Clone Name	FLbaf62o14
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|DQ245989.1| Zea mays clone 94004 mRNA sequence	383	e-103
2	gb|AF475114.1| Triticum aestivum 60s ribosomal protein L21 mRNA,...	204	2e-49
3	ref|NM_001071334.1| Oryza sativa (japonica cultivar-group) Os10g...	125	2e-25
4	gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 geno...	125	2e-25
5	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	125	2e-25
6	emb|CT837723.1| Oryza sativa (indica cultivar-group) cDNA clone:...	117	4e-23
7	gb|AF093630.1|AF093630 Oryza sativa 60S ribosomal protein L21 (R...	117	4e-23
8	emb|CT834200.1| Oryza sativa (indica cultivar-group) cDNA clone:...	92	2e-15
9	ref|NM_001055459.1| Oryza sativa (japonica cultivar-group) Os03g...	92	2e-15
10	gb|AC137930.3| Oryza sativa (japonica cultivar-group) chromosome...	92	2e-15
11	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	92	2e-15
12	gb|AC137697.2| Genomic sequence for Oryza sativa, Nipponbare str...	92	2e-15
13	dbj|AK120267.1| Oryza sativa (japonica cultivar-group) cDNA clon...	92	2e-15
14	gb|AY105020.1| Zea mays PCO098402 mRNA sequence	88	4e-14
15	emb|CT987644.1| partial cDNA sequence from a Lambda ZAP II norma...	84	6e-13
16	emb|CT985375.1| partial cDNA sequence from a Lambda ZAP II norma...	84	6e-13
17	emb|CT985109.1| partial cDNA sequence from a Lambda ZAP II norma...	84	6e-13
18	gb|BT016206.1| Zea mays clone Contig39 mRNA sequence	78	3e-11
19	emb|CT984806.1| partial cDNA sequence from a Lambda ZAP II norma...	76	1e-10
20	gb|DQ245638.1| Zea mays clone 18621 mRNA sequence	74	5e-10
21	ref|NM_100841.2| Arabidopsis thaliana structural constituent of ...	72	2e-09
22	gb|AY081656.1| Arabidopsis thaliana similar to ribosomal protein...	72	2e-09
23	gb|AY059923.1| Arabidopsis thaliana Similar to ribosomal protein...	72	2e-09
24	emb|BX814291.1|CNS0ADUZ Arabidopsis thaliana Full-length cDNA Co...	72	2e-09
25	gb|AC000132.1|F21M12 Sequence of BAC F21M12 from Arabidopsis tha...	72	2e-09
26	dbj|AK227851.1| Arabidopsis thaliana mRNA for hypothetical prote...	66	1e-07
27	ref|NM_104579.3| Arabidopsis thaliana structural constituent of ...	66	1e-07
28	ref|NM_104563.3| Arabidopsis thaliana structural constituent of ...	66	1e-07
29	gb|AC079733.1| Arabidopsis thaliana chromosome 1 BAC T8L23 genom...	66	1e-07
30	gb|AY091167.1| Arabidopsis thaliana putative 60S ribosomal prote...	66	1e-07
31	gb|AY050840.1| Arabidopsis thaliana putative 60S ribosomal prote...	66	1e-07
32	gb|AY086851.1| Arabidopsis thaliana clone 28545 mRNA, complete s...	66	1e-07
33	gb|AC079732.4|AC079732 Arabidopsis thaliana chromosome 1 BAC F12...	66	1e-07
34	gb|BT004794.1| Arabidopsis thaliana At1g57860 gene, complete cds	66	1e-07
35	emb|BX814226.1|CNS0AC0R Arabidopsis thaliana Full-length cDNA Co...	66	1e-07
36	emb|BX841874.1|CNS09Y44 Arabidopsis thaliana Full-length cDNA Co...	66	1e-07
37	gb|AC189331.1| Brassica rapa subsp. pekinensis clone KBrB037O12,...	62	2e-06
38	ref|NM_100831.2| Arabidopsis thaliana structural constituent of ...	58	3e-05
39	gb|AC003970.1| Arabidopsis thaliana chromosome I BAC F14J9 genom...	58	3e-05
40	gb|BT000775.1| Arabidopsis thaliana clone RAFL04-10-C15 (R11681)...	58	3e-05
41	gb|AY059119.1| Arabidopsis thaliana putative 60S ribosomal prote...	58	3e-05
42	gb|AF370227.1| Arabidopsis thaliana putative 60S ribosomal prote...	58	3e-05
43	emb|BX816463.1|CNS0AANS Arabidopsis thaliana Full-length cDNA Co...	58	3e-05
44	gb|DQ245035.1| Zea mays clone 12389 mRNA sequence	56	1e-04
45	gb|AY310808.1| Nicotiana benthamiana clone 12-130 unknown mRNA	56	1e-04
46	emb|AJ718457.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC1-11-43...	56	1e-04
47	dbj|AP004496.1| Lotus japonicus genomic DNA, chromosome 1, clone...	56	1e-04
48	gb|AY107603.1| Zea mays PCO098394 mRNA sequence	56	1e-04
49	emb|AL132977.1|ATT10K17 Arabidopsis thaliana DNA chromosome 3, B...	52	0.002
50	gb|AF457939.1| Zea mays clone cho1c.pk003.g2, mRNA sequence	48	0.030
51	emb|Z49705.1|SC8520X S.cerevisiae chromosome XIII cosmid 8520	44	0.47
52	emb|AL607024.17| Mouse DNA sequence from clone RP23-194P5 on chr...	44	0.47
53	gb|AC102610.18| Mus musculus chromosome 19, clone RP23-411P21, c...	42	1.9
54	gb|AC121784.2| Mus musculus BAC clone RP23-378G4 from 12, comple...	40	7.4
55	ref|XM_750518.1| Aspergillus fumigatus Af293 hypothetical protei...	40	7.4
56	dbj|AK077315.1| Mus musculus adult male pituitary gland cDNA, RI...	40	7.4
57	dbj|BA000027.2| Oryzias latipes DNA, MHC Class I Region	40	7.4
58	emb|Z83851.17|HS989H11 Human DNA sequence from clone CTA-989H11 ...	40	7.4
59	emb|AL162726.16| Human DNA sequence from clone RP11-15B24 on chr...	40	7.4
60	emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso...	40	7.4
61	emb|AL662891.9| Mouse DNA sequence from clone RP23-20N14 on chro...	40	7.4
62	emb|AL732460.7| Mouse DNA sequence from clone RP23-113I19 on chr...	40	7.4

