjct: 17635 atattcggtgaggccaagatcgaggatttgagctctcagct 17675



to top

>gb|AF370545.1|AF370545 Arabidopsis thaliana alpha NAC-like protein (T9C5.70) mRNA,
           complete cds
          Length = 966

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484
           |||||||| |||||||||||||||||  ||||||| |||||
Sbjct: 447 atattcggtgaggccaagatcgaggatttgagctctcagct 487



to top

>gb|AC012329.5|AC012329 Arabidopsis thaliana chromosome 1 BAC T1G12 genomic sequence, complete
             sequence
          Length = 80367

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 444   atattcggggaggccaagatcgaggacctgagctcgcagct 484
             |||||||| |||||||||||||||||  ||||||| |||||
Sbjct: 62775 atattcggtgaggccaagatcgaggatttgagctctcagct 62815



to top

>ref|XM_949594.1| Theileria annulata strain Ankara hypothetical protein (TA19445)
           partial mRNA
          Length = 1881

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 742 gtttccgtttccgtttccgtttcggtttc 770
           ||||||||||||||||||||||| |||||
Sbjct: 494 gtttccgtttccgtttccgtttccgtttc 466



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 741 cgtttccgtttccgtttccgtttc 764
           ||||||||||||||||||||||||
Sbjct: 489 cgtttccgtttccgtttccgtttc 466



 Score = 46.1 bits (23), Expect = 0.22
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 741 cgtttccgtttccgtttccgtttcggt 767
           ||||||||||||||||||||| |||||
Sbjct: 483 cgtttccgtttccgtttccgtatcggt 457



to top

>emb|BX825921.1|CNS0A553 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL72ZG01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 923

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 444 atattcggggaggccaagatcgaggacctgagctcgcagct 484
           |||||||| |||||||||||||||||  ||||||| |||||
Sbjct: 425 atattcggtgaggccaagatcgaggatttgagctctcagct 465



to top

>dbj|AP004512.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10L16, TM0042,
             complete sequence
          Length = 85815

 Score = 50.1 bits (25), Expect = 0.014
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 735   tttcttcgtttccgtttccgtttccgttt 763
             ||||| |||||||||||||||||||||||
Sbjct: 45017 tttctccgtttccgtttccgtttccgttt 44989



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 745   tccgtttccgtttccgtttcggttt 769
             |||||||||||||||||||| ||||
Sbjct: 45013 tccgtttccgtttccgtttccgttt 44989



to top

>gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete sequence
          Length = 23011544

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 740     tcgtttccgtttccgtttccgtttcggtttcg 771
               ||||||| |||||||||||||||||| |||||
Sbjct: 2868026 tcgtttctgtttccgtttccgtttcgctttcg 2867995



to top

>gb|AE014298.4| Drosophila melanogaster chromosome X, complete sequence
          Length = 22422827

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                       
Query: 739     ttcgtttccgtttccgtttccgtt 762
               ||||||||||||||||||||||||
Sbjct: 3237280 ttcgtttccgtttccgtttccgtt 3237257



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 742      gtttccgtttccgtttccgtttcg 765
                ||||||||||||||||||||||||
Sbjct: 12128711 gtttccgtttccgtttccgtttcg 12128734



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 742     gtttccgtttccgtttccgttt 763
               ||||||||||||||||||||||
Sbjct: 8410184 gtttccgtttccgtttccgttt 8410163



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 298     agaagaagagccgcaaggcca 318
               |||||||||||||||||||||
Sbjct: 4789776 agaagaagagccgcaaggcca 4789796



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 743      tttccgtttccgtttccgttt 763
                |||||||||||||||||||||
Sbjct: 12979475 tttccgtttccgtttccgttt 12979455



to top

>ref|XM_362390.1| Magnaporthe grisea 70-15 hypothetical protein (MG04836.4) partial
           mRNA
          Length = 1464

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 741 cgtttccgtttccgtttccgtttc 764
           ||||||||||||||||||||||||
Sbjct: 115 cgtttccgtttccgtttccgtttc 92



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 746 ccgtttccgtttccgtttcggtttc 770
           ||||||||||||||||||| |||||
Sbjct: 116 ccgtttccgtttccgtttccgtttc 92



to top

>ref|XM_001004040.1| PREDICTED: Mus musculus cDNA sequence AB182283 (AB182283), mRNA
          Length = 4896

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 402  aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461
            |||||||| || |||||||||||  | || || || |||||| | || || |||||||||
Sbjct: 4480 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4539

                        
Query: 462  atcgaggacctg 473
            ||||||||||||
Sbjct: 4540 atcgaggacctg 4551



to top

>ref|XM_109794.6| PREDICTED: Mus musculus cDNA sequence AB182283, transcript variant 1
            (AB182283), mRNA
          Length = 4896

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 402  aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461
            |||||||| || |||||||||||  | || || || |||||| | || || |||||||||
Sbjct: 4480 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4539

                        
Query: 462  atcgaggacctg 473
            ||||||||||||
Sbjct: 4540 atcgaggacctg 4551



to top

>ref|NM_121388.4| Arabidopsis thaliana unknown protein (AT5G13850) mRNA, complete cds
          Length = 842

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488
           ||||||||||| |||||  |||||||||||||||||
Sbjct: 380 gaggccaagatagaggatttgagctcgcagctgcag 415



to top

>ref|XM_609695.2| PREDICTED: Bos taurus similar to Nascent polypeptide-associated
            complex alpha subunit, muscle-specific form (Alpha-NAC,
            muscle-specific form) (LOC531208), mRNA
          Length = 8513

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 438  tacgtgatattcggggaggccaagatcgaggacctg 473
            |||||| | ||||| |||||||||||||||||||||
Sbjct: 7960 tacgtggtcttcggcgaggccaagatcgaggacctg 7995



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 696  gacatcgtcagcgccatcatggagct 721
            |||||||||| |||||||||||||||
Sbjct: 8236 gacatcgtcaacgccatcatggagct 8261



to top

>gb|BT014875.1| Arabidopsis thaliana At5g13850 gene, complete cds
          Length = 615

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488
           ||||||||||| |||||  |||||||||||||||||
Sbjct: 331 gaggccaagatagaggatttgagctcgcagctgcag 366



to top

>ref|NM_167320.1| Drosophila melanogaster CG32655-RA (CG32655), mRNA
          Length = 993

