ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf69k12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001049118.1| Oryza sativa (japonica cultivar-group) Os01g... 1455 0.0
2dbj|AK072762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 1455 0.0
3dbj|AK240999.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 1162 0.0
4ref|NM_001050284.1| Oryza sativa (japonica cultivar-group) Os01g... 327 1e-85
5dbj|AK061752.1| Oryza sativa (japonica cultivar-group) cDNA clon... 327 1e-85
6gb|AF155333.2|AF155333 Oryza sativa NADP-specific isocitrate deh... 327 1e-85
7emb|CT832096.1| Oryza sativa (indica cultivar-group) cDNA clone:... 274 1e-69
8emb|X77944.1|NTNIDH N.tabacum (Xanthi) NADP-dependent Isocitrate... 270 2e-68
9gb|AY105031.1| Zea mays PCO072845 mRNA sequence 264 1e-66
10gb|BT019016.1| Zea mays clone Contig512.F mRNA sequence 248 7e-62
11ref|NM_001062916.1| Oryza sativa (japonica cultivar-group) Os05g... 246 3e-61
12gb|AF155334.1|AF155334 Oryza sativa NADP-specific isocitrate deh... 246 3e-61
13gb|AF176669.1|AF176669 Citrus limon NADP-isocitrate dehydrogenas... 218 6e-53
14gb|AF367443.1| Prunus persica clone Icdh1 NADP-dependent isocitr... 204 1e-48
15gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, ... 202 4e-48
16dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 202 4e-48
17dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic D... 202 4e-48
18emb|X75638.1|STNICD S.tuberosum mRNA for NADP-dependent isocitr... 200 1e-47
19gb|DQ125944.1| Populus alba x Populus tremula cytosolic NADP+-is... 182 4e-42
20gb|U80912.1|EGU80912 Eucalyptus globulus NADP-isocitrate dehydro... 182 4e-42
21gb|L12157.1|SOYIDH Glycine max NADP-specific isocitrate dehydrog... 178 5e-41
22gb|AY509880.1| Pisum sativum NADP-dependent isocitrate dehydroge... 176 2e-40
23gb|AY107138.1| Zea mays PCO115488 mRNA sequence 176 2e-40
24gb|AY572426.1| Capsicum annuum NADP-dependent isocitrate dehydro... 174 9e-40
25dbj|AB019327.1| Daucus carota mRNA for NADP specific isocitrate ... 172 3e-39
26gb|BT017177.1| Zea mays clone EL01N0369B08.c mRNA sequence 168 5e-38
27emb|AJ437269.1|CSA437269 Cucumis sativus mRNA for isocitrate deh... 168 5e-38
28gb|M93672.1|ALFISDHYA Medicago sativa isocitrate dehydrogenase m... 163 3e-36
29dbj|AB019328.1| Daucus carota mRNA for NADP specific isocitrate ... 153 3e-33
30gb|BT025983.1| Arabidopsis thaliana At1g54340 mRNA, complete cds 149 5e-32
31ref|NM_104312.2| Arabidopsis thaliana ICDH (isocitrate dehydroge... 149 5e-32
32gb|AF316501.1|AF316501 Arabidopsis thaliana NADP-specific isocit... 149 5e-32
33emb|X97063.1|EGNADPID Eucalyptus globulus subsp. bicostata mRNA ... 147 2e-31
34gb|AF095445.1|AF095445 Glycine max NADP-dependent isocitrate deh... 147 2e-31
35gb|AY344584.1| Pinus pinaster NADP+-isocitrate dehydrogenase mRN... 139 5e-29
36dbj|AB109114.1| Lupinus albus LaICDH1;2 mRNA for NADP-specific i... 137 2e-28
37dbj|AB109115.1| Lupinus albus LaICDH2;1 mRNA for NADP-specific i... 133 3e-27
38gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome... 119 4e-23
39dbj|AB243085.1| Codonopsis lanceolata mRNA for NADP-isocitrate d... 119 4e-23
40dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 119 4e-23
41dbj|AB109113.1| Lupinus albus LaICDH1;1 mRNA for NADP-specific i... 117 2e-22
42ref|NM_105265.2| Arabidopsis thaliana isocitrate dehydrogenase (... 113 3e-21
43gb|AY097340.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, co... 113 3e-21
44gb|AY093091.1| Arabidopsis thaliana similar to NADP-specific iso... 113 3e-21
45gb|AF419575.1|AF419575 Arabidopsis thaliana At1g65930/F12P19_10 ... 113 3e-21
46gb|AY088129.1| Arabidopsis thaliana clone 41544 mRNA, complete s... 113 3e-21
47gb|AY045631.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, co... 113 3e-21
48emb|AJ437268.1|ATH437268 Arabidopsis thaliana mRNA for isocitrat... 113 3e-21
49gb|BT002400.1| Arabidopsis thaliana isocitrate dehydrogenase, pu... 113 3e-21
50emb|X16648.1|HVPR1 Barley fungal pathogen induced mRNA for patho... 113 3e-21
51gb|AY997861.1| Lathrocasis tenerrima voucher Johnson 93-103 WS c... 111 1e-20
52gb|AF173666.1|AF173666 Beta vulgaris clone ISORT isocitrate dehy... 111 1e-20
53gb|AY997909.1| Saltugilia splendens subsp. grantii voucher Johns... 109 4e-20
54gb|AY997908.1| Saltugilia splendens subsp. grantii voucher Johns... 109 4e-20
55gb|AY997907.1| Saltugilia splendens subsp. grantii voucher Johns... 109 4e-20
56gb|AY997901.1| Saltugilia caruifolia voucher Johnson 93-092 BRY ... 109 4e-20
57gb|AY997899.1| Saltugilia caruifolia voucher Johnson 93-092 BRY ... 109 4e-20
58gb|AY997898.1| Saltugilia caruifolia voucher Weese 01-032 BRY cl... 109 4e-20
59gb|BT016882.1| Zea mays clone Contig715 mRNA sequence 105 7e-19
60gb|AY730588.2| Pisum sativum NADP-dependent isocitrate dehydroge... 105 7e-19
61gb|AY997906.1| Saltugilia splendens subsp. grantii voucher Johns... 105 7e-19
62gb|AY104847.1| Zea mays PCO066525 mRNA sequence 105 7e-19
63emb|X92486.1|STICDH2 S.tuberosum mRNA for NADP-isocitrate dehydr... 103 3e-18
64ref|NM_001049119.1| Oryza sativa (japonica cultivar-group) Os01g... 101 1e-17
65gb|AY997878.1| Saltugilia splendens subsp. splendens voucher Joh... 101 1e-17
66gb|AY997877.1| Saltugilia splendens subsp. splendens voucher Joh... 101 1e-17
67gb|AY997876.1| Saltugilia splendens subsp. grantii voucher Johns... 101 1e-17
68gb|AY997874.1| Saltugilia latimeri voucher Johnson 92-021 WS iso... 101 1e-17
69gb|AY997873.1| Saltugilia caruifolia voucher Johnson 97-100 BRY ... 101 1e-17
70gb|AY997870.1| Saltugilia australis voucher Johnson 97-049 BRY i... 101 1e-17