---

>gb|DQ245989.1| Zea mays clone 94004 mRNA sequence
          Length = 751
 Score =  383 bits (193), Expect = e-103
 Identities = 251/269 (93%), Gaps = 1/269 (0%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
           ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 440 aaggcgcgtggggaggtcatcagcacgaagaggcagccagcagggcccaagcctgggttc 499

                                                                       
Query: 124 atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
           |||||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 500 atggtggagggcaccaccatcgagacggtcacccccatcccgtacgacgtcgtcaacgat 559

                                                                       
Query: 184 ctcaagggtggttactagagcgcttgtttcctgagcagaagcttgagccag-tcttagta 242
           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 560 ctcaagggtggttactagagcgcttgtttcctgagcagaagcttgagccagttcttagta 619

                                                                       
Query: 243 tctatgcttgttccgaatgttttgctactgagtagtcatcgttttgctctgtggagtctg 302
           |||||||||||||| ||||||||| |||||||||||  || |||||||| |  |||| ||
Sbjct: 620 tctatgcttgttcccaatgttttggtactgagtagttctctttttgctccgccgagtgtg 679

                                        
Query: 303 aacttctctgtggttaacattaaagattt 331
           |||||||||||||||||||||||||||||
Sbjct: 680 aacttctctgtggttaacattaaagattt 708

---

>gb|AF475114.1| Triticum aestivum 60s ribosomal protein L21 mRNA, partial cds
          Length = 519

 Score =  204 bits (103), Expect = 2e-49
 Identities = 129/138 (93%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
           ||||| ||||| |||||||||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 382 aaggcgcgtggcgaggtcatcagcacgaagaggcagccagcagggcccaagcctgggttc 441

                                                                       
Query: 124 atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
           |||||||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||
Sbjct: 442 atggtggagggcaccaccatcgagacggtcacccccatcccgtacgacgtcgtcaacgat 501

                             
Query: 184 ctcaagggtggttactag 201
           ||||| ||||||||||||
Sbjct: 502 ctcaanggtggttactag 519

---

>ref|NM_001071334.1| Oryza sativa (japonica cultivar-group) Os10g0465800 (Os10g0465800)
           mRNA, complete cds
          Length = 717

 Score =  125 bits (63), Expect = 2e-25
 Identities = 122/139 (87%), Gaps = 2/139 (1%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggccc-aagcccgggtt 122
           ||||| |||||||||||||||||||| ||||||||||| |||||| || |||||||| ||
Sbjct: 362 aaggctcgtggtgaggtcatcagcacgaagaggcagcc-gcagggtcctaagcccggctt 420

                                                                       
Query: 123 catggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacga 182
           |||||| |||||  | ||  | ||||| ||||| ||||||||||||||||| ||||| ||
Sbjct: 421 catggttgagggtgcaacactggagactgtcacccccatcccgtacgatgtggtcaatga 480

                              
Query: 183 tctcaagggtggttactag 201
           |||||||||||||||||||
Sbjct: 481 tctcaagggtggttactag 499

---

>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete
             sequence
          Length = 162339

 Score =  125 bits (63), Expect = 2e-25
 Identities = 122/139 (87%), Gaps = 2/139 (1%)
 Strand = Plus / Minus

                                                                         
Query: 64    aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggccc-aagcccgggtt 122
             ||||| |||||||||||||||||||| ||||||||||| |||||| || |||||||| ||
Sbjct: 14219 aaggctcgtggtgaggtcatcagcacgaagaggcagcc-gcagggtcctaagcccggctt 14161