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 742 gtttccgtttccgtttccgtttcg 765
           ||||||||||||||||||||||||
Sbjct: 986 gtttccgtttccgtttccgtttcg 963



to top

>ref|NM_164510.2| Drosophila melanogaster CG2991-RC, transcript variant C (CG2991),
            mRNA
          Length = 2892

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 740  tcgtttccgtttccgtttccgtttcggtttcg 771
            ||||||| |||||||||||||||||| |||||
Sbjct: 2365 tcgtttctgtttccgtttccgtttcgctttcg 2334



to top

>ref|NM_164509.2| Drosophila melanogaster CG2991-RA, transcript variant A (CG2991),
            mRNA
          Length = 3098

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 740  tcgtttccgtttccgtttccgtttcggtttcg 771
            ||||||| |||||||||||||||||| |||||
Sbjct: 2571 tcgtttctgtttccgtttccgtttcgctttcg 2540



to top

>ref|NM_134881.5| Drosophila melanogaster CG2991-RB, transcript variant B (CG2991),
            mRNA
          Length = 3008

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 740  tcgtttccgtttccgtttccgtttcggtttcg 771
            ||||||| |||||||||||||||||| |||||
Sbjct: 2481 tcgtttctgtttccgtttccgtttcgctttcg 2450



to top

>gb|AY070417.1| Arabidopsis thaliana At5g13850 mRNA sequence
          Length = 818

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488
           ||||||||||| |||||  |||||||||||||||||
Sbjct: 374 gaggccaagatagaggatttgagctcgcagctgcag 409



to top

>ref|XM_752185.1| Ustilago maydis 521 hypothetical protein (UM01131.1) partial mRNA
          Length = 2646

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 741  cgtttccgtttccgtttccgtttc 764
            ||||||||||||||||||||||||
Sbjct: 2557 cgtttccgtttccgtttccgtttc 2534



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 741  cgtttccgtttccgtttccgtttcggtttc 770
            |||| ||||||||||||||||||| |||||
Sbjct: 2563 cgttgccgtttccgtttccgtttccgtttc 2534



to top

>gb|AC105351.2| Drosophila melanogaster X BAC RP98-34B12 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 179795

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 739   ttcgtttccgtttccgtttccgtt 762
             ||||||||||||||||||||||||
Sbjct: 29815 ttcgtttccgtttccgtttccgtt 29838



to top

>ref|XM_742602.1| Aspergillus fumigatus Af293 nascent polypeptide-associated complex
           subunit (Afu6g03820) partial mRNA
          Length = 615

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 447 ttcggggaggccaagatcgaggacctga 474
           ||||| ||||||||||||||||||||||
Sbjct: 295 ttcggtgaggccaagatcgaggacctga 322



to top

>gb|AC023687.3| Drosophila melanogaster X BAC RP98-36C7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 185848

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 742    gtttccgtttccgtttccgtttcg 765
              ||||||||||||||||||||||||
Sbjct: 132602 gtttccgtttccgtttccgtttcg 132579



to top

>gb|AC023690.3| Drosophila melanogaster X BAC RP98-6M20 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 176233

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 742    gtttccgtttccgtttccgtttcg 765
              ||||||||||||||||||||||||
Sbjct: 176102 gtttccgtttccgtttccgtttcg 176125



to top

>dbj|AB182283.1| Mus musculus mKIAA0363 mRNA for mKIAA0363 protein, partial cds
          Length = 4409

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 402  aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461
            |||||||| || |||||||||||  | || || || |||||| | || || |||||||||
Sbjct: 3997 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4056

                        
Query: 462  atcgaggacctg 473
            ||||||||||||
Sbjct: 4057 atcgaggacctg 4068



to top

>gb|AC009392.6| Drosophila melanogaster, chromosome 2L, region 23A-23E, BAC clone
              BACR42J13, complete sequence
          Length = 179125

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 740    tcgtttccgtttccgtttccgtttcggtttcg 771
              ||||||| |||||||||||||||||| |||||
Sbjct: 143867 tcgtttctgtttccgtttccgtttcgctttcg 143836



to top

>gb|AF303741.1|AF303741 Chilo iridescent virus complete genome
          Length = 212482

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 741    cgtttccgtttccgtttccgtttc 764
              ||||||||||||||||||||||||
Sbjct: 110544 cgtttccgtttccgtttccgtttc 110521



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 745    tccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||| |||||
Sbjct: 110546 tccgtttccgtttccgtttccgtttc 110521



to top

>emb|AL121800.1|DMBN5I9 Drosophila melanogaster BAC clone BACN5I9
          Length = 96433

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 739   ttcgtttccgtttccgtttccgtt 762
             ||||||||||||||||||||||||
Sbjct: 53348 ttcgtttccgtttccgtttccgtt 53371



to top

>ref|NM_204641.1| Gallus gallus FK506 binding protein 3, 25kDa (FKBP3), mRNA
 emb|AJ312905.1|GGA312905 Gallus gallus mRNA for putative FK506-binding protein (FKBP25 gene)
          Length = 893

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 132 aaggccgaggagcccgcggaggacggggcgcc 163
           ||||||||||||||||||||||| ||| ||||
Sbjct: 323 aaggccgaggagcccgcggaggaggggccgcc 354



to top

>gb|BT006012.1| Drosophila melanogaster LD08641 full insert cDNA
          Length = 3111

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 740  tcgtttccgtttccgtttccgtttcggtttcg 771
            ||||||| |||||||||||||||||| |||||
Sbjct: 2571 tcgtttctgtttccgtttccgtttcgctttcg 2540



to top

>gb|AC154857.2| Mus musculus BAC clone RP23-16K21 from chromosome 13, complete sequence
          Length = 214859

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 743    tttccgtttccgtttccgtttcggtttc 770
              |||||||||||||||||||||| |||||
Sbjct: 159687 tttccgtttccgtttccgtttccgtttc 159660



 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 741    cgtttccgtttccgtttccgtttc 764
              ||||||||||||||||||||||||
Sbjct: 159683 cgtttccgtttccgtttccgtttc 159660



to top

>dbj|AB005230.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MAC12
          Length = 74613

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 453   gaggccaagatcgaggacctgagctcgcagctgcag 488
             ||||||||||| |||||  |||||||||||||||||
Sbjct: 22865 gaggccaagatagaggatttgagctcgcagctgcag 22900



to top

>emb|BX830689.1|CNS09ZFD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS14ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 678

