>emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chromosome 11 Contains the
              Taf15 gene for TAF15 RNA polymerase II TATA box binding
              protein (TBP)-associated factor, two novel genes, the Ccl5,
              Ccl9, Ccl6, Ccl3 and Ccl4 genes for chemokine (C-C motif)
              ligand 5, 9, 6, 3 and 4, a ribosomal protein L9 (Rpl9)
              pseudogene, three extracellular proteinase inhibitor (Expi)
              pseudogene and an H+ transporting mitochondrial F1F0
              complex ATP synthase subunit e (Atp5k) pseudogene,,
              complete sequence
          Length = 211873
 Score = 44.1 bits (22), Expect = 0.51
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 351    tgaatatgtgatcagtggagggatgg 376
              ||||||||||| ||||||||||||||
Sbjct: 185012 tgaatatgtgagcagtggagggatgg 184987

>gb|U80447.1| Caenorhabditis elegans cosmid F55F8, complete sequence
          Length = 31048

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 402   tgtctgttggattttcagtcg 422
             |||||||||||||||||||||
Sbjct: 21153 tgtctgttggattttcagtcg 21173

>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence
          Length = 188834

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 42     tcactgagcttccttcctctc 62
              |||||||||||||||||||||
Sbjct: 176850 tcactgagcttccttcctctc 176830

>ref|NM_059257.2| Caenorhabditis elegans PaTched Related family member (ptr-10)
            (ptr-10) mRNA, complete cds
          Length = 2930

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 402  tgtctgttggattttcagtcg 422
            |||||||||||||||||||||
Sbjct: 2406 tgtctgttggattttcagtcg 2426

>gb|AC084407.10| Mus Musculus Strain C57BL6/J Chromosome 11 Clone RP23-271O13, complete
              sequence
          Length = 239837

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 42     tcactgagcttccttcctctc 62
              |||||||||||||||||||||
Sbjct: 163412 tcactgagcttccttcctctc 163432

>emb|AL593858.20| Mouse DNA sequence from clone RP23-151M22 on chromosome 11, complete
              sequence
          Length = 200298

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 42     tcactgagcttccttcctctc 62
              |||||||||||||||||||||
Sbjct: 195989 tcactgagcttccttcctctc 196009

>gb|AC121918.3| Mus musculus BAC clone RP24-195D23 from chromosome 2, complete sequence
          Length = 179270

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 181    atattgaagagatcctagctgcca 204
              ||||||||||||||||||| ||||
Sbjct: 139577 atattgaagagatcctagcagcca 139554

>ref|NM_026828.1| Mus musculus DNA segment, Chr 2, Brigham & Women's Genetics 1335
           expressed (D2Bwg1335e), mRNA
 dbj|AK142070.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length
           enriched library, clone:D230020H02 product:hypothetical
           DNL zinc finger containing protein, full insert sequence
          Length = 2914

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 181 atattgaagagatcctagctgcca 204
           ||||||||||||||||||| ||||
Sbjct: 482 atattgaagagatcctagcagcca 505

>dbj|AK004089.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110034G11 product:hypothetical
           DNL zinc finger containing protein, full insert sequence
          Length = 731

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 181 atattgaagagatcctagctgcca 204
           ||||||||||||||||||| ||||
Sbjct: 471 atattgaagagatcctagcagcca 494

>emb|AL161637.13| Human DNA sequence from clone RP3-393B19 on chromosome 1p33-34.3
             Contains a CpG island, complete sequence
          Length = 101954

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 212   ggtcttccaagttcgaagac 231
             ||||||||||||||||||||
Sbjct: 57957 ggtcttccaagttcgaagac 57976

>emb|BX842648.2| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 3/11
          Length = 346416

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 219    caagttcgaagacatggttc 238
              ||||||||||||||||||||
Sbjct: 209813 caagttcgaagacatggttc 209832

>emb|AL805905.5| Zebrafish DNA sequence from clone CH211-214D15 in linkage group 18
              Contains a novel gene and three CpG islands, complete
              sequence
          Length = 199745

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    gctctccctcctctctcgca 122
              ||||||||||||||||||||
Sbjct: 179432 gctctccctcctctctcgca 179413

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 120     gcaagaaccagacgcgcgac 139
               ||||||||||||||||||||
Sbjct: 2893324 gcaagaaccagacgcgcgac 2893343

>gb|BC031595.1| Mus musculus DNA segment, Chr 2, Brigham & Women's Genetics 1335
           expressed, mRNA (cDNA clone IMAGE:4501932), complete cds
          Length = 2703

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 181 atattgaagagatcctagctgcca 204
           ||||||||||||||||||| ||||
Sbjct: 248 atattgaagagatcctagcagcca 271

>emb|AL844550.5| Mouse DNA sequence from clone RP23-277K21 on chromosome 2, complete
             sequence
          Length = 118080

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 432   gacaatgttttgagtcggct 451
             ||||||||||||||||||||
Sbjct: 69477 gacaatgttttgagtcggct 69496

>emb|AL732541.11| Mouse DNA sequence from clone RP23-306D20 on chromosome 2, complete
              sequence
          Length = 213918

 Score = 40.1 bits (20), Expect = 8.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 181    atattgaagagatcctagctgcca 204
              ||||||||||||||||||| ||||
Sbjct: 175769 atattgaagagatcctagcagcca 175792


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 89,274,216
Number of extensions: 4702175
Number of successful extensions: 96684
Number of sequences better than 10.0: 16
Number of HSP's gapped: 96684
Number of HSP's successfully gapped: 16
Length of query: 543
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 521
Effective length of database: 18,508,616,841
Effective search space: 9642989374161
Effective search space used: 9642989374161
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)