                                                                         
Query: 123   catggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacga 182
             |||||| |||||  | ||  | ||||| ||||| ||||||||||||||||| ||||| ||
Sbjct: 14160 catggttgagggtgcaacactggagactgtcacccccatcccgtacgatgtggtcaatga 14101

                                
Query: 183   tctcaagggtggttactag 201
             |||||||||||||||||||
Sbjct: 14100 tctcaagggtggttactag 14082

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10
          Length = 22685906

 Score =  125 bits (63), Expect = 2e-25
 Identities = 122/139 (87%), Gaps = 2/139 (1%)
 Strand = Plus / Minus

                                                                            
Query: 64       aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggccc-aagcccgggtt 122
                ||||| |||||||||||||||||||| ||||||||||| |||||| || |||||||| ||
Sbjct: 16669702 aaggctcgtggtgaggtcatcagcacgaagaggcagcc-gcagggtcctaagcccggctt 16669644

                                                                            
Query: 123      catggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacga 182
                |||||| |||||  | ||  | ||||| ||||| ||||||||||||||||| ||||| ||
Sbjct: 16669643 catggttgagggtgcaacactggagactgtcacccccatcccgtacgatgtggtcaatga 16669584

                                   
Query: 183      tctcaagggtggttactag 201
                |||||||||||||||||||
Sbjct: 16669583 tctcaagggtggttactag 16669565

---

>emb|CT837723.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA045H17, full
           insert sequence
          Length = 402

 Score =  117 bits (59), Expect = 4e-23
 Identities = 121/139 (87%), Gaps = 2/139 (1%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggccc-aagcccgggtt 122
           ||||| |||||||||||||||||||| ||||||||||| |||||| || ||||| || ||
Sbjct: 132 aaggctcgtggtgaggtcatcagcacgaagaggcagcc-gcagggtcctaagcctggctt 190

                                                                       
Query: 123 catggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacga 182
           |||||| |||||  | ||  | ||||| ||||| ||||||||||||||||| ||||| ||
Sbjct: 191 catggttgagggtgcaacactggagactgtcacccccatcccgtacgatgtggtcaatga 250

                              
Query: 183 tctcaagggtggttactag 201
           |||||||||||||||||||
Sbjct: 251 tctcaagggtggttactag 269

---

>gb|AF093630.1|AF093630 Oryza sativa 60S ribosomal protein L21 (RPL21) mRNA, complete cds
          Length = 753

 Score =  117 bits (59), Expect = 4e-23
 Identities = 121/139 (87%), Gaps = 2/139 (1%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggccc-aagcccgggtt 122
           ||||| |||||||||||||||||||| ||||||||||| |||||| || ||||| || ||
Sbjct: 374 aaggctcgtggtgaggtcatcagcacgaagaggcagcc-gcagggtcctaagcctggctt 432

                                                                       
Query: 123 catggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacga 182
           |||||| |||||  | ||  | ||||| ||||| ||||||||||||||||| ||||| ||
Sbjct: 433 catggttgagggtgcaacactggagactgtcacccccatcccgtacgatgtggtcaatga 492

                              
Query: 183 tctcaagggtggttactag 201
           |||||||||||||||||||
Sbjct: 493 tctcaagggtggttactag 511

---

>emb|CT834200.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA042O23, full
           insert sequence
          Length = 737

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
           ||||||||||||||||| |||||||| ||||| ||||| |  || ||||| || || |||
Sbjct: 434 aaggcccgtggtgaggttatcagcaccaagagacagcccgagggacccaaacctggtttc 493

                                                                       
Query: 124 atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
           ||||| |||||  | ||  | ||||| || || ||||| ||||| ||||| ||||| |||
Sbjct: 494 atggttgagggtgctacgctggagactgttacccccattccgtatgatgtggtcaatgat 553

                                         
Query: 184 ctcaagggtggttactagagcgcttgtttc 213
           |||||||||||||||||||  |||||||||
Sbjct: 554 ctcaagggtggttactagaatgcttgtttc 583



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 308 ctctgtggttaacattaaagattt 331
           ||||||||||||||||||||||||
Sbjct: 668 ctctgtggttaacattaaagattt 691

---

>ref|NM_001055459.1| Oryza sativa (japonica cultivar-group) Os03g0141000 (Os03g0141000)
            mRNA, complete cds
          Length = 2004

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                        
Query: 64   aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
            ||||||||||||||||| |||||||| ||||| ||||| |  || ||||| || || |||
Sbjct: 1498 aaggcccgtggtgaggttatcagcaccaagagacagcccgagggacccaaacctggtttc 1557

                                                                        
Query: 124  atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
            ||||| |||||  | ||  | ||||| || || ||||| ||||| ||||| ||||| |||
Sbjct: 1558 atggttgagggtgctacgctggagactgttacccccattccgtatgatgtggtcaatgat 1617