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 453 gaggccaagatcgaggacctgagctcgcagctgcag 488
           ||||||||||| |||||  |||||||||||||||||
Sbjct: 380 gaggccaagatagaggatttgagctcgcagctgcag 415



to top

>gb|BC072589.1| Mus musculus similar to mKIAA0363 protein, mRNA (cDNA clone
            IMAGE:5721236)
          Length = 4914

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                        
Query: 402  aagccggacgtgttcaagagcccgacgtcggagacgtacgtgatattcggggaggccaag 461
            |||||||| || |||||||||||  | || || || |||||| | || || |||||||||
Sbjct: 4480 aagccggatgtcttcaagagccccgcctcagacacctacgtggtctttggcgaggccaag 4539

                        
Query: 462  atcgaggacctg 473
            ||||||||||||
Sbjct: 4540 atcgaggacctg 4551



to top

>emb|AJ404610.1|LIN404610 Leishmania infantum mRNA for nascent polypeptide associated complex
           homologue, alpha chain
          Length = 1321

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721
           ||||||| ||||||| ||||||    || ||||||||||||||| | |||||||||||||
Sbjct: 567 caaggccatcaaggcgctcaagaacaacaacggcgacatcgtcaacaccatcatggagct 626



to top

>ref|XM_722229.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY06639)
           partial mRNA
          Length = 681

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 742 gtttccgtttccgtttccgtttcggttt 769
           ||||||||||||||||||||||| ||||
Sbjct: 471 gtttccgtttccgtttccgtttccgttt 444



 Score = 46.1 bits (23), Expect = 0.22
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 741 cgtttccgtttccgtttccgttt 763
           |||||||||||||||||||||||
Sbjct: 466 cgtttccgtttccgtttccgttt 444



to top

>gb|AC007765.1|AC007765 Drosophila melanogaster, chromosome 2L, region 23C1-23C5, P1 clones
              DS02190 and DS00906, complete sequence
          Length = 163403

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 740    tcgtttccgtttccgtttccgtttcggtttcg 771
              ||||||| |||||||||||||||||| |||||
Sbjct: 162428 tcgtttctgtttccgtttccgtttcgctttcg 162459



to top

>ref|XM_883488.1| Leishmania major strain Friedlin nascent polypeptide associated
           complex subunit (L4830.07) partial mRNA
          Length = 519

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                       
Query: 662 caaggccgtcaaggccctcaaggcgcacgacggcgacatcgtcagcgccatcatggagct 721
           ||||||| ||||||||||||||    || |||||||||| |||| | |||||||||||||
Sbjct: 450 caaggccatcaaggccctcaagaacaacaacggcgacattgtcaacaccatcatggagct 509



to top

>gb|AC007478.1|AC007478 Arabidopsis thaliana BAC F15A18 from chromosome V near 68.5 cM,
             complete sequence
          Length = 107931

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 741   cgtttccgtttccgtttccgtttc 764
             ||||||||||||||||||||||||
Sbjct: 50300 cgtttccgtttccgtttccgtttc 50277



to top

>emb|AJ871913.1| Coffea canephora subsp. canephora microsatellite DNA, clone rev
           95C05
          Length = 1155

 Score = 48.1 bits (24), Expect = 0.057
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 741 cgtttccgtttccgtttccgtttc 764
           ||||||||||||||||||||||||
Sbjct: 800 cgtttccgtttccgtttccgtttc 777



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 746 ccgtttccgtttccgtttcggtttc 770
           ||||||||||||||||||| |||||
Sbjct: 801 ccgtttccgtttccgtttccgtttc 777



to top

>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence
          Length = 21146708

 Score = 46.1 bits (23), Expect = 0.22
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 746      ccgtttccgtttccgtttcggtttcga 772
                ||||||||||||||||||| |||||||
Sbjct: 12215713 ccgtttccgtttccgtttcagtttcga 12215687



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 737     tcttcgtttccgtttccgtttc 758
               ||||||||||||||||||||||
Sbjct: 6885842 tcttcgtttccgtttccgtttc 6885821



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 696     gacatcgtcagcgccatcatggagct 721
               |||||||||| |||||||||||||||
Sbjct: 8647405 gacatcgtcaacgccatcatggagct 8647380



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 741      cgtttccgtttccgtttccgtttcg 765
                |||||||||||||||||| ||||||
Sbjct: 12215712 cgtttccgtttccgtttcagtttcg 12215688



to top

>ref|XM_708425.1| Candida albicans SC5314 hypothetical protein (CaO19.11329), mRNA
          Length = 1293

 Score = 46.1 bits (23), Expect = 0.22
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 742  gtttccgtttccgtttccgtttc 764
            |||||||||||||||||||||||
Sbjct: 1202 gtttccgtttccgtttccgtttc 1180



to top

>ref|XM_708386.1| Candida albicans SC5314 hypothetical protein (CaO19.3848), mRNA
          Length = 1293

 Score = 46.1 bits (23), Expect = 0.22
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 742  gtttccgtttccgtttccgtttc 764
            |||||||||||||||||||||||
Sbjct: 1202 gtttccgtttccgtttccgtttc 1180



to top

>gb|AC123520.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0034O04, complete sequence
          Length = 164882

 Score = 46.1 bits (23), Expect = 0.22
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 742   gtttccgtttccgtttccgtttc 764
             |||||||||||||||||||||||
Sbjct: 51676 gtttccgtttccgtttccgtttc 51654



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score = 46.1 bits (23), Expect = 0.22
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 742     gtttccgtttccgtttccgtttc 764
               |||||||||||||||||||||||
Sbjct: 5841792 gtttccgtttccgtttccgtttc 5841770



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 582      gaggaggaggtggtggacgaga 603
                ||||||||||||||||||||||
Sbjct: 12643585 gaggaggaggtggtggacgaga 12643564



to top

>gb|AC009356.3|AC009356 Drosophila melanogaster, chromosome 2R, region 52E-53A, BAC clone
             BACR25I17, complete sequence
          Length = 157835

 Score = 46.1 bits (23), Expect = 0.22
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 746   ccgtttccgtttccgtttcggtttcga 772
             ||||||||||||||||||| |||||||
Sbjct: 89548 ccgtttccgtttccgtttcagtttcga 89522



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 741   cgtttccgtttccgtttccgtttcg 765
             |||||||||||||||||| ||||||
Sbjct: 89547 cgtttccgtttccgtttcagtttcg 89523



to top

>gb|AC008230.4|AC008230 Drosophila melanogaster, chromosome 2R, region 53A-53C, BAC clone
             BACR17I17, complete sequence
          Length = 159640

