ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf70j09
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AM260479.1| Ralstonia eutropha H16 chromosome 1 46 0.10
2gb|CP000438.1| Pseudomonas aeruginosa UCBPP-PA14, complete genome 44 0.40
3gb|AE004091.2| Pseudomonas aeruginosa PAO1, complete genome 44 0.40
4gb|CP000316.1| Polaromonas sp. JS666, complete genome 44 0.40
5gb|AY578802.1| Anopheles gambiae FK506-binding protein (FKBP12) ... 44 0.40
6emb|BX071290.1|CNS09R66 Single read from an extremity of a full-... 44 0.40
7emb|BX069738.1|CNS09PZ2 Single read from an extremity of a full-... 44 0.40
8emb|BX066824.1|CNS09NQ4 Single read from an extremity of a full-... 44 0.40
9emb|BX060326.1|CNS09IPM Single read from an extremity of a full-... 44 0.40
10emb|BX059081.1|CNS09HR1 Single read from an extremity of a full-... 44 0.40
11emb|BX052952.1|CNS09D0S Single read from an extremity of a full-... 44 0.40
12emb|BX040734.1|CNS093LE Single read from an extremity of a full-... 44 0.40
13emb|BX040733.1|CNS093LD Single read from an extremity of a full-... 44 0.40
14emb|BX040285.1|CNS0938X Single read from an extremity of a full-... 44 0.40
15emb|BX040284.1|CNS0938W Single read from an extremity of a full-... 44 0.40
16emb|BX032931.1|CNS08XKN Single read from an extremity of a full-... 44 0.40
17emb|BX025964.1|CNS08S74 Single read from an extremity of a full-... 44 0.40
18emb|BX024487.1|CNS08R23 Single read from an extremity of a full-... 44 0.40
19emb|BX023901.1|CNS08QLT Single read from an extremity of a full-... 44 0.40
20emb|BX023048.1|CNS08PY4 Single read from an extremity of a full-... 44 0.40
21emb|BX020146.1|CNS08NPI Single read from an extremity of a full-... 44 0.40
22emb|BX019960.1|CNS08NKC Single read from an extremity of a full-... 44 0.40
23emb|BX019959.1|CNS08NKB Single read from an extremity of a full-... 44 0.40
24emb|BX017776.1|CNS08LVO Single read from an extremity of a full-... 44 0.40
25emb|BX017775.1|CNS08LVN Single read from an extremity of a full-... 44 0.40
26emb|BX017758.1|CNS08LV6 Single read from an extremity of a full-... 44 0.40
27emb|BX017754.1|CNS08LV2 Single read from an extremity of a full-... 44 0.40
28emb|BX012176.1|CNS08HK4 Single read from an extremity of a full-... 44 0.40
29emb|BX012175.1|CNS08HK3 Single read from an extremity of a full-... 44 0.40
30ref|XM_320351.2| Anopheles gambiae str. PEST ENSANGP00000014046 ... 44 0.40
31gb|U29172.1|PAU29172 Pseudomonas aeruginosa HtrA-like serine pro... 44 0.40
32gb|DQ244415.1| Zea mays clone 7322 mRNA sequence 42 1.6
33emb|CT833934.1| Oryza sativa (indica cultivar-group) cDNA clone:... 42 1.6
34emb|CT833933.1| Oryza sativa (indica cultivar-group) cDNA clone:... 42 1.6
35ref|NM_001054723.1| Oryza sativa (japonica cultivar-group) Os02g... 42 1.6
36gb|AC190267.1| Gallus gallus chromosome Z clone CH261-44B21, com... 42 1.6
37gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence 42 1.6
38gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 ge... 42 1.6
39gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 ge... 42 1.6
40gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 ge... 42 1.6
41gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 ge... 42 1.6
42gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 ge... 42 1.6
43gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 ge... 42 1.6
44gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 ge... 42 1.6
45gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 ge... 42 1.6
46gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 ge... 42 1.6
47gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 ge... 42 1.6
48gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 ge... 42 1.6
49gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 ge... 42 1.6
50gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 ge... 42 1.6
51gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 ge... 42 1.6
52gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 ge... 42 1.6
53gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 ge... 42 1.6
54gb|AY754697.1| Zea mays immunophilin mRNA, complete cds 42 1.6
55dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 1.6
56dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
57dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.6
58dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
59dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
60dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.6
61gb|AF117595.1|AF117595 Manduca sexta clone pMsmaD183 FK506-bindi... 42 1.6
62gb|AY103897.1| Zea mays PCO108516 mRNA sequence 42 1.6
63emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 6.2
64emb|CT025367.2| Xenopus tropicalis finished cDNA, clone TNeu030i01 40 6.2
65gb|AE011846.1| Xanthomonas axonopodis pv. citri str. 306, secti... 40 6.2
66dbj|AK042542.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 6.2
67ref|XM_803305.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 6.2
68dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
69dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
70emb|AL162594.13| Human DNA sequence from clone RP5-1037B23 on ch... 40 6.2
71emb|BX005693.1|CNS08CK1 Single read from an extremity of a full-... 40 6.2
72dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 40 6.2
73dbj|AP005471.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.2
74ref|NM_001011088.1| Xenopus tropicalis hypothetical LOC496501 (L... 40 6.2
75gb|U31902.1|PDU31902 Paracoccus denitrificans succinate dehydrog... 40 6.2
76gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome... 40 6.2 
>emb|AM260479.1| Ralstonia eutropha H16 chromosome 1
          Length = 4052032
 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 201     cggccaggtgatccgcggctgggacga 227
               |||||| ||||||||||||||||||||
Sbjct: 3018630 cggccatgtgatccgcggctgggacga 3018656
to top
>gb|CP000438.1| Pseudomonas aeruginosa UCBPP-PA14, complete genome
          Length = 6537648