71gb|AY997858.1| Gilia scopulorum voucher Johnson304 BRY isocitrat... 101 1e-17
72gb|AY997919.1| Saltugilia splendens subsp. splendens voucher Joh... 101 1e-17
73gb|AY997917.1| Saltugilia splendens subsp. splendens voucher Joh... 101 1e-17
74gb|AY997916.1| Saltugilia splendens subsp. grantii voucher Johns... 101 1e-17
75gb|AY997915.1| Saltugilia splendens subsp. grantii voucher Johns... 101 1e-17
76gb|AY997912.1| Saltugilia splendens subsp. grantii voucher Johns... 101 1e-17
77gb|AY997911.1| Saltugilia splendens subsp. grantii voucher Johns... 101 1e-17
78gb|AY997910.1| Saltugilia splendens subsp. grantii voucher Johns... 101 1e-17
79gb|AY997905.1| Saltugilia latimeri voucher Johnson 92-021 WS iso... 101 1e-17
80gb|AY997903.1| Saltugilia caruifolia voucher Johnson 97-100 BRY ... 101 1e-17
81gb|AY997902.1| Saltugilia caruifolia voucher Johnson 97-099 BRY ... 101 1e-17
82gb|AY997897.1| Saltugilia australis voucher Johnson 97-082 BRY c... 101 1e-17
83gb|AY997896.1| Saltugilia australis voucher Johnson 97-065 BRY c... 101 1e-17
84gb|AY997894.1| Saltugilia australis voucher Johnson 97-049 BRY c... 101 1e-17
85gb|AY997893.1| Saltugilia australis voucher Johnson 97-049 BRY c... 101 1e-17
86gb|AY997892.1| Saltugilia australis voucher Johnson 97-049 BRY c... 101 1e-17
87gb|AY997891.1| Saltugilia australis voucher Johnson 97-049 BRY c... 101 1e-17
88gb|AY997890.1| Saltugilia australis voucher Johnson 97-049 BRY c... 101 1e-17
89dbj|AK059893.1| Oryza sativa (japonica cultivar-group) cDNA clon... 101 1e-17
90emb|Y12540.1|AGIDHC A.graveolens mRNA for isocitrate dehydrogena... 96 6e-16
91gb|AY997862.1| Lathrocasis tenerrima voucher Johnson 93-103 WS c... 96 6e-16
92gb|AY997887.1| Lathrocasis tenerrima voucher Johnson 93-103 WS i... 96 6e-16
93dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic D... 96 6e-16
94dbj|AP003709.2| Oryza sativa (japonica cultivar-group) genomic D... 96 6e-16
95gb|AY997872.1| Saltugilia caruifolia voucher Johnson 93-092 BRY ... 94 3e-15
96gb|AY997866.1| Navarretia breweri voucher Johnson 93-101 WS isoc... 94 3e-15
97gb|AY997859.1| Gilia stellata voucher Johnson 97-006 BRY isocitr... 94 3e-15
98gb|AY997855.1| Gilia capitata voucher Johnson 92-015 WS isocitra... 94 3e-15
99gb|AY997854.1| Dayia scabra voucher Porter 15422 RSA isocitrate ... 94 3e-15
100gb|AY997847.1| Aliciella latifolia voucher Johnson 93-018 WS clo... 94 3e-15
101gb|AY997846.1| Aliciella latifolia voucher Johnson 93-018 WS clo... 94 3e-15
102gb|AY997918.1| Saltugilia splendens subsp. splendens voucher Joh... 94 3e-15
103gb|AY997913.1| Saltugilia splendens subsp. grantii voucher Johns... 94 3e-15
104gb|AY997900.1| Saltugilia caruifolia voucher Johnson 93-092 BRY ... 94 3e-15
105gb|AY997885.1| Gilia stellata voucher Johnson 97-006 BRY isocitr... 94 3e-15
106gb|AY997882.1| Dayia scabra voucher Porter 15422 RSA isocitrate ... 94 3e-15
107gb|AY997875.1| Saltugilia splendens subsp. grantii voucher Johns... 92 1e-14
108gb|AY997845.1| Aliciella hutchinsifolia voucher Johnson 96-069 W... 92 1e-14
109gb|AY997844.1| Aliciella hutchinsifolia voucher Johnson 96-069 W... 92 1e-14
110gb|AY997914.1| Saltugilia splendens subsp. grantii voucher Johns... 92 1e-14
111gb|AY997879.1| Aliciella hutchinsifolia voucher Johnson 93-069 W... 92 1e-14
112emb|CR855213.1| Oryza sativa genomic DNA, chromosome 4, BAC clon... 90 4e-14
113ref|NM_001059804.1| Oryza sativa (japonica cultivar-group) Os04g... 90 4e-14
114ref|NM_001049117.1| Oryza sativa (japonica cultivar-group) Os01g... 90 4e-14
115dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 90 4e-14
116gb|AY997843.1| Acanthogilia gloriosa voucher Johnson 95-070 WS i... 90 4e-14
117emb|AL662969.3|OSJN00169 Oryza sativa genomic DNA, chromosome 4,... 90 4e-14
118dbj|AK070042.1| Oryza sativa (japonica cultivar-group) cDNA clon... 90 4e-14
119gb|AC126787.12| Medicago truncatula clone mth2-11c8, complete se... 88 2e-13
120emb|X96728.1|NTNADPI N.tabacum mRNA for NADP-dependent isocitrat... 88 2e-13
121gb|DQ465384.1| Oreochromis mossambicus clone SSH #509 mitochondr... 86 6e-13
122ref|NM_121463.3| Arabidopsis thaliana isocitrate dehydrogenase (... 86 6e-13
123gb|AY810390.1| Schistosoma japonicum SJCHGC05125 protein mRNA, p... 86 6e-13
124gb|BT000276.1| Arabidopsis thaliana isocitrate dehydrogenase-lik... 86 6e-13
125gb|AF367449.1| Prunus persica clone Icdh2 NADP-dependent isocitr... 86 6e-13
126gb|AY099683.1| Arabidopsis thaliana isocitrate dehydrogenase-lik... 86 6e-13
127gb|AY997871.1| Saltugilia australis voucher Johnson 92-011 BRY i... 86 6e-13
128gb|AY997869.1| Navarretia mellita voucher Johnson 94-072 BRY iso... 86 6e-13
129gb|AY997867.1| Navarretia jepsonii voucher Johnson 96-011 BRY is... 86 6e-13
130gb|AY997857.1| Gilia laciniata voucher Morrell 403 RSA clone 2 i... 86 6e-13
131gb|AY997856.1| Gilia laciniata voucher Morrell 403 RSA clone 1 i... 86 6e-13
132gb|AY997852.1| Collomia heterophylla voucher Johnson 94-076 BRY ... 86 6e-13
133gb|AY997850.1| Allophyllum integrifolium voucher Johnson 93-111 ... 86 6e-13
134gb|AY997849.1| Allophyllum integrifolium voucher Johnson 93-111 ... 86 6e-13
135gb|AY997895.1| Saltugilia australis voucher Johnson 92-011 BRY c... 86 6e-13
136gb|AY997884.1| Gilia laciniata voucher Morrell 403 RSA isocitrat... 86 6e-13
137gb|AY997880.1| Allophyllum integrifolium voucher Johnson 93-111 ... 86 6e-13
138gb|AC009513.2|F12P19 Sequence of BAC F12P19 from Arabidopsis tha... 84 2e-12
139dbj|AK227755.1| Arabidopsis thaliana mRNA for NADP specific isoc... 82 1e-11
140dbj|D21069.1|RICAK88B Oryza sativa mRNA for isocitrate dehydroge... 80 4e-11