                                          
Query: 184  ctcaagggtggttactagagcgcttgtttc 213
            |||||||||||||||||||  |||||||||
Sbjct: 1618 ctcaagggtggttactagaatgcttgtttc 1647



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 294  tggagtctgaacttctctgtggttaacattaaagattt 331
            |||| ||||||| ||| |||||||||||||||||||||
Sbjct: 1720 tggaatctgaacctctatgtggttaacattaaagattt 1757

---

>gb|AC137930.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0030C11,
              complete sequence
          Length = 156647

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                          
Query: 64     aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
              ||||||||||||||||| |||||||| ||||| ||||| |  || ||||| || || |||
Sbjct: 138491 aaggcccgtggtgaggttatcagcaccaagagacagcccgagggacccaaacctggtttc 138550

                                                                          
Query: 124    atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
              ||||| |||||  | ||  | ||||| || || ||||| ||||| ||||| ||||| |||
Sbjct: 138551 atggttgagggtgctacgctggagactgttacccccattccgtatgatgtggtcaatgat 138610

                                            
Query: 184    ctcaagggtggttactagagcgcttgtttc 213
              |||||||||||||||||||  |||||||||
Sbjct: 138611 ctcaagggtggttactagaatgcttgtttc 138640



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 294    tggagtctgaacttctctgtggttaacattaaagattt 331
              |||| ||||||| ||| |||||||||||||||||||||
Sbjct: 138713 tggaatctgaacctctatgtggttaacattaaagattt 138750

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                           
Query: 64      aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
               ||||||||||||||||| |||||||| ||||| ||||| |  || ||||| || || |||
Sbjct: 2248209 aaggcccgtggtgaggttatcagcaccaagagacagcccgagggacccaaacctggtttc 2248268

                                                                           
Query: 124     atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
               ||||| |||||  | ||  | ||||| || || ||||| ||||| ||||| ||||| |||
Sbjct: 2248269 atggttgagggtgctacgctggagactgttacccccattccgtatgatgtggtcaatgat 2248328

                                             
Query: 184     ctcaagggtggttactagagcgcttgtttc 213
               |||||||||||||||||||  |||||||||
Sbjct: 2248329 ctcaagggtggttactagaatgcttgtttc 2248358



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 294     tggagtctgaacttctctgtggttaacattaaagattt 331
               |||| ||||||| ||| |||||||||||||||||||||
Sbjct: 2248431 tggaatctgaacctctatgtggttaacattaaagattt 2248468

---

>gb|AC137697.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0081A17, from chromosome 3, complete sequence
          Length = 134821

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Minus

                                                                         
Query: 64    aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
             ||||||||||||||||| |||||||| ||||| ||||| |  || ||||| || || |||
Sbjct: 77859 aaggcccgtggtgaggttatcagcaccaagagacagcccgagggacccaaacctggtttc 77800

                                                                         
Query: 124   atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
             ||||| |||||  | ||  | ||||| || || ||||| ||||| ||||| ||||| |||
Sbjct: 77799 atggttgagggtgctacgctggagactgttacccccattccgtatgatgtggtcaatgat 77740

                                           
Query: 184   ctcaagggtggttactagagcgcttgtttc 213
             |||||||||||||||||||  |||||||||
Sbjct: 77739 ctcaagggtggttactagaatgcttgtttc 77710



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 294   tggagtctgaacttctctgtggttaacattaaagattt 331
             |||| ||||||| ||| |||||||||||||||||||||
Sbjct: 77637 tggaatctgaacctctatgtggttaacattaaagattt 77600

---

>dbj|AK120267.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047I10, full
            insert sequence
          Length = 2007

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 124/150 (82%)
 Strand = Plus / Plus

                                                                        
Query: 64   aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
            ||||||||||||||||| |||||||| ||||| ||||| |  || ||||| || || |||
Sbjct: 1499 aaggcccgtggtgaggttatcagcaccaagagacagcccgagggacccaaacctggtttc 1558

                                                                        
Query: 124  atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
            ||||| |||||  | ||  | ||||| || || ||||| ||||| ||||| ||||| |||
Sbjct: 1559 atggttgagggtgctacgctggagactgttacccccattccgtatgatgtggtcaatgat 1618

                                          
Query: 184  ctcaagggtggttactagagcgcttgtttc 213
            |||||||||||||||||||  |||||||||
Sbjct: 1619 ctcaagggtggttactagaatgcttgtttc 1648



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 294  tggagtctgaacttctctgtggttaacattaaagattt 331
            |||| ||||||| ||| |||||||||||||||||||||
Sbjct: 1721 tggaatctgaacctctatgtggttaacattaaagattt 1758

---

>gb|AY105020.1| Zea mays PCO098402 mRNA sequence
          Length = 784

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 116/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
           |||||||| |||||||| |||||||| ||||||||||| |  || ||||| || || |||
Sbjct: 457 aaggcccgcggtgaggtgatcagcaccaagaggcagcctgtgggacccaaacctggcttc 516