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 201     cggccaggtgatccgcggctgg 222
               ||||||||||||||||||||||
Sbjct: 5144246 cggccaggtgatccgcggctgg 5144267
to top
>gb|AE004091.2| Pseudomonas aeruginosa PAO1, complete genome
          Length = 6264404

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 201     cggccaggtgatccgcggctgg 222
               ||||||||||||||||||||||
Sbjct: 4980655 cggccaggtgatccgcggctgg 4980676
to top
>gb|CP000316.1| Polaromonas sp. JS666, complete genome
          Length = 5200264

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                             
Query: 202     ggccaggtgatccgcggctgggacgagggc 231
               |||||||| ||||| |||||||||||||||
Sbjct: 3250120 ggccaggtcatccgtggctgggacgagggc 3250091
to top
>gb|AY578802.1| Anopheles gambiae FK506-binding protein (FKBP12) gene, complete cds
          Length = 461

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 298 aggtgatccgcggctgggacga 319
to top
>emb|BX071290.1|CNS09R66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 385 aggtgatccgcggctgggacga 406
to top
>emb|BX069738.1|CNS09PZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 624

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 345 aggtgatccgcggctgggacga 366
to top
>emb|BX066824.1|CNS09NQ4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 315 aggtgatccgcggctgggacga 336
to top
>emb|BX060326.1|CNS09IPM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 434 aggtgatccgcggctgggacga 455
to top
>emb|BX059081.1|CNS09HR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 324 aggtgatccgcggctgggacga 345
to top
>emb|BX052952.1|CNS09D0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 358 aggtgatccgcggctgggacga 379
to top
>emb|BX040734.1|CNS093LE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1004

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 838 aggtgatccgcggctgggacga 817
to top
>emb|BX040733.1|CNS093LD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11CH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 331 aggtgatccgcggctgggacga 352
to top
>emb|BX040285.1|CNS0938X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 870 aggtgatccgcggctgggacga 849
to top
>emb|BX040284.1|CNS0938W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 954

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 352 aggtgatccgcggctgggacga 373
to top
>emb|BX032931.1|CNS08XKN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 772

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 384 aggtgatccgcggctgggacga 405
to top
>emb|BX025964.1|CNS08S74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4AB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 321 aggtgatccgcggctgggacga 342
to top
>emb|BX024487.1|CNS08R23 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 612

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 252 aggtgatccgcggctgggacga 273
to top
>emb|BX023901.1|CNS08QLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 400 aggtgatccgcggctgggacga 421
to top
>emb|BX023048.1|CNS08PY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 350 aggtgatccgcggctgggacga 371
to top
>emb|BX020146.1|CNS08NPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3CG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 345 aggtgatccgcggctgggacga 366
to top
>emb|BX019960.1|CNS08NKC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 850 aggtgatccgcggctgggacga 829
to top
>emb|BX019959.1|CNS08NKB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1066

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 433 aggtgatccgcggctgggacga 454
to top
>emb|BX017776.1|CNS08LVO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 866 aggtgatccgcggctgggacga 845
to top
>emb|BX017775.1|CNS08LVN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 416 aggtgatccgcggctgggacga 437
to top
>emb|BX017758.1|CNS08LV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 375

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 113 aggtgatccgcggctgggacga 134
to top
>emb|BX017754.1|CNS08LV2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 588