141ref|XM_640192.1| Dictyostelium discoideum AX4 isocitrate dehydro... 78 1e-10
142gb|AC116963.2| Dictyostelium discoideum chromosome 2 map 4657875... 78 1e-10
143gb|AY997853.1| Collomia tracyi voucher Johnson 94-075 BRY isocit... 78 1e-10
144gb|AY997851.1| Collomia diversifolia voucher Johnson 96-013 BRY ... 78 1e-10
145gb|AY997848.1| Allophyllum glutinosum voucher Johnson 93-032 BRY... 78 1e-10
146gb|AY997881.1| Collomia tracyi voucher Johnson 94-075 BRY isocit... 78 1e-10
147gb|AY111294.1| Zea mays CL31612_1 mRNA sequence 76 6e-10
148gb|AY111226.1| Zea mays CL7227_-2 mRNA sequence 76 6e-10
149gb|DQ448875.1| Theobroma cacao isocitrate dehydrogenase mRNA, pa... 74 2e-09
150gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 geno... 74 2e-09
151dbj|AP004491.1| Lotus japonicus genomic DNA, chromosome 1, clone... 74 2e-09
152gb|DQ196974.1| Collomia cavanillesii clone 1327c NADP-dependent ... 72 9e-09
153gb|DQ196973.1| Collomia grandiflora clone 14.1 NADP-dependent is... 72 9e-09
154gb|DQ196972.1| Collomia grandiflora NADP-dependent isocitrate de... 72 9e-09
155gb|DQ196971.1| Collomia wilkenii clone 99 NADP-dependent isocitr... 72 9e-09
156gb|DQ196970.1| Collomia wilkenii clone 75 NADP-dependent isocitr... 72 9e-09
157gb|DQ196969.1| Collomia wilkenii clone 1524C NADP-dependent isoc... 72 9e-09
158gb|DQ196968.1| Collomia wilkenii clone 1523B NADP-dependent isoc... 72 9e-09
159gb|DQ196967.1| Collomia wilkenii clone 1501A NADP-dependent isoc... 72 9e-09
160gb|DQ196966.1| Collomia tenella clone 1521A NADP-dependent isoci... 72 9e-09
161gb|DQ196965.1| Collomia tenella NADP-dependent isocitrate dehydr... 72 9e-09
162gb|DQ196964.1| Collomia renacta clone 1520i NADP-dependent isoci... 72 9e-09
163gb|DQ196963.1| Collomia cavanillesii clone 1327A NADP-dependent ... 72 9e-09
164gb|DQ196961.1| Collomia wilkenii clone 74 NADP-dependent isocitr... 72 9e-09
165gb|DQ196960.1| Collomia wilkenii clone 1524B NADP-dependent isoc... 72 9e-09
166gb|DQ196959.1| Collomia wilkenii clone 1523A NADP-dependent isoc... 72 9e-09
167gb|DQ196958.1| Collomia wilkenii clone 1501B NADP-dependent isoc... 72 9e-09
168gb|DQ196957.1| Collomia linearis clone 1500C NADP-dependent isoc... 72 9e-09
169gb|DQ196956.1| Collomia linearis clone 1526K NADP-dependent isoc... 72 9e-09
170emb|AJ973130.1| Andrographis paniculata partial idh gene for put... 72 9e-09
171gb|AC189484.1| Brassica rapa subsp. pekinensis clone KBrB083K19,... 70 4e-08
172gb|AY997868.1| Navarretia leptalea voucher Johnson 93-131 BRY is... 70 4e-08
173gb|AY997904.1| Saltugilia latimeri voucher Grant 8840 RSA isocit... 70 4e-08
174gb|AY997889.1| Navarretia leptalea voucher Johnson 93-131 BRY is... 70 4e-08
175gb|BC046379.1| Xenopus laevis, clone IMAGE:5542876, mRNA 66 6e-07
176gb|AY068151.1| Schmidtea mediterranea clone H.79.5h(T3) unknown ... 66 6e-07
177gb|DQ196975.1| Collomia tinctoria clone 2 NADP-dependent isocitr... 64 2e-06
178gb|DQ196962.1| Collomia wilkenii clone 11.4 NADP-dependent isoci... 64 2e-06
179ref|NM_001046669.1| Bombyx mori isocitrate dehydrogenase (LOC692... 64 2e-06
180emb|AL163792.1|ATT15N1 Arabidopsis thaliana DNA chromosome 5, BA... 64 2e-06
181ref|XM_421965.2| PREDICTED: Gallus gallus similar to cytosolic N... 62 9e-06
182ref|NM_001004799.1| Xenopus tropicalis MGC69505 protein (MGC6950... 62 9e-06
183gb|AC132565.28| Medicago truncatula clone mth2-4a8, complete seq... 62 9e-06
184emb|CT025337.2| Xenopus tropicalis finished cDNA, clone TNeu118i04 62 9e-06
185gb|AY997883.1| Gilia cana voucher Johnson 93-016 WS isocitrate d... 62 9e-06
186gb|AF457967.1| Zea mays clone bms1.pk0003.f5, mRNA sequence 62 9e-06
187dbj|AK112679.1| Ciona intestinalis cDNA, clone:cieg029b05, full ... 62 9e-06
188gb|DQ196986.1| Collomia cavanillesii clone 1344J putative cytoso... 60 3e-05
189gb|DQ196985.1| Collomia grandiflora putative cytosolic NADP isoc... 60 3e-05
190gb|DQ196976.1| Collomia tinctoria clone 33 NADP-dependent isocit... 60 3e-05
191gb|BC054241.1| Xenopus laevis hypothetical protein MGC64442, mRN... 60 3e-05
192emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome 60 3e-05
193gb|AY997886.1| Ipomopsis polycladon voucher Johnson 93-068 BRY i... 60 3e-05
194ref|XM_674495.1| Plasmodium berghei strain ANKA isocitrate dehyd... 60 3e-05
195ref|XM_725295.1| Plasmodium yoelii yoelii str. 17XNL NADP-depend... 60 3e-05
196ref|XM_720412.1| Plasmodium yoelii yoelii str. 17XNL isocitrate ... 60 3e-05
197gb|DQ196987.1| Collomia tinctoria clone 7.2 putative cytosolic N... 58 1e-04
198gb|CP000394.1| Granulibacter bethesdensis CGDNIH1, complete genome 58 1e-04
199gb|CP000362.1| Roseobacter denitrificans OCh 114, complete genome 58 1e-04
200gb|AE013012.1| Thermoanaerobacter tengcongensis MB4, section 39 ... 58 1e-04
201ref|NM_077474.2| Caenorhabditis elegans C34F6.8 (C34F6.8) mRNA, ... 58 1e-04
202gb|DQ086200.1| Ictalurus punctatus isocitrate dehydrogenase 2 mR... 58 1e-04
203gb|AY112639.1| Zea mays CL62576_1 mRNA sequence 58 1e-04
204gb|DQ403074.1| Tamandua tetradactyla isocitrate dehydrogenase 1 ... 56 5e-04
205gb|AY617794.1| Sterkiella histriomuscorum clone UGC1O0005_K08_R ... 56 5e-04
206dbj|AK220845.1| Arabidopsis thaliana mRNA for NADP specific isoc... 56 5e-04
207gb|DQ196984.1| Collomia wilkenii clone 1534M putative cytosolic ... 54 0.002
208gb|DQ196983.1| Collomia tenella putative cytosolic NADP isocitra... 54 0.002
209gb|DQ196982.1| Collomia tenella clone 1530A putative cytosolic N... 54 0.002
210gb|DQ196981.1| Collomia wilkenii clone 1534K putative cytosolic ... 54 0.002