                                                                       
Query: 124 atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
           ||||| |||||  | ||  | ||||||||||| || || || || ||||| |||||||||
Sbjct: 517 atggttgagggtgctacactcgagacagtcactcctattccttatgatgtggtcaacgat 576

                               
Query: 184 ctcaagggtggttactagag 203
           |||||||| |||||||||||
Sbjct: 577 ctcaagggcggttactagag 596

---

>emb|CT987644.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 730

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  atcagcacaaagaggcagccagcagggcccaagcccgggttcatggtggagggcaccacc 141
           |||||||| ||||| ||||| | ||| |||||||| || |||||||| |||||||| |||
Sbjct: 408 atcagcacgaagagacagccggaaggtcccaagcctggcttcatggtcgagggcacgacc 467

                                                                     
Query: 142 attgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggttact 199
           || ||||| ||||| || || ||||| ||||||||||| || || ||||| |||||||
Sbjct: 468 atagagacggtcactcctattccgtatgatgtcgtcaatgacctgaagggcggttact 525

---

>emb|CT985375.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 752

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  atcagcacaaagaggcagccagcagggcccaagcccgggttcatggtggagggcaccacc 141
           |||||||| ||||| ||||| | ||| |||||||| || |||||||| |||||||| |||
Sbjct: 433 atcagcacgaagagacagccggaaggtcccaagcctggcttcatggtcgagggcacgacc 492

                                                                     
Query: 142 attgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggttact 199
           || ||||| ||||| || || ||||| ||||||||||| || || ||||| |||||||
Sbjct: 493 atagagacggtcactcctattccgtatgatgtcgtcaatgacctgaagggcggttact 550

---

>emb|CT985109.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 693

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 99/118 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  atcagcacaaagaggcagccagcagggcccaagcccgggttcatggtggagggcaccacc 141
           |||||||| ||||| ||||| | ||| |||||||| || |||||||| |||||||| |||
Sbjct: 418 atcagcacgaagagacagccggaaggtcccaagcctggcttcatggtcgagggcacgacc 477

                                                                     
Query: 142 attgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggttact 199
           || ||||| ||||| || || ||||| ||||||||||| || || ||||| |||||||
Sbjct: 478 atagagacggtcactcctattccgtatgatgtcgtcaatgacctgaagggcggttact 535

---

>gb|BT016206.1| Zea mays clone Contig39 mRNA sequence
          Length = 748

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 108/131 (82%)
 Strand = Plus / Plus

                                                                       
Query: 73  ggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtggag 132
           |||||||| |||||||| ||||||||||| |  || ||||| || || |||||||| |||
Sbjct: 430 ggtgaggtgatcagcaccaagaggcagcccgtgggacccaaacctggcttcatggttgag 489

                                                                       
Query: 133 ggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggt 192
           ||  | ||  | ||||||||||| || || || || ||||| ||||||||||||||||| 
Sbjct: 490 ggtgctacactcgagacagtcactcctattccttatgatgtggtcaacgatctcaagggc 549

                      
Query: 193 ggttactagag 203
           |||||||||||
Sbjct: 550 ggttactagag 560

---

>emb|CT984806.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 689

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 82  atcagcacaaagaggcagccagcagggcccaagcccgggttcatggtggagggcaccacc 141
           |||||||| ||||| ||||| | ||| |||||||| || |||||||| |||||||| |||
Sbjct: 433 atcagcacgaagagacagccggaaggtcccaagcctggcttcatggtcgagggcacgacc 492

                                                 
Query: 142 attgagacagtcacacccatcccgtacgatgtcgtcaa 179
           || ||||| ||||| || || ||||| |||||||||||
Sbjct: 493 atagagacggtcactcctattccgtatgatgtcgtcaa 530

---

>gb|DQ245638.1| Zea mays clone 18621 mRNA sequence
          Length = 680

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 82  atcagcacaaagaggcagccagcagggcccaagcccgggttcatggtggagggcaccacc 141
           |||||||| ||||| |||||   ||| |||||||| || |||||||| ||||| |  || 
Sbjct: 419 atcagcaccaagagacagcctaaaggtcccaagcctggtttcatggtcgagggtatgaca 478

                                                                
Query: 142 attgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtgg 194
            | ||||| ||||| |||||||| |||||||| ||||||||||||||||||||
Sbjct: 479 ttggagactgtcactcccatcccttacgatgttgtcaacgatctcaagggtgg 531

---

>ref|NM_100841.2| Arabidopsis thaliana structural constituent of ribosome (AT1G09690)
           mRNA, complete cds
          Length = 755

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 407 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 466

                                                                       
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaaggg 191
            || |  ||| | ||||| ||||| || ||||||||||||||||||||||||||||||||
Sbjct: 467 aggaatgaccttggagactgtcactccaatcccgtacgatgtcgtcaacgatctcaaggg 526

---

>gb|AY081656.1| Arabidopsis thaliana similar to ribosomal protein L21 (At1g09690)
           mRNA, complete cds
          Length = 538