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 414 aggtgatccgcggctgggacga 435
to top
>emb|BX012176.1|CNS08HK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 804 aggtgatccgcggctgggacga 783
to top
>emb|BX012175.1|CNS08HK3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 352 aggtgatccgcggctgggacga 373
to top
>ref|XM_320351.2| Anopheles gambiae str. PEST ENSANGP00000014046
           (ENSANGG00000011557), mRNA
          Length = 954

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 206 aggtgatccgcggctgggacga 227
           ||||||||||||||||||||||
Sbjct: 352 aggtgatccgcggctgggacga 373
to top
>gb|U29172.1|PAU29172 Pseudomonas aeruginosa HtrA-like serine protease AlgW gene,
           complete cds
          Length = 1191

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 201 cggccaggtgatccgcggctgg 222
           ||||||||||||||||||||||
Sbjct: 835 cggccaggtgatccgcggctgg 856
to top
>gb|DQ244415.1| Zea mays clone 7322 mRNA sequence
          Length = 720

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 141 aagggccagaaggtcaccgttcactgcac 169
to top
>emb|CT833934.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA119C04, full
           insert sequence
          Length = 1344

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 900 aagggccagaaggtcaccgtccactgcac 928
to top
>emb|CT833933.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA015F18, full
           insert sequence
          Length = 673

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 206 aagggccagaaggtcaccgtccactgcac 234
to top
>ref|NM_001054723.1| Oryza sativa (japonica cultivar-group) Os02g0760300 (Os02g0760300)
           mRNA, complete cds
          Length = 630

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 152 aagggccagaaggtcaccgtccactgcac 180
to top
>gb|AC190267.1| Gallus gallus chromosome Z clone CH261-44B21, complete sequence
          Length = 162998

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 165   ccccggccagactcccttctccttc 189
             |||| ||||||||||||||||||||
Sbjct: 12496 cccctgccagactcccttctccttc 12520
to top
>gb|DQ428233.1| Sorghum propinquum locus PRC0268 genomic sequence
          Length = 798

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 73  aagggccagaaggtcaccgtccactgcac 101
to top
>gb|DQ428232.1| Sorghum bicolor voucher PI585454 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428231.1| Sorghum bicolor voucher PI267539 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428230.1| Sorghum bicolor voucher PI267408 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428229.1| Sorghum bicolor voucher PI221607 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428228.1| Sorghum bicolor voucher PI152702 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428227.1| Sorghum bicolor voucher NSL92371 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428226.1| Sorghum bicolor voucher NSL87902 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428225.1| Sorghum bicolor voucher NSL87666 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428224.1| Sorghum bicolor voucher NSL77217 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428223.1| Sorghum bicolor voucher NSL77034 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428222.1| Sorghum bicolor voucher NSL56174 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428221.1| Sorghum bicolor voucher NSL56003 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428220.1| Sorghum bicolor voucher NSL55243 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428219.1| Sorghum bicolor voucher NSL51365 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428218.1| Sorghum bicolor voucher NSL51030 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|DQ428217.1| Sorghum bicolor voucher NSL50875 locus PRC0268 genomic sequence
          Length = 801

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 76  aagggccagaaggtcaccgtccactgcac 104
to top
>gb|AY754697.1| Zea mays immunophilin mRNA, complete cds
          Length = 761

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 164 aagggccagaaggtcaccgttcactgcac 192
to top
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 298     aagggcttccccgcctggggc 318
               |||||||||||||||||||||
Sbjct: 3019024 aagggcttccccgcctggggc 3019044
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 91       aagggccagaagatcaccgtgcactgcac 119
                |||||||||||| ||||||| ||||||||
Sbjct: 32038180 aagggccagaaggtcaccgtccactgcac 32038152
to top
>dbj|AP004159.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1175_B01
          Length = 96191

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 91    aagggccagaagatcaccgtgcactgcac 119
             |||||||||||| ||||||| ||||||||
Sbjct: 58555 aagggccagaaggtcaccgtccactgcac 58527
to top
>dbj|AK121481.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023149K16, full
           insert sequence
          Length = 620

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 153 aagggccagaaggtcaccgtccactgcac 181
to top
>dbj|AK100511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023099N19, full
           insert sequence
          Length = 1896

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 150 aagggccagaaggtcaccgtccactgcac 178
to top
>dbj|AK063850.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-C11, full
           insert sequence
          Length = 630

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 152 aagggccagaaggtcaccgtccactgcac 180
to top
>gb|AF117595.1|AF117595 Manduca sexta clone pMsmaD183 FK506-binding protein mRNA, complete
           cds
          Length = 930