211gb|DQ196980.1| Collomia cavanillesii clone 1344L putative cytoso... 54 0.002
212gb|DQ196979.1| Collomia renacta clone 1531L putative cytosolic N... 54 0.002
213gb|DQ196978.1| Collomia linearis clone 1536B putative cytosolic ... 54 0.002
214ref|XM_640191.1| Dictyostelium discoideum AX4 isocitrate dehydro... 54 0.002
215gb|BC063967.1| Danio rerio isocitrate dehydrogenase 2 (NADP+), m... 54 0.002
216gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 54 0.002
217gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete... 54 0.002
218emb|BX818521.1|CNS0AE6Z Arabidopsis thaliana Full-length cDNA Co... 54 0.002
219ref|NM_207873.1| Eremothecium gossypii AAL022Wp (AAL022W), mRNA 54 0.002
220ref|NM_199564.1| Danio rerio isocitrate dehydrogenase 2 (NADP+),... 54 0.002
221ref|XM_963757.1| PREDICTED: Tribolium castaneum similar to CG717... 52 0.009
222gb|AY758242.1| Toxoplasma gondii isocitrate dehydrogenase (ICDH1... 52 0.009
223gb|AY617793.1| Sterkiella histriomuscorum clone UGC1O0005_K08_F ... 52 0.009
224gb|AY432993.1| Aedes aegypti ASAP ID: 36387 isocitrate dehydroge... 52 0.009
225ref|XM_708364.1| Candida albicans SC5314 cytosolic NADP-specific... 52 0.009
226ref|XM_708328.1| Candida albicans SC5314 cytosolic NADP-specific... 52 0.009
227ref|XM_655511.1| Aspergillus nidulans FGSC A4 isocitrate dehydro... 52 0.009
228dbj|AK107792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.009
229dbj|AK107325.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.009
230ref|XM_735713.1| Plasmodium chabaudi chabaudi hypothetical prote... 52 0.009
231ref|XM_729441.1| Plasmodium chabaudi chabaudi hypothetical prote... 52 0.009
232dbj|AK233706.1| Sus scrofa mRNA, clone:LVRM10208G10, expressed i... 50 0.034
233dbj|AK233241.1| Sus scrofa mRNA, clone:LVRM10108F06, expressed i... 50 0.034
234dbj|AK231773.1| Sus scrofa mRNA, clone:LNG010021H05, expressed i... 50 0.034
235gb|DQ196977.1| Collomia linearis clone 1510i putative cytosolic ... 50 0.034
236ref|XM_001168316.1| PREDICTED: Pan troglodytes isocitrate dehydr... 50 0.034
237ref|XM_510589.2| PREDICTED: Pan troglodytes isocitrate dehydroge... 50 0.034
238ref|XM_001168291.1| PREDICTED: Pan troglodytes isocitrate dehydr... 50 0.034
239ref|XM_001168261.1| PREDICTED: Pan troglodytes isocitrate dehydr... 50 0.034
240gb|DQ896063.1| Homo sapiens clone FLH189993.01L; RZPDo839D0565D ... 50 0.034
241gb|DQ892817.1| Synthetic construct Homo sapiens clone FLH189997.... 50 0.034
242gb|AC187707.1| Gasterosteus aculeatus clone VMRC28-60C14, comple... 50 0.034
243gb|DQ443205.1| Bombyx mori NADPH-specific isocitrate dehydrogena... 50 0.034
244gb|AC122587.5| Rattus norvegicus BAC CH230-173H6 (Children's Ho... 50 0.034
245gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, com... 50 0.034
246ref|NM_002168.2| Homo sapiens isocitrate dehydrogenase 2 (NADP+)... 50 0.034
247gb|AC109232.17| Mus musculus chromosome 7, clone RP23-423P21, co... 50 0.034
248gb|BC060030.1| Mus musculus isocitrate dehydrogenase 2 (NADP+), ... 50 0.034
249ref|XM_705827.1| Candida albicans SC5314 NADP-specific isocitrat... 50 0.034
250ref|XM_705812.1| Candida albicans SC5314 NADP-specific isocitrat... 50 0.034
251gb|DQ311190.1| Bombyx mori isocitrate dehydrogenase precursor, m... 50 0.034
252ref|XM_459772.1| Debaryomyces hansenii CBS767 hypothetical prote... 50 0.034
253dbj|AK146564.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 50 0.034
254dbj|AK145753.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 50 0.034
255dbj|AK161640.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 50 0.034
256dbj|AK169395.1| Mus musculus 16 days embryo heart cDNA, RIKEN fu... 50 0.034
257ref|NM_069264.3| Caenorhabditis elegans F59B8.2 (F59B8.2) mRNA, ... 50 0.034
258dbj|AK088110.1| Mus musculus 2 days neonate thymus thymic cells ... 50 0.034
259ref|XM_816506.1| Trypanosoma cruzi strain CL Brener isocitrate d... 50 0.034
260emb|Z68343.1|CEF59B8 Caenorhabditis elegans Cosmid F59B8, comple... 50 0.034
261dbj|AK222916.1| Homo sapiens mRNA for isocitrate dehydrogenase 2... 50 0.034
262emb|X69433.1|HSIDNADP H.sapiens mRNA for mitochondrial isocitrat... 50 0.034
263emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS... 50 0.034
264emb|BX897699.1| Bartonella henselae strain Houston-1, complete g... 50 0.034
265ref|NM_173011.1| Mus musculus isocitrate dehydrogenase 2 (NADP+)... 50 0.034
266emb|CR625817.1| full-length cDNA clone CS0DA002YE04 of Neuroblas... 50 0.034
267emb|CR625730.1| full-length cDNA clone CS0DF007YI03 of Fetal bra... 50 0.034
268emb|CR625291.1| full-length cDNA clone CS0DI018YK23 of Placenta ... 50 0.034
269emb|CR622745.1| full-length cDNA clone CS0DI029YO14 of Placenta ... 50 0.034
270emb|CR619410.1| full-length cDNA clone CS0DI042YG08 of Placenta ... 50 0.034
271emb|CR619261.1| full-length cDNA clone CS0DL009YE05 of B cells (... 50 0.034
272emb|CR617370.1| full-length cDNA clone CS0DI081YH08 of Placenta ... 50 0.034
273emb|CR617266.1| full-length cDNA clone CS0DI041YL18 of Placenta ... 50 0.034
274emb|CR617229.1| full-length cDNA clone CS0DF006YD12 of Fetal bra... 50 0.034
275emb|CR616318.1| full-length cDNA clone CS0DI008YC17 of Placenta ... 50 0.034
276emb|CR615856.1| full-length cDNA clone CS0DI077YD06 of Placenta ... 50 0.034
277emb|CR613707.1| full-length cDNA clone CS0DI044YJ06 of Placenta ... 50 0.034
278emb|CR610749.1| full-length cDNA clone CS0DI056YE07 of Placenta ... 50 0.034
279emb|CR610921.1| full-length cDNA clone CS0DF013YA17 of Fetal bra... 50 0.034
280emb|CR610676.1| full-length cDNA clone CS0DH005YD07 of T cells (... 50 0.034