 Score = 46.1 bits (23), Expect = 0.22
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 746   ccgtttccgtttccgtttcggtttcga 772
             ||||||||||||||||||| |||||||
Sbjct: 66098 ccgtttccgtttccgtttcagtttcga 66072



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 741   cgtttccgtttccgtttccgtttcg 765
             |||||||||||||||||| ||||||
Sbjct: 66097 cgtttccgtttccgtttcagtttcg 66073



to top

>ref|XM_001222367.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_06273)
           mRNA, complete cds
          Length = 570

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 447 ttcggggaggccaagatcgaggacct 472
           ||||| ||||||||||||||||||||
Sbjct: 304 ttcggcgaggccaagatcgaggacct 329



to top

>dbj|AK242375.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J080039F09,
           full insert sequence
          Length = 1373

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 572 cgtcgccgacgaggaggaggtggtgg 597
           ||||||||| ||||||||||||||||
Sbjct: 677 cgtcgccgaggaggaggaggtggtgg 702



to top

>ref|NM_001074299.1| Oryza sativa (japonica cultivar-group) Os11g0421800 (Os11g0421800)
           mRNA, complete cds
          Length = 1154

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 582 gaggaggaggtggtggacgaga 603
           ||||||||||||||||||||||
Sbjct: 311 gaggaggaggtggtggacgaga 332



to top

>gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete sequence
          Length = 24543557

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 742     gtttccgtttccgtttccgttt 763
               ||||||||||||||||||||||
Sbjct: 8463803 gtttccgtttccgtttccgttt 8463824



to top

>gb|AE014297.2| Drosophila melanogaster chromosome 3R, complete sequence
          Length = 27905053

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 739     ttcgtttccgtttccgtttccgtttcggtttcga 772
               ||||||| |||||||||||||| ||| |||||||
Sbjct: 5290150 ttcgttttcgtttccgtttccgcttctgtttcga 5290117



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 739      ttcgtttccgtttccgtttccgtttcggtttcg 771
                ||||||||| ||||| ||||| |||||||||||
Sbjct: 10334251 ttcgtttccatttccatttccatttcggtttcg 10334219



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 742      gtttccgtttccgtttccgtttcggtttc 770
                ||||| ||||||||||| |||||||||||
Sbjct: 14757162 gtttcagtttccgtttcagtttcggtttc 14757190



to top

>gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete genome
          Length = 3696649

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 682     aggcgcacgacggcgacatcgt 703
               ||||||||||||||||||||||
Sbjct: 3021226 aggcgcacgacggcgacatcgt 3021205



to top

>ref|NM_202414.1| Arabidopsis thaliana ICS1 (ISOCHORISMATE SYNTHASEI); isochorismate
           synthase (ICS1) mRNA, complete cds
          Length = 2120

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 741 cgtttccgtttccgtttccgtt 762
           ||||||||||||||||||||||
Sbjct: 552 cgtttccgtttccgtttccgtt 531



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 744 ttccgtttccgtttccgtttc 764
           |||||||||||||||||||||
Sbjct: 555 ttccgtttccgtttccgtttc 535



to top

>ref|NM_106129.2| Arabidopsis thaliana ICS1 (ISOCHORISMATE SYNTHASEI); isochorismate
           synthase (ICS1) mRNA, complete cds
          Length = 2051

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 741 cgtttccgtttccgtttccgtt 762
           ||||||||||||||||||||||
Sbjct: 553 cgtttccgtttccgtttccgtt 532



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 744 ttccgtttccgtttccgtttc 764
           |||||||||||||||||||||
Sbjct: 556 ttccgtttccgtttccgtttc 536



to top

>gb|AC146939.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0064M09 map near S6115, complete sequence
          Length = 215240

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 582   gaggaggaggtggtggacgaga 603
             ||||||||||||||||||||||
Sbjct: 26261 gaggaggaggtggtggacgaga 26240



to top

>gb|AY260902.1| Rhodospirillum centenum che2 gene cluster, complete sequence
          Length = 11332

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 674   ggccctcaaggcgcacgacggc 695
             ||||||||||||||||||||||
Sbjct: 10747 ggccctcaaggcgcacgacggc 10726



to top

>gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete sequence
          Length = 182105

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 696   gacatcgtcagcgccatcatggagct 721
             |||||||||| |||||||||||||||
Sbjct: 23159 gacatcgtcaacgccatcatggagct 23134



to top

>gb|AY317248.1| Mus musculus olfactory receptor Olfr164 (Olfr164) gene, complete
           cds
          Length = 942

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 362 taccatcaagagagccaagaac 383
           ||||||||||||||||||||||
Sbjct: 472 taccatcaagagagccaagaac 451



to top

>ref|XM_543223.2| PREDICTED: Canis familiaris similar to protease, serine, 12,
           transcript variant 1 (LOC486097), mRNA
          Length = 1835

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 482 gctgcaggcgcaggcggcgcag 503
           ||||||||||||||||||||||
Sbjct: 815 gctgcaggcgcaggcggcgcag 836



to top

>gb|AY231744.1| Drosophila yakuba clone yak-em_Nacalpha mRNA sequence
          Length = 198

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 696 gacatcgtcagcgccatcatggagct 721
           |||||||||| |||||||||||||||
Sbjct: 163 gacatcgtcaacgccatcatggagct 188



to top

>ref|NM_165950.1| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RC, transcript variant C
           (Nacalpha), mRNA
          Length = 874

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 696 gacatcgtcagcgccatcatggagct 721
           |||||||||| |||||||||||||||
Sbjct: 672 gacatcgtcaacgccatcatggagct 697



to top

>ref|NM_134312.2| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RA, transcript variant A
           (Nacalpha), mRNA
          Length = 870

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 696 gacatcgtcagcgccatcatggagct 721
           |||||||||| |||||||||||||||
Sbjct: 663 gacatcgtcaacgccatcatggagct 688



to top

>gb|AC112681.12| Mus musculus chromosome 16, clone RP23-272P19, complete sequence
          Length = 228367

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 362    taccatcaagagagccaagaac 383
              ||||||||||||||||||||||
Sbjct: 115271 taccatcaagagagccaagaac 115292



to top

>ref|NM_057868.3| Drosophila melanogaster Nascent polypeptide associated complex
           protein alpha subunit CG8759-RB, transcript variant B
           (Nacalpha), mRNA
          Length = 897