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 366 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 425

                                                                       
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaaggg 191
            || |  ||| | ||||| ||||| || ||||||||||||||||||||||||||||||||
Sbjct: 426 aggaatgaccttggagactgtcactccaatcccgtacgatgtcgtcaacgatctcaaggg 485

---

>gb|AY059923.1| Arabidopsis thaliana Similar to ribosomal protein L21 (At1g09690;
           F21M12.8) mRNA, complete cds
          Length = 665

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 407 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 466

                                                                       
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaaggg 191
            || |  ||| | ||||| ||||| || ||||||||||||||||||||||||||||||||
Sbjct: 467 aggaatgaccttggagactgtcactccaatcccgtacgatgtcgtcaacgatctcaaggg 526

---

>emb|BX814291.1|CNS0ADUZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 660

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 394 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 453

                                                                       
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaaggg 191
            || |  ||| | ||||| ||||| || ||||||||||||||||||||||||||||||||
Sbjct: 454 aggaatgaccttggagactgtcactccaatcccgtacgatgtcgtcaacgatctcaaggg 513

---

>gb|AC000132.1|F21M12 Sequence of BAC F21M12 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 146505

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 99/120 (82%)
 Strand = Plus / Minus

                                                                         
Query: 72    tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
             |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 23422 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 23363

                                                                         
Query: 132   gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaaggg 191
              || |  ||| | ||||| ||||| || ||||||||||||||||||||||||||||||||
Sbjct: 23362 aggaatgaccttggagactgtcactccaatcccgtacgatgtcgtcaacgatctcaaggg 23303

---

>dbj|AK227851.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
           clone: RAFL14-42-H06
          Length = 659

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 477 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 529

---

>ref|NM_104579.3| Arabidopsis thaliana structural constituent of ribosome (AT1G57860)
           mRNA, complete cds
          Length = 669

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 477 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 529

---

>ref|NM_104563.3| Arabidopsis thaliana structural constituent of ribosome (AT1G57660)
           mRNA, complete cds
          Length = 715

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 486 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 538

---

>gb|AC079733.1| Arabidopsis thaliana chromosome 1 BAC T8L23 genomic sequence, complete
             sequence
          Length = 90448

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                  
Query: 145   gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
             ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 46951 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 47003

---

>gb|AY091167.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g57660)
           mRNA, complete cds
          Length = 526

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 439 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 491

---

>gb|AY050840.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g57660)
           mRNA, complete cds
          Length = 681

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 486 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 538

---

>gb|AY086851.1| Arabidopsis thaliana clone 28545 mRNA, complete sequence
          Length = 627

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 483 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 535

---

>gb|AC079732.4|AC079732 Arabidopsis thaliana chromosome 1 BAC F12K22 genomic sequence,
            complete sequence
          Length = 43985

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 145  gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
            ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 6271 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 6323

---

>gb|BT004794.1| Arabidopsis thaliana At1g57860 gene, complete cds
          Length = 495

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 439 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 491

---

>emb|BX814226.1|CNS0AC0R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZA08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 674

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 445 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 497

---

>emb|BX841874.1|CNS09Y44 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH60ZG03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 658

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                
Query: 145 gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaagggtggtta 197
           ||||| ||||| ||||| || |||||||| |||||||||||||||||||||||
Sbjct: 481 gagactgtcactcccattccttacgatgttgtcaacgatctcaagggtggtta 533

---

>gb|AC189331.1| Brassica rapa subsp. pekinensis clone KBrB037O12, complete sequence
          Length = 109500

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 145   gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaaggg 191
             ||||| ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 68716 gagactgtcactcccatcccttacgacgtcgtcaacgatctcaaggg 68762



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                            
Query: 145   gagacagtcacacccatcccgtacgatgtcgtcaacgatctcaaggg 191
             ||||| ||||| || ||||| ||||||||||||||||||||||||||
Sbjct: 88529 gagactgtcactcctatcccatacgatgtcgtcaacgatctcaaggg 88483

---

>ref|NM_100831.2| Arabidopsis thaliana structural constituent of ribosome (AT1G09590)
           mRNA, complete cds
          Length = 675

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 380 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 439

                                                                    
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaa 188
            || |  ||| | ||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 440 aggaatgaccttggagactgtcactccaatcccctacgatgtcgtcaacgatctcaa 496

---

>gb|AC003970.1| Arabidopsis thaliana chromosome I BAC F14J9 genomic sequence contains
             phyA marker, complete sequence
          Length = 95865

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                         
Query: 72    tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
             |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 89080 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 89139

                                                                      
Query: 132   gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaa 188
              || |  ||| | ||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 89140 aggaatgaccttggagactgtcactccaatcccctacgatgtcgtcaacgatctcaa 89196

---

>gb|BT000775.1| Arabidopsis thaliana clone RAFL04-10-C15 (R11681) putative 60S
           ribosomal protein L21 (At1g09590) mRNA, complete cds
          Length = 672