281emb|CR607742.1| full-length cDNA clone CS0DK005YD09 of HeLa cell... 50 0.034
282emb|CR607159.1| full-length cDNA clone CS0CAP008YI14 of Thymus o... 50 0.034
283emb|CR607058.1| full-length cDNA clone CS0DI057YN22 of Placenta ... 50 0.034
284emb|CR606745.1| full-length cDNA clone CS0DH005YP17 of T cells (... 50 0.034
285emb|CR606440.1| full-length cDNA clone CS0DI066YD06 of Placenta ... 50 0.034
286emb|CR604829.1| full-length cDNA clone CS0DA005YA06 of Neuroblas... 50 0.034
287emb|CR602902.1| full-length cDNA clone CS0DF017YA02 of Fetal bra... 50 0.034
288emb|CR602079.1| full-length cDNA clone CS0DI039YF02 of Placenta ... 50 0.034
289emb|CR600938.1| full-length cDNA clone CS0DA007YE17 of Neuroblas... 50 0.034
290emb|CR600286.1| full-length cDNA clone CS0DI027YC02 of Placenta ... 50 0.034
291emb|CR599284.1| full-length cDNA clone CS0DL002YF02 of B cells (... 50 0.034
292emb|CR599159.1| full-length cDNA clone CS0DI013YL09 of Placenta ... 50 0.034
293emb|CR598530.1| full-length cDNA clone CS0DI043YC04 of Placenta ... 50 0.034
294emb|CR597829.1| full-length cDNA clone CS0DI018YK02 of Placenta ... 50 0.034
295emb|CR597564.1| full-length cDNA clone CS0DA008YM06 of Neuroblas... 50 0.034
296emb|CR595435.1| full-length cDNA clone CS0DI054YK01 of Placenta ... 50 0.034
297emb|CR594870.1| full-length cDNA clone CS0DI064YE13 of Placenta ... 50 0.034
298emb|CR593589.1| full-length cDNA clone CS0DM002YM16 of Fetal liv... 50 0.034
299emb|CR593087.1| full-length cDNA clone CS0DI023YP13 of Placenta ... 50 0.034
300emb|CR590507.1| full-length cDNA clone CS0DI040YO19 of Placenta ... 50 0.034
301gb|AC092769.7| Homo sapiens chromosome 15, clone CTD-2315E11, co... 50 0.034
302gb|BC071828.1| Homo sapiens isocitrate dehydrogenase 2 (NADP+), ... 50 0.034
303gb|BC009244.2| Homo sapiens isocitrate dehydrogenase 2 (NADP+), ... 50 0.034
304gb|U51167.1|MMU51167 Mus musculus isocitrate dehydrogenase mRNA,... 50 0.034
305gb|M86719.1|PIGMTNADP Pig mitochondrial NADP-isocitrate dehydrog... 50 0.034
306gb|DQ403073.1| Dasypus novemcinctus isocitrate dehydrogenase 1 (... 48 0.13
307gb|DQ403070.1| Didelphis virginiana isocitrate dehydrogenase 1 (... 48 0.13
308gb|CP000264.1| Jannaschia sp. CCS1, complete genome 48 0.13
309gb|AY997865.1| Linanthus maculatus voucher Johnson 97-002 BRY is... 48 0.13
310gb|AY997888.1| Linanthus maculatus voucher Johnson 97-002 BRY is... 48 0.13
311gb|AC073945.34| Mus musculus strain C57BL/6J chromosome 9 clone ... 48 0.13
312dbj|AK116068.1| Ciona intestinalis cDNA, clone:citb006p20, full ... 48 0.13
313ref|XM_001020930.1| Tetrahymena thermophila SB210 dehydrogenase,... 46 0.53
314ref|XM_001017274.1| Tetrahymena thermophila SB210 isocitrate deh... 46 0.53
315ref|XM_001176835.1| PREDICTED: Strongylocentrotus purpuratus sim... 46 0.53
316ref|XM_775028.2| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.53
317gb|DQ403071.1| Sminthopsis douglasi isocitrate dehydrogenase 1 (... 46 0.53
318ref|NM_201499.1| Danio rerio isocitrate dehydrogenase 1 (NADP+),... 46 0.53
319ref|XM_697426.1| PREDICTED: Danio rerio hypothetical protein LOC... 46 0.53
320emb|AJ973131.1| Andrographis paniculata partial idh gene for put... 46 0.53
321ref|XM_686369.1| PREDICTED: Danio rerio similar to Isocitrate de... 46 0.53
322emb|CR380954.1| Candida glabrata strain CBS138 chromosome H comp... 46 0.53
323emb|CR376856.9| Zebrafish DNA sequence from clone CH211-11O22 in... 46 0.53
324ref|XM_446953.1| Candida glabrata CBS138, CAGL0H03663g partial mRNA 46 0.53
325emb|BX005152.9| Zebrafish DNA sequence from clone CH211-168G2 in... 46 0.53
326ref|XM_312860.2| Anopheles gambiae str. PEST ENSANGP00000016660 ... 46 0.53
327emb|AM263323.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
328emb|AM263318.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
329emb|AM263315.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
330emb|AM263314.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
331emb|AM263313.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
332emb|AM263312.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
333emb|AM263311.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
334emb|AM263310.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
335emb|AM263309.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
336emb|AM263307.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
337emb|AM263303.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
338emb|AM263302.1| Stylonychia lemnaepartial idh gene for isocitrat... 44 2.1
339ref|XM_623670.2| PREDICTED: Apis mellifera similar to Isocitrate... 44 2.1
340ref|XM_001095686.1| PREDICTED: Macaca mulatta isocitrate dehydro... 44 2.1
341gb|DQ440329.1| Aedes aegypti clone AET-426 NADP-dependent isocit... 44 2.1
342ref|XM_504978.1| Yarrowia lipolytica CLIB122, YALI0F04095g predi... 44 2.1
343emb|AL445469.4| Human DNA sequence from clone RP11-254N18 on chr... 44 2.1
344dbj|AK205677.1| Mus musculus cDNA, clone:Y2G0102H04, strand:plus... 44 2.1
345gb|AF268076.1|AF268076 Sinorhizobium meliloti NADP-dependent iso... 44 2.1
346gb|U52144.1|HSU52144 Human isocitrate dehydrogenase mRNA, comple... 44 2.1
347emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 44 2.1
348ref|XM_842170.1| Trypanosoma brucei TREU927 hypothetical protein... 42 8.2
349ref|XM_842107.1| Trypanosoma brucei TREU927 isocitrate dehydroge... 42 8.2
350ref|XM_001196036.1| PREDICTED: Strongylocentrotus purpuratus sim... 42 8.2
351ref|XM_777651.2| PREDICTED: Strongylocentrotus purpuratus simila... 42 8.2
352emb|AM263330.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