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 696 gacatcgtcagcgccatcatggagct 721
           |||||||||| |||||||||||||||
Sbjct: 690 gacatcgtcaacgccatcatggagct 715



to top

>gb|AY124864.1| Arabidopsis thaliana At1g74710/F25A4.31 mRNA, complete cds
          Length = 1710

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 741 cgtttccgtttccgtttccgtt 762
           ||||||||||||||||||||||
Sbjct: 457 cgtttccgtttccgtttccgtt 436



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 744 ttccgtttccgtttccgtttc 764
           |||||||||||||||||||||
Sbjct: 460 ttccgtttccgtttccgtttc 440



to top

>gb|AC010041.7| Drosophila melanogaster 3L BAC RP98-13D12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 174712

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 742    gtttccgtttccgtttccgttt 763
              ||||||||||||||||||||||
Sbjct: 108289 gtttccgtttccgtttccgttt 108310



to top

>ref|NM_146451.1| Mus musculus olfactory receptor 164 (Olfr164), mRNA
 gb|AY073647.1| Mus musculus olfactory receptor MOR279-2 gene, complete cds
          Length = 948

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 362 taccatcaagagagccaagaac 383
           ||||||||||||||||||||||
Sbjct: 478 taccatcaagagagccaagaac 457



to top

>gb|AF367342.1| Arabidopsis thaliana F25A4.31/F25A4.31 mRNA, complete cds
          Length = 2023

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 741 cgtttccgtttccgtttccgtt 762
           ||||||||||||||||||||||
Sbjct: 551 cgtttccgtttccgtttccgtt 530



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 744 ttccgtttccgtttccgtttc 764
           |||||||||||||||||||||
Sbjct: 554 ttccgtttccgtttccgtttc 534



to top

>gb|AY075332.1| Drosophila melanogaster GH11940 full length cDNA
          Length = 890

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 696 gacatcgtcagcgccatcatggagct 721
           |||||||||| |||||||||||||||
Sbjct: 661 gacatcgtcaacgccatcatggagct 686



to top

>gb|AY056055.1| Arabidopsis thaliana isochorismate synthase 1 precursor (ICS1)
           mRNA, complete cds; nuclear gene for plastid product
          Length = 2057

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 741 cgtttccgtttccgtttccgtt 762
           ||||||||||||||||||||||
Sbjct: 553 cgtttccgtttccgtttccgtt 532



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 744 ttccgtttccgtttccgtttc 764
           |||||||||||||||||||||
Sbjct: 556 ttccgtttccgtttccgtttc 536



to top

>emb|BX016202.1|CNS08KNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 585 gaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtcatg 638
           ||||||| ||||||||| ||||||||||| | | | |||||||| || ||||||
Sbjct: 687 gaggaggaggtggacgataccggcatcgacgacagggacatcgatctggtcatg 634



to top

>emb|BX016201.1|CNS08KNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 585 gaggaggtggtggacgagaccggcatcgaggcccgcgacatcgacctcgtcatg 638
           ||||||| ||||||||| ||||||||||| | | | |||||||| || ||||||
Sbjct: 540 gaggaggaggtggacgataccggcatcgacgacagggacatcgatctggtcatg 593



to top

>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence
          Length = 2325379

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 743    tttccgtttccgtttccgtttc 764
              ||||||||||||||||||||||
Sbjct: 688031 tttccgtttccgtttccgtttc 688052



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 741    cgtttccgtttccgtttccgtt 762
              ||||||||||||||||||||||
Sbjct: 688035 cgtttccgtttccgtttccgtt 688056



to top

>gb|AC009209.6|AC009209 Drosophila melanogaster, chromosome 2R, region 47D-47D, BAC clone
             BACR24G16, complete sequence
          Length = 165974

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 737   tcttcgtttccgtttccgtttc 758
             ||||||||||||||||||||||
Sbjct: 79526 tcttcgtttccgtttccgtttc 79505



to top

>dbj|AP003346.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0434C04
          Length = 150064

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 739    ttcgtttccgtttccgtttccg 760
              ||||||||||||||||||||||
Sbjct: 109395 ttcgtttccgtttccgtttccg 109374



to top

>dbj|AP003431.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1099D03
          Length = 191022

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 739   ttcgtttccgtttccgtttccg 760
             ||||||||||||||||||||||
Sbjct: 46687 ttcgtttccgtttccgtttccg 46666



to top

>gb|AC010581.3|AC010581 Drosophila melanogaster, chromosome 3R, region 85D-85D, BAC clone
              BACR19J06, complete sequence
          Length = 175053

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 739    ttcgtttccgtttccgtttccgtttcggtttcga 772
              ||||||| |||||||||||||| ||| |||||||
Sbjct: 100083 ttcgttttcgtttccgtttccgcttctgtttcga 100050



to top

>gb|AC082645.13|AC082645 Oryza sativa chromosome 3 BAC OSJNBb0033N16 genomic sequence, complete
             sequence
          Length = 143681

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 572   cgtcgccgacgaggaggaggtggtgg 597
             ||||||||| ||||||||||||||||
Sbjct: 44843 cgtcgccgaggaggaggaggtggtgg 44818



to top

>gb|AC018445.21| Homo sapiens chromosome 18, clone RP11-196B3, complete sequence
          Length = 162265

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 584   ggaggaggtggtggacgagacc 605
             ||||||||||||||||||||||
Sbjct: 57491 ggaggaggtggtggacgagacc 57470



to top

>gb|AC011765.6|AC011765 Arabidopsis thaliana chromosome 1 BAC F1M20 genomic sequence, complete
              sequence
          Length = 134402

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 741    cgtttccgtttccgtttccgtt 762
              ||||||||||||||||||||||
Sbjct: 128016 cgtttccgtttccgtttccgtt 127995



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 744    ttccgtttccgtttccgtttc 764
              |||||||||||||||||||||
Sbjct: 128019 ttccgtttccgtttccgtttc 127999



to top

>dbj|AP005149.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBb0005G07
          Length = 142850

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 739   ttcgtttccgtttccgtttccg 760
             ||||||||||||||||||||||
Sbjct: 79286 ttcgtttccgtttccgtttccg 79265



to top

>gb|AF017783.2|AF017783 Drosophila melanogaster alpha NAC, diacylglycerol kinase epsilon
           and ubiquinol-cytochrome C reductase complex genes,
           complete cds; and unknown gene
          Length = 4728