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 206 aggtgatccgcggctgggacgaggg 230
           |||||||||| ||||||||||||||
Sbjct: 236 aggtgatccgaggctgggacgaggg 260
to top
>gb|AY103897.1| Zea mays PCO108516 mRNA sequence
          Length = 797

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 91  aagggccagaagatcaccgtgcactgcac 119
           |||||||||||| ||||||| ||||||||
Sbjct: 164 aagggccagaaggtcaccgttcactgcac 192
to top
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 204     ccaggtgatccgcggctgggacga 227
               |||||| |||||||||||||||||
Sbjct: 2744256 ccaggtcatccgcggctgggacga 2744233
to top
>emb|CT025367.2| Xenopus tropicalis finished cDNA, clone TNeu030i01
          Length = 747

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 208 gtgatccgcggctgggacgagggc 231
           ||||||||||||||||| ||||||
Sbjct: 176 gtgatccgcggctgggaggagggc 199
to top
>gb|AE011846.1| Xanthomonas axonopodis pv. citri str. 306,  section 224 of 469 of the
            complete genome
          Length = 11508

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 204  ccaggtgatccgcggctgggacga 227
            |||||| |||||||||||||||||
Sbjct: 4747 ccaggtcatccgcggctgggacga 4724
to top
>dbj|AK042542.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:A730002P21 product:SRY-box
           containing gene 10, full insert sequence
          Length = 2698

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 301 ggcttccccgcctggggcat 320
           ||||||||||||||||||||
Sbjct: 874 ggcttccccgcctggggcat 855
to top
>ref|XM_803305.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053506847.70) partial mRNA
          Length = 1077

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 375 tacataaagcacgcgcctgctctt 398
           |||||||||||| |||||||||||
Sbjct: 520 tacataaagcactcgcctgctctt 543
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 172      cagactcccttctccttcaa 191
                ||||||||||||||||||||
Sbjct: 21654218 cagactcccttctccttcaa 21654199
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 94       ggccagaagatcaccgtgca 113
                ||||||||||||||||||||
Sbjct: 23487696 ggccagaagatcaccgtgca 23487715
to top
>emb|AL162594.13| Human DNA sequence from clone RP5-1037B23 on chromosome 1p13.1-13.3
             Contains the SYT6 gene for synaptotagmin VI and a CpG
             island, complete sequence
          Length = 114098

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    ccagcttcccaggaagggcc 97
             ||||||||||||||||||||
Sbjct: 40665 ccagcttcccaggaagggcc 40684
to top
>emb|BX005693.1|CNS08CK1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA1BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 314

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 208 gtgatccgcggctgggacga 227
           ||||||||||||||||||||
Sbjct: 256 gtgatccgcggctgggacga 275
to top
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 210     gatccgcggctgggacgagg 229
               ||||||||||||||||||||
Sbjct: 1347608 gatccgcggctgggacgagg 1347627
to top
>dbj|AP005471.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0062E01
          Length = 161804

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 172   cagactcccttctccttcaa 191
             ||||||||||||||||||||
Sbjct: 53149 cagactcccttctccttcaa 53130
to top
>ref|NM_001011088.1| Xenopus tropicalis hypothetical LOC496501 (LOC496501), mRNA
 gb|BC084480.1| Xenopus tropicalis hypothetical LOC496501, mRNA (cDNA clone
           MGC:89394 IMAGE:6989418), complete cds
          Length = 1026

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 208 gtgatccgcggctgggacgagggc 231
           ||||||||||||||||| ||||||
Sbjct: 371 gtgatccgcggctgggaggagggc 394
to top
>gb|U31902.1|PDU31902 Paracoccus denitrificans succinate dehydrogenase b-type cytochrome
           subunit (sdhC), succinate dehydrogenase hydrophobic
           membrane anchor (sdhD), succinate dehydrogenase
           flavoprotein subunit (sdhA), and succinate dehydrogenase
           iron-sulfur protein subunit (sdhB) genes, complete cds
          Length = 6380

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 197 gcatcggccaggtgatccgc 216
           ||||||||||||||||||||
Sbjct: 543 gcatcggccaggtgatccgc 562
to top
>gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0095J22, complete sequence
          Length = 151730

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 94    ggccagaagatcaccgtgca 113
             ||||||||||||||||||||
Sbjct: 23420 ggccagaagatcaccgtgca 23439


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 57,649,352
Number of extensions: 3006612
Number of successful extensions: 207428
Number of sequences better than 10.0: 76
Number of HSP's gapped: 207428
Number of HSP's successfully gapped: 76
Length of query: 429
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 407
Effective length of database: 18,508,616,841
Effective search space: 7533007054287
Effective search space used: 7533007054287
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
to top