353emb|AM263329.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
354emb|AM263328.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
355emb|AM263327.1| Stylonychia lemnaepartial idh gene for isocitrat... 42 8.2
356emb|AM263326.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
357emb|AM263325.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
358emb|AM263324.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
359emb|AM263322.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
360emb|AM263321.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
361emb|AM263320.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
362emb|AM263319.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
363emb|AM263317.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
364emb|AM263316.1| Stylonychia mytiluspartial idh gene for isocitra... 42 8.2
365emb|AM263308.1| Stylonychia lemnaepartial idh gene for isocitrat... 42 8.2
366emb|AM263306.1| Stylonychia lemnaepartial idh gene for isocitrat... 42 8.2
367emb|AM263305.1| Stylonychia lemnaepartial idh gene for isocitrat... 42 8.2
368emb|AM263304.1| Stylonychia lemnaepartial idh gene for isocitrat... 42 8.2
369emb|AM263301.1| Stylonychia lemnaepartial idh gene for isocitrat... 42 8.2
370gb|CP000109.2| Thiomicrospira crunogena XCL-2, complete genome 42 8.2
371gb|DQ403080.1| Oryctolagus cuniculus isocitrate dehydrogenase 1 ... 42 8.2
372gb|DQ403072.1| Loxodonta africana isocitrate dehydrogenase 1 (ID... 42 8.2
373gb|CP000383.1| Cytophaga hutchinsonii ATCC 33406, complete genome 42 8.2
374gb|DQ775823.1| Synthetic construct Vibrio cholerae clone FLH1980... 42 8.2
375emb|CT033774.17| Mouse DNA sequence from clone RP24-574N19 on ch... 42 8.2
376gb|AC102769.12| Mus musculus chromosome 17, clone RP23-89A3, com... 42 8.2
377gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete seq... 42 8.2
378gb|AC092212.32| Trypanosoma brucei chromosome 8 clone RPCI93-10J... 42 8.2
379gb|AC159435.1| Trypanosoma brucei chromosome 8 clone RPCI93-29H2... 42 8.2
380gb|AY440864.1| Armigeres subalbatus ASAP ID: 41689 unknown mRNA ... 42 8.2
381gb|AC125006.9| Mus musculus chromosome 3, clone RP24-157K20, com... 42 8.2
382gb|AC117721.8| Mus musculus chromosome 1, clone RP24-196D2, comp... 42 8.2
383ref|XM_587627.2| PREDICTED: Bos taurus similar to Down-regulated... 42 8.2
384ref|XM_708365.1| Candida albicans SC5314 cytosolic NADP-specific... 42 8.2
385gb|AC135378.2| Mus musculus BAC clone RP24-284L24 from chromosom... 42 8.2
386gb|AC026232.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 42 8.2
387gb|AC131786.3| Mus musculus BAC clone RP24-397H7 from chromosome... 42 8.2
388gb|AC113107.15| Mus musculus chromosome 10, clone RP23-325G13, c... 42 8.2
389gb|AC147101.2| Mus musculus BAC clone RP23-455H16 from chromosom... 42 8.2
390gb|AC117230.3| Mus musculus BAC clone RP23-385F15 from 16, compl... 42 8.2
391gb|AE004390.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 42 8.2
392ref|XM_844263.1| PREDICTED: Canis familiaris similar to IP63 pro... 42 8.2
393gb|AC110169.7| Mus musculus chromosome 9, clone RP23-233D3, comp... 42 8.2
394ref|XM_819328.1| Trypanosoma brucei TREU927 clone RPCI93-29H22 h... 42 8.2
395ref|XM_820111.1| Trypanosoma brucei TREU927 clone RPCI93-10J17 i... 42 8.2
396gb|AC104644.3| Homo sapiens chromosome 3 clone RP11-281N1, compl... 42 8.2
397gb|AC158960.4| Mus musculus chromosome 1, clone RP23-315O2, comp... 42 8.2
398gb|AC157792.4| Mus musculus chromosome 7, clone RP24-192N20, com... 42 8.2
399ref|XM_391084.1| Gibberella zeae PH-1 chromosome 3 hypothetical ... 42 8.2
400dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, compl... 42 8.2
401gb|AC119807.11| Mus musculus chromosome 8, clone RP23-167I14, co... 42 8.2
402gb|AC124046.2| Homo sapiens chromosome 3 clone RP11-352B8, compl... 42 8.2
403gb|AF510423.1|AF510423S1 Homo sapiens chromosome 5 BAC clone TAR... 42 8.2
404emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 42 8.2
405ref|XM_960963.1| Plasmodium falciparum 3D7 hypothetical protein ... 42 8.2
406emb|Z81479.1|CEC34F6 Caenorhabditis elegans Cosmid C34F6, comple... 42 8.2
407gb|AC104633.2| Homo sapiens chromosome 3 clone RP11-118O11, comp... 42 8.2
408emb|CR382398.1| Plasmodium falciparum chromosome 6, complete seq... 42 8.2
409emb|AL669912.7| Mouse DNA sequence from clone RP23-147K24 on chr... 42 8.2
410gb|AC091825.4| Homo sapiens chromosome 5 clone CTC-463A16, compl... 42 8.2
411gb|AC007677.3| Homo sapiens BAC clone RP11-86N1 from 2, complete... 42 8.2
412gb|AC108857.13| Mus musculus chromosome 1, clone RP24-389A10, co... 42 8.2
413gb|AC026949.21| Mus musculus chromosome 7, clone RP23-103E11, co... 42 8.2
414gb|AC118685.10| Mus musculus chromosome 5, clone RP23-412L2, com... 42 8.2
415emb|AL732501.8| Mouse DNA sequence from clone RP23-325I22 on chr... 42 8.2
416gb|AC153591.4| Mus musculus 6 BAC RP23-301O22 (Roswell Park Canc... 42 8.2
417gb|AC120438.9| Mus musculus chromosome 7, clone RP24-572G2, comp... 42 8.2
418gb|AC101950.11| Mus musculus chromosome 1, clone RP24-149K4, com... 42 8.2
419emb|AL772211.7| Mouse DNA sequence from clone RP23-473B24 on chr... 42 8.2
420gb|AC132422.3| Mus musculus BAC clone RP23-302G15 from 12, compl... 42 8.2
421gb|AC148005.3| Mus musculus BAC clone RP23-295O6 from 12, comple... 42 8.2
422emb|CT025641.10| Mouse DNA sequence from clone RP24-322A17 on ch... 42 8.2
423gb|AC173346.1| Mus musculus BAC clone RP23-42N8 from chromosome ... 42 8.2
424gb|AC149281.2| Mus musculus BAC clone RP23-287D14 from 19, compl... 42 8.2
425emb|AL626771.9| Mouse DNA sequence from clone RP23-281O10 on chr... 42 8.2