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 696 gacatcgtcagcgccatcatggagct 721
           |||||||||| |||||||||||||||
Sbjct: 756 gacatcgtcaacgccatcatggagct 781



to top

>gb|AF229199.1|AF229199 Oryza sativa chromosome 1 clone OSJNBa0048I01, complete sequence
          Length = 193444

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 739    ttcgtttccgtttccgtttccg 760
              ||||||||||||||||||||||
Sbjct: 181795 ttcgtttccgtttccgtttccg 181774



to top

>dbj|AP002873.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0552C05
          Length = 136586

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 743   tttccgtttccgtttccgtttc 764
             ||||||||||||||||||||||
Sbjct: 49428 tttccgtttccgtttccgtttc 49449



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 741   cgtttccgtttccgtttccgtt 762
             ||||||||||||||||||||||
Sbjct: 49432 cgtttccgtttccgtttccgtt 49453



to top

>dbj|AP002871.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0475H04
          Length = 143337

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 743    tttccgtttccgtttccgtttc 764
              ||||||||||||||||||||||
Sbjct: 123248 tttccgtttccgtttccgtttc 123269



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 741    cgtttccgtttccgtttccgtt 762
              ||||||||||||||||||||||
Sbjct: 123252 cgtttccgtttccgtttccgtt 123273



to top

>gb|AC023696.4| Drosophila melanogaster X BAC RP98-17J10 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 174367

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 742    gtttccgtttccgtttccgttt 763
              ||||||||||||||||||||||
Sbjct: 106420 gtttccgtttccgtttccgttt 106399



to top

>dbj|AK106317.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-101-E02, full
           insert sequence
          Length = 1154

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 582 gaggaggaggtggtggacgaga 603
           ||||||||||||||||||||||
Sbjct: 311 gaggaggaggtggtggacgaga 332



to top

>emb|AL113807.1|CNS01B5J Botrytis cinerea strain T4 cDNA library
          Length = 679

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 741 cgtttccgtttccgtttccgtttcggtttc 770
           |||||||| ||||||||||||||| |||||
Sbjct: 562 cgtttccggttccgtttccgtttccgtttc 533



to top

>emb|BX814970.1|CNS0ADXM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZG02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2101

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 741 cgtttccgtttccgtttccgtt 762
           ||||||||||||||||||||||
Sbjct: 535 cgtttccgtttccgtttccgtt 514



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 744 ttccgtttccgtttccgtttc 764
           |||||||||||||||||||||
Sbjct: 538 ttccgtttccgtttccgtttc 518



to top

>gb|AC158405.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone B1366F05,
             complete sequence
          Length = 171022

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 739   ttcgtttccgtttccgtttccg 760
             ||||||||||||||||||||||
Sbjct: 71396 ttcgtttccgtttccgtttccg 71375



 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 739   ttcgtttccgtttccgtttccgtttc 764
             ||||||| ||||||||||||||||||
Sbjct: 71402 ttcgttttcgtttccgtttccgtttc 71377



to top

>gb|AF177464.1|AF177464 Drosophila melanogaster Tob homolog (Tob) mRNA, partial cds
          Length = 1759

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 743  tttccgtttccgtttccgtttc 764
            ||||||||||||||||||||||
Sbjct: 1567 tttccgtttccgtttccgtttc 1546



to top

>gb|AC008263.2|F25A4 Arabidopsis thaliana chromosome 1 BAC F25A4 sequence, complete sequence
          Length = 115721

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 741    cgtttccgtttccgtttccgtt 762
              ||||||||||||||||||||||
Sbjct: 103334 cgtttccgtttccgtttccgtt 103355



 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 744    ttccgtttccgtttccgtttc 764
              |||||||||||||||||||||
Sbjct: 103331 ttccgtttccgtttccgtttc 103351



to top

>gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, region 49C1-49D3, P1 clones
             DS04499, DS06146, and DS00455, complete sequence
          Length = 145055

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 696   gacatcgtcagcgccatcatggagct 721
             |||||||||| |||||||||||||||
Sbjct: 59922 gacatcgtcaacgccatcatggagct 59897



to top

>gb|AY817623.1| Drosophila biarmipes Yellow gene, complete cds
          Length = 14704

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 742 gtttccgtttccgtttccgttt 763
           ||||||||||||||||||||||
Sbjct: 300 gtttccgtttccgtttccgttt 279



to top

>emb|Y08969.1|DMNACPRAL D.melanogaster mRNA for NAC protein alpha subunit
          Length = 829

 Score = 44.1 bits (22), Expect = 0.88
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 696 gacatcgtcagcgccatcatggagct 721
           |||||||||| |||||||||||||||
Sbjct: 623 gacatcgtcaacgccatcatggagct 648



to top

>gb|CP000462.1| Aeromonas hydrophila subsp. hydrophila ATCC 7966, complete genome
          Length = 4744448

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 689    cgacggcgacatcgtcagcgccatc 713
              |||| ||||||||||||||||||||
Sbjct: 581984 cgacagcgacatcgtcagcgccatc 581960



to top

>ref|NM_001051743.1| Oryza sativa (japonica cultivar-group) Os01g0918500 (Os01g0918500)
           mRNA, partial cds
          Length = 2834

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 572 cgtcgccgacgaggaggaggtggtggacg 600
           |||||||||||||||||||| || |||||
Sbjct: 71  cgtcgccgacgaggaggaggaggaggacg 43



to top

>gb|CP000384.1| Mycobacterium sp. MCS, complete genome
          Length = 5705448

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 688    acgacggcgacatcgtcagcg 708
              |||||||||||||||||||||
Sbjct: 499392 acgacggcgacatcgtcagcg 499412



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 485     gcaggcgcaggcggcgcagca 505
               |||||||||||||||||||||
Sbjct: 1858842 gcaggcgcaggcggcgcagca 1858862



to top

>gb|AC007928.7| Drosophila melanogaster clone BACR04O02, complete sequence
          Length = 176395

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 739   ttcgtttccgtttccgtttccgtttcggtttcg 771
             ||||||||| ||||| ||||| |||||||||||
Sbjct: 57267 ttcgtttccatttccatttccatttcggtttcg 57299



to top

>gb|AC106887.3| Oryza sativa chromosome 3 BAC OSJNBa0054H04 genomic sequence, complete
              sequence
          Length = 159579

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 574    tcgccgacgaggaggaggtgg 594
              |||||||||||||||||||||
Sbjct: 110889 tcgccgacgaggaggaggtgg 110909



to top

>ref|NM_131964.1| Drosophila melanogaster CG15470-RA (CG15470), mRNA
          Length = 1038