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 380 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 439

                                                                    
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaa 188
            || |  ||| | ||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 440 aggaatgaccttggagactgtcactccaatcccctacgatgtcgtcaacgatctcaa 496

---

>gb|AY059119.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g09590)
           mRNA, complete cds
          Length = 526

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 366 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 425

                                                                    
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaa 188
            || |  ||| | ||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 426 aggaatgaccttggagactgtcactccaatcccctacgatgtcgtcaacgatctcaa 482

---

>gb|AF370227.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g09590)
           mRNA, complete cds
          Length = 674

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 380 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 439

                                                                    
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaa 188
            || |  ||| | ||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 440 aggaatgaccttggagactgtcactccaatcccctacgatgtcgtcaacgatctcaa 496

---

>emb|BX816463.1|CNS0AANS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH4ZD12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 569

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Plus

                                                                       
Query: 72  tggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggtgga 131
           |||||||  ||||||||| ||||| |||||   ||| ||||| || || |||||||| ||
Sbjct: 348 tggtgagaccatcagcaccaagagacagcctaaaggacccaaaccaggattcatggtcga 407

                                                                    
Query: 132 gggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgatctcaa 188
            || |  ||| | ||||| ||||| || ||||| |||||||||||||||||||||||
Sbjct: 408 aggaatgaccttggagactgtcactccaatcccctacgatgtcgtcaacgatctcaa 464

---

>gb|DQ245035.1| Zea mays clone 12389 mRNA sequence
          Length = 738

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 112/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
           |||| |||||| ||||| |||||||| ||||||||||| |  || ||||| || || |||
Sbjct: 468 aaggaccgtggcgaggtgatcagcaccaagaggcagcctgtgggacccaaacctggcttc 527

                                                                       
Query: 124 atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
           ||||| |||||  | ||  ||||||| || || || || || || ||||| || || |||
Sbjct: 528 atggttgagggtgctacacttgagaccgttactcctattccctatgatgtggtaaatgat 587

                               
Query: 184 ctcaagggtggttactagag 203
           |||||||| |||||||||||
Sbjct: 588 ctcaaggggggttactagag 607

---

>gb|AY310808.1| Nicotiana benthamiana clone 12-130 unknown mRNA
          Length = 388

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 73  ggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggt 128
           |||||||||||||||||||||||||| ||   ||| ||||| || |||||||||||
Sbjct: 140 ggtgaggtcatcagcacaaagaggcaacctcaaggacccaaaccagggttcatggt 195

---

>emb|AJ718457.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC1-11-430, cultivar Bright
           Yellow 2
          Length = 384

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 73  ggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggt 128
           |||||||||||||||||||||||||| ||   ||| ||||| || |||||||||||
Sbjct: 91  ggtgaggtcatcagcacaaagaggcaacctcaaggacccaaaccagggttcatggt 146

---

>dbj|AP004496.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT11C13, TM0029a,
             complete sequence
          Length = 53909

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 73    ggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttcatggt 128
             |||||||| |||||||| ||||||||||| || |||||||| || || ||||||||
Sbjct: 15743 ggtgaggtgatcagcaccaagaggcagcctgctgggcccaaaccaggtttcatggt 15798

---

>gb|AY107603.1| Zea mays PCO098394 mRNA sequence
          Length = 965

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 112/140 (80%)
 Strand = Plus / Plus

                                                                       
Query: 64  aaggcccgtggtgaggtcatcagcacaaagaggcagccagcagggcccaagcccgggttc 123
           |||| |||||| ||||| |||||||| ||||||||||| |  || ||||| || || |||
Sbjct: 475 aaggaccgtggcgaggtgatcagcaccaagaggcagcctgtgggacccaaacctggcttc 534

                                                                       
Query: 124 atggtggagggcaccaccattgagacagtcacacccatcccgtacgatgtcgtcaacgat 183
           ||||| |||||  | ||  ||||||| || || || || || || ||||| || || |||
Sbjct: 535 atggttgagggtgctacacttgagaccgttactcctattccctatgatgtggtaaatgat 594

                               
Query: 184 ctcaagggtggttactagag 203
           |||||||| |||||||||||
Sbjct: 595 ctcaaggggggttactagag 614

---

>emb|AL132977.1|ATT10K17 Arabidopsis thaliana DNA chromosome 3, BAC clone T10K17
          Length = 109016

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 152   tcacacccatcccgtacgatgtcgtcaacgatctcaagggtg 193
             |||| |||||||| |||||||||||||||||  |||||||||
Sbjct: 13307 tcactcccatcccatacgatgtcgtcaacgacttcaagggtg 13266

---

>gb|AF457939.1| Zea mays clone cho1c.pk003.g2, mRNA sequence
          Length = 526

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 71/84 (84%), Gaps = 2/84 (2%)
 Strand = Plus / Plus