>ref|NM_001049118.1| Oryza sativa (japonica cultivar-group) Os01g0248400 (Os01g0248400)
            mRNA, complete cds
          Length = 1855
 Score = 1455 bits (734), Expect = 0.0
 Identities = 1121/1250 (89%)
 Strand = Plus / Plus

                                                                        
Query: 172  ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
            ||||||||||||||||||||   || ||||||||| ||||||||||||||||||||||||
Sbjct: 195  ccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtgatgaga 254

                                                                        
Query: 232  tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
            |||| ||| |||| ||||||||||||||||||||||||||||| |||||| ||||| |||
Sbjct: 255  tgactcgagttatttggaaatggatcaaagataagcttatattccctttcttggacttgg 314

                                                                        
Query: 292  acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
            |||||||||||| |||||||||||||||||| ||||||||||||||||| ||||| || |
Sbjct: 315  acataaaatactatgacttaggtctacctaatcgtgacgctactggggacaaagttacaa 374

                                                                        
Query: 352  tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
            |||| ||||||||||| |||||||||||||| || |||||||||||||||||| | || |
Sbjct: 375  tagagagtgcagaagcgaccctaaagtataatgtagccatcaaatgtgcaactataactc 434

                                                                        
Query: 412  cagatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatggga 471
            |||||||||||||||| ||||||||||||||||  || ||||||| ||||||||||||||
Sbjct: 435  cagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatggga 494