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 298 agaagaagagccgcaaggcca 318
           |||||||||||||||||||||
Sbjct: 932 agaagaagagccgcaaggcca 952



to top

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 489    gcgcaggcggcgcagcagttc 509
              |||||||||||||||||||||
Sbjct: 830521 gcgcaggcggcgcagcagttc 830501



to top

>ref|NM_001000041.1| Rattus norvegicus olfactory receptor 1570 (predicted)
           (Olr1570_predicted), mRNA
          Length = 942

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 362 taccatcaagagagccaagaa 382
           |||||||||||||||||||||
Sbjct: 472 taccatcaagagagccaagaa 452



to top

>gb|AC023711.5| Drosophila melanogaster X BAC RP98-6C4 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 174157

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 743   tttccgtttccgtttccgttt 763
             |||||||||||||||||||||
Sbjct: 72783 tttccgtttccgtttccgttt 72763



to top

>ref|XM_756736.1| Ustilago maydis 521 hypothetical protein (UM05682.1) partial mRNA
          Length = 2328

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                             
Query: 740  tcgtttccgtttccg-tttccgtttcggtttcg 771
            ||||||||||||||| |||| ||||||||||||
Sbjct: 1976 tcgtttccgtttccgttttcggtttcggtttcg 1944



to top

>gb|AC023685.4| Drosophila melanogaster 3L BAC RP98-20N12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167926

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 743    tttccgtttccgtttccgttt 763
              |||||||||||||||||||||
Sbjct: 102197 tttccgtttccgtttccgttt 102177



to top

>gb|AE012227.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 135
            of 460 of the complete genome
          Length = 10155

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 478  cgcagctgcaggcgcaggcgg 498
            |||||||||||||||||||||
Sbjct: 8072 cgcagctgcaggcgcaggcgg 8092



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 575      cgccgacgaggaggaggtggt 595
                |||||||||||||||||||||
Sbjct: 11646383 cgccgacgaggaggaggtggt 11646403



to top

>ref|NM_001043571.1| Bombyx mori allatostatin preprohormone (LOC692588), mRNA
 gb|AF309090.1|AF309090 Bombyx mori allatostatin preprohormone mRNA, complete cds
          Length = 2066

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 135 gccgaggagcccgcggaggac 155
           |||||||||||||||||||||
Sbjct: 481 gccgaggagcccgcggaggac 501



to top

>emb|BX072038.1|CNS09RQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 919

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 689 gaggaggaggtggacgataccggcatcga 661



to top

>emb|BX072037.1|CNS09RQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 543 gaggaggaggtggacgataccggcatcga 571



to top

>emb|BX071074.1|CNS09R06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 696 gaggaggaggtggacgataccggcatcga 668



to top

>emb|BX071073.1|CNS09R05 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 996

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 546 gaggaggaggtggacgataccggcatcga 574



to top

>emb|BX069043.1|CNS09PFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 230 gaggaggaggtggacgataccggcatcga 202



to top

>emb|BX069042.1|CNS09PFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 723 gaggaggaggtggacgataccggcatcga 751



to top

>emb|BX065975.1|CNS09N2J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5AD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 505 gaggaggaggtggacgataccggcatcga 533



to top

>emb|BX064684.1|CNS09M2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 518 gaggaggaggtggacgataccggcatcga 546



to top

>emb|BX063673.1|CNS09LAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 491 gaggaggaggtggacgataccggcatcga 519



to top

>emb|BX061993.1|CNS09JZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 711 gaggaggaggtggacgataccggcatcga 683



to top

>emb|BX061992.1|CNS09JZW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 544 gaggaggaggtggacgataccggcatcga 572



to top

>emb|BX058974.1|CNS09HO2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 692 gaggaggaggtggacgataccggcatcga 664



to top

>emb|BX058973.1|CNS09HO1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 531 gaggaggaggtggacgataccggcatcga 559



to top

>gb|AF336804.1|AF336804 Bombyx mori bombystatin mRNA, partial cds
          Length = 686

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 135 gccgaggagcccgcggaggac 155
           |||||||||||||||||||||
Sbjct: 232 gccgaggagcccgcggaggac 252



to top

>emb|BX054844.1|CNS09EHC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 454

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 348 gaggaggaggtggacgacaccggcatcga 376



to top

>emb|BX054383.1|CNS09E4J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 128 gaggaggaggtggacgataccggcatcga 100



to top

>emb|BX054382.1|CNS09E4I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 739

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 470 gaggaggaggtggacgataccggcatcga 498



to top

>emb|BX052598.1|CNS09CQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 702 gaggaggaggtggacgataccggcatcga 674



to top

>emb|BX052597.1|CNS09CQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 747

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 205 gaggaggaggtggacgataccggcatcga 233



to top

>emb|BX052105.1|CNS09CD9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 562 gaggaggaggtggacgataccggcatcga 590



to top

>emb|BX051766.1|CNS09C3U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 694 gaggaggaggtggacgataccggcatcga 666



to top

>emb|BX051765.1|CNS09C3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 543 gaggaggaggtggacgataccggcatcga 571



to top

>emb|BX050826.1|CNS09BDQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 694 gaggaggaggtggacgataccggcatcga 666



to top

>emb|BX050825.1|CNS09BDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 536 gaggaggaggtggacgataccggcatcga 564



to top

>emb|BX049822.1|CNS09ALU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 702 gaggaggaggtggacgataccggcatcga 674



to top

>emb|BX049821.1|CNS09ALT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 540 gaggaggaggtggacgataccggcatcga 568



to top

>emb|BX045807.1|CNS097IB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 699 gaggaggaggtggacgataccggcatcga 671



to top

>emb|BX045806.1|CNS097IA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC2AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 539 gaggaggaggtggacgataccggcatcga 567



to top

>emb|BX042049.1|CNS094LX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 697 gaggaggaggtggacgataccggcatcga 669



to top

>emb|BX042048.1|CNS094LW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 535 gaggaggaggtggacgataccggcatcga 563



to top

>emb|BX040221.1|CNS09375 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 696 gaggaggaggtggacgataccggcatcga 668



to top

>emb|BX040220.1|CNS09374 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 505 gaggaggaggtggacgataccggcatcga 533



to top

>emb|BX037502.1|CNS0913M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 397