                                                                       
Query: 109 cccaagcccgggttcatggtggagggcaccacca-ttgagacagtcacacccatcccgta 167
           ||||||||||| |||||||| ||||||| || || ||||||| || ||  ||||||| ||
Sbjct: 443 cccaagcccggcttcatggtcgagggcaacaacatttgagaccgtaac-tccatcccata 501

                                   
Query: 168 cgatgtcgtcaacgatctcaaggg 191
            ||||| ||||| |||||||||||
Sbjct: 502 tgatgtggtcaatgatctcaaggg 525

---

>emb|Z49705.1|SC8520X S.cerevisiae chromosome XIII cosmid 8520
          Length = 41200

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 366  atatatttacatttggtcgata 387
            ||||||||||||||||||||||
Sbjct: 4767 atatatttacatttggtcgata 4788

---

>emb|AL607024.17| Mouse DNA sequence from clone RP23-194P5 on chromosome 11 Contains a
              novel gene, the Pafah1b1 gene for platelet-activating
              factor acetylhydrolase isoform 1b beta1 subunit, the 5' end
              of a novel gene and two CpG islands, complete sequence
          Length = 137908

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 407    taggctgttttgtgaagctgca 428
              ||||||||||||||||||||||
Sbjct: 133384 taggctgttttgtgaagctgca 133405

---

>gb|AC102610.18| Mus musculus chromosome 19, clone RP23-411P21, complete sequence
          Length = 226019

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 56     ggagagagaaggcccgtggtg 76
              |||||||||||||||||||||
Sbjct: 215384 ggagagagaaggcccgtggtg 215364

---

>gb|AC121784.2| Mus musculus BAC clone RP23-378G4 from 12, complete sequence
          Length = 163125

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 443    tttatttcccttgttatttc 462
              ||||||||||||||||||||
Sbjct: 136965 tttatttcccttgttatttc 136946

---

>ref|XM_750518.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g12800)
           partial mRNA
          Length = 579

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 167 acgatgtcgtcaacgatctc 186
           ||||||||||||||||||||
Sbjct: 491 acgatgtcgtcaacgatctc 510

---

>dbj|AK077315.1| Mus musculus adult male pituitary gland cDNA, RIKEN full-length
            enriched library, clone:5330411G14
            product:unclassifiable, full insert sequence
          Length = 1907

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 443  tttatttcccttgttatttc 462
            ||||||||||||||||||||
Sbjct: 1834 tttatttcccttgttatttc 1815

---

>dbj|BA000027.2| Oryzias latipes DNA, MHC Class I Region
          Length = 425935

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 442   atttatttcccttgttattt 461
             ||||||||||||||||||||
Sbjct: 28153 atttatttcccttgttattt 28134

---

>emb|Z83851.17|HS989H11 Human DNA sequence from clone CTA-989H11 on chromosome 22q13.1-13.2,
             complete sequence
          Length = 118831

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 94    aggcagccagcagggcccaa 113
             ||||||||||||||||||||
Sbjct: 65341 aggcagccagcagggcccaa 65360

---

>emb|AL162726.16| Human DNA sequence from clone RP11-15B24 on chromosome 9 Contains a
             cytochrome c oxidase III (COIII) (MTCO3) pseudogene, a
             novel pseudogene and three novel genes, complete sequence
          Length = 195824

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   agggcaccaccattgagaca 150
             ||||||||||||||||||||
Sbjct: 66392 agggcaccaccattgagaca 66411

---

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 311     tgtggttaacattaaagatt 330
               ||||||||||||||||||||
Sbjct: 1135044 tgtggttaacattaaagatt 1135063

---

>emb|AL662891.9| Mouse DNA sequence from clone RP23-20N14 on chromosome 11 Contains the
             Psme4 gene for proteasome (prosome, macropain) activator
             subunit 4, the Gpr75 gene for G protein-coupled receptor
             75, a novel pseudogene, a PDZ and LIM domain 1 (elfin)
             (Pdlim1) pseudogene, two novel genes, the 5' end of the
             Asb3 gene for ankyrin repeat and SOCS box-containing
             protein 3, a methyl-CpG binding domain protein 2
             interacting protein (Mbdin) pseudogene and a CpG island,
             complete sequence
          Length = 244971

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 313   tggttaacattaaagatttt 332
             ||||||||||||||||||||
Sbjct: 89665 tggttaacattaaagatttt 89684

---

>emb|AL732460.7| Mouse DNA sequence from clone RP23-113I19 on chromosome X, complete
              sequence
          Length = 198572

 Score = 40.1 bits (20), Expect = 7.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 442    atttatttcccttgttatttctgt 465
              ||||||| ||||||||||||||||
Sbjct: 112100 atttattgcccttgttatttctgt 112123


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 90,550,356
Number of extensions: 4800860
Number of successful extensions: 89430
Number of sequences better than 10.0: 62
Number of HSP's gapped: 89413
Number of HSP's successfully gapped: 69
Length of query: 506
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 484
Effective length of database: 18,508,616,841
Effective search space: 8958170551044
Effective search space used: 8958170551044
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)

---