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 247 gaggaggaggtggacgataccggcatcga 219



to top

>emb|BX037471.1|CNS0912R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9DG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 897

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 553 gaggaggaggtggacgataccggcatcga 581



to top

>emb|BX036960.1|CNS090OK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 970

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 709 gaggaggaggtggacgataccggcatcga 681



to top

>emb|BX036959.1|CNS090OJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 565 gaggaggaggtggacgataccggcatcga 593



to top

>emb|BX035771.1|CNS08ZRJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 702 gaggaggaggtggacgataccggcatcga 674



to top

>emb|BX035770.1|CNS08ZRI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 557 gaggaggaggtggacgataccggcatcga 585



to top

>emb|BX036058.1|CNS08ZZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 706 gaggaggaggtggacgataccggcatcga 678



to top

>emb|BX036057.1|CNS08ZZH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA7CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 556 gaggaggaggtggacgataccggcatcga 584



to top

>emb|BX034963.1|CNS08Z53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 692 gaggaggaggtggacgataccggcatcga 664



to top

>emb|BX034962.1|CNS08Z52 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 542 gaggaggaggtggacgataccggcatcga 570



to top

>emb|BX034217.1|CNS08YKD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 581 gaggaggaggtggacgataccggcatcga 609



to top

>emb|BX033994.1|CNS08YE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 543 gaggaggaggtggacgataccggcatcga 571



to top

>emb|BX033035.1|CNS08XNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 218 gaggaggaggtggacgataccggcatcga 190



to top

>emb|BX033034.1|CNS08XNI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 575 gaggaggaggtggacgataccggcatcga 603



to top

>emb|BX030920.1|CNS08W0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 710 gaggaggaggtggacgataccggcatcga 682



to top

>emb|BX030919.1|CNS08W0R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 585 gaggaggaggtggacgataccggcatcga 613



to top

>emb|BX030864.1|CNS08VZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 563 gaggaggaggtggacgataccggcatcga 591



to top

>emb|BX030395.1|CNS08VM7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 552 gaggaggaggtggacgataccggcatcga 580



to top

>emb|BX029669.1|CNS08V21 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 589 gaggaggaggtggacgataccggcatcga 561



to top

>emb|BX029668.1|CNS08V20 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 637 gaggaggaggtggacgataccggcatcga 665



to top

>emb|BX028992.1|CNS08UJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 589 gaggaggaggtggacgataccggcatcga 561



to top

>emb|BX028991.1|CNS08UJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 567 gaggaggaggtggacgataccggcatcga 595



to top

>emb|BX027756.1|CNS08TKW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 311

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 226 gaggaggaggtggacgataccggcatcga 198



to top

>emb|BX028005.1|CNS08TRT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 711 gaggaggaggtggacgataccggcatcga 683



to top

>emb|BX028004.1|CNS08TRS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 552 gaggaggaggtggacgataccggcatcga 580



to top

>emb|BX019149.1|CNS08MXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 261

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 96  gaggaggaggtggacgataccggcatcga 124



to top

>emb|BX023222.1|CNS08Q2Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 698

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 533 gaggaggaggtggacgataccggcatcga 505



to top

>emb|BX023221.1|CNS08Q2X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35CA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 547 gaggaggaggtggacgataccggcatcga 575



to top

>emb|BX022052.1|CNS08P6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 591 gaggaggaggtggacgataccggcatcga 563



to top

>emb|BX022051.1|CNS08P6F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32DA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 554 gaggaggaggtggacgataccggcatcga 582



to top

>emb|BX020483.1|CNS08NYV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| || ||||||||||||||||||
Sbjct: 561 gaggaggagggggacgagaccggcatcga 589



to top

>emb|BX020459.1|CNS08NY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 552 gaggaggaggtggacgataccggcatcga 580



to top

>emb|BX019569.1|CNS08N9H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 708 gaggaggaggtggacgataccggcatcga 680



to top

>emb|BX018722.1|CNS08MLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28BG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 563 gaggaggaggtggacgataccggcatcga 591



to top

>emb|BX018239.1|CNS08M8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 758

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 695 gaggaggaggtggacgataccggcatcga 667



to top

>emb|BX018238.1|CNS08M8I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 576 gaggaggaggtggacgataccggcatcga 604



to top

>emb|BX017233.1|CNS08LGL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 704 gaggaggaggtggacgataccggcatcga 676



to top

>emb|BX017232.1|CNS08LGK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 893

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 577 gaggaggaggtggacgataccggcatcga 605



to top

>emb|BX016670.1|CNS08L0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 224 gaggaggaggtggacgataccggcatcga 196



to top

>emb|BX016619.1|CNS08KZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 719 gaggaggaggtggacgataccggcatcga 691



to top

>emb|BX016618.1|CNS08KZI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 569 gaggaggaggtggacgataccggcatcga 597



to top

>dbj|AP003451.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0413C03
          Length = 162161

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 572    cgtcgccgacgaggaggaggtggtggacg 600
              |||||||||||||||||||| || |||||
Sbjct: 158393 cgtcgccgacgaggaggaggaggaggacg 158421



to top

>emb|BX016072.1|CNS08KKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 544 gaggaggaggtggacgataccggcatcga 516



to top

>emb|BX016071.1|CNS08KKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 446

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 287 gaggaggaggtggacgataccggcatcga 315



to top

>emb|BX016032.1|CNS08KJ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 728

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 700 gaggaggaggtggacgataccggcatcga 672



to top

>emb|BX016031.1|CNS08KJ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 539 gaggaggaggtggacgataccggcatcga 567



to top

>dbj|AP003437.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0678F11
          Length = 154292

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 572   cgtcgccgacgaggaggaggtggtggacg 600
             |||||||||||||||||||| || |||||
Sbjct: 10026 cgtcgccgacgaggaggaggaggaggacg 10054



to top

>emb|BX014845.1|CNS08JM9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA22BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 42.1 bits (21), Expect = 3.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 585 gaggaggtggtggacgagaccggcatcga 613
           ||||||| ||||||||| |||||||||||
Sbjct: 697 gaggaggaggtggacgataccggcatcga 669


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 106,860,001
Number of extensions: 5988805
Number of successful extensions: 158202
Number of sequences better than 10.0: 281
Number of HSP's gapped: 158118
Number of HSP's successfully gapped: 378
Length of query: 927
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 904
Effective length of database: 18,503,978,556
Effective search space: 16727596614624
Effective search space used: 16727596614624
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top