                                                                        
Query: 472  caataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttc 531
            ||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 495  caataaggaacattttgaatggaactgttttccgagaaccaatcatctgcaagaatattc 554

                                                                        
Query: 532  ctcggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatc 591
            |||||||||| ||||| |||| ||| ||||||||||||||  ||||||| ||||||||||
Sbjct: 555  ctcggcttgtacctgggtggataaagcccatatgcattggacgacatgcatttggtgatc 614

                                                                        
Query: 592  aataccgagcaacagatataatcattagagggacagggaagctcaagttgatatttgatg 651
            |||||||||||||||||| | | |||| |||  | |||||| | |||||  |||||||||
Sbjct: 615  aataccgagcaacagatacagttattaaaggtcctgggaagttgaagttagtatttgatg 674

                                                                        
Query: 652  gcatagaggaacaaatagagttggatgtgttcaactttagtggtgctggtggagtagcat 711
            ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
Sbjct: 675  gcagagaggaacaaatagagttggatgtgttcaactttactggtgctggtggagtagcct 734

                                                                        
Query: 712  tatctatgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatgg 771
            | ||||||||||| ||||| ||||||||| | ||||| ||||||||||| ||||||||||
Sbjct: 735  tgtctatgtataatactgacgagtctatttgggcattcgctgaagcttccatgaacatgg 794

                                                                        
Query: 772  cttaccagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatg 831
            |||||||||| |||||||||||||||||||| || || ||||| ||||| |||||||| |
Sbjct: 795  cttaccagaaaagatggccactttatcttagcaccaaaaacacgatcctcaaaaaatacg 854

                                                                        
Query: 832  acggaaggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttg 891
            | |||||||||||||| ||||| ||  | |||||||||||||| ||||||  || |||||
Sbjct: 855  atggaaggtttaaagatatatttcaggagaactatgaaacaaaatggagagccaagtttg 914

                                                                        
Query: 892  aggatgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaa 951
            | ||||||||||||||||| |||||| | ||||||||||||||||||||||||||||| |
Sbjct: 915  atgatgcaggaatatggtacgaacatcggctgattgatgatatggtggcctatgccctta 974

                                                                        
Query: 952  agagtgaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatc 1011
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 975  agagtgaaggtggctatgtttgggcttgcaagaactatgatggagatgtgcagagcgatc 1034

                                                                        
Query: 1012 taattgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatg 1071
            ||||||||||||||||||||||| ||||||| |||||||| ||| |||||||||||||||
Sbjct: 1035 taattgctcaaggttttggatcgctaggtctaatgacatcagttctggtgtgccctgatg 1094

                                                                        
Query: 1072 gtagaacagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccacc 1131
            |||||||  |||||||||||||||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1095 gtagaaccattgaagctgaagctgctcatggtacagtcacacgccattacagagttcacc 1154

                                                                        
Query: 1132 aaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggat 1191
            ||||||||||||||||||| ||||| |||||||| ||||| ||||| ||| | || ||| 
Sbjct: 1155 aaaaaggaggcgaaactagtacaaatagcattgcttcaatatttgcttggacaaccggac 1214

                                                                        
Query: 1192 tagcacatagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttg 1251
            ||| ||||||||||||||| |||||||| ||||||||||| |||||   |||||||||||
Sbjct: 1215 taggacatagggcaaagctcgatgacaataaaagactgttagattttgtacaaaaacttg 1274

                                                                        
Query: 1252 aagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctca 1311
            |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||  
Sbjct: 1275 aagctgcttgtgtgggaacagtggaatctggaaagatgacaaaggatctagctcttcttg 1334

                                                                        
Query: 1312 tccatgggccaactgttagtcgtgataagtatctgaacaccatggagttcattgatgcgg 1371
            | |||||||||| |||||| || ||||||||||| |||||  | |||||||| ||||| |
Sbjct: 1335 tacatgggccaaatgttagccgagataagtatcttaacactgttgagttcatcgatgctg 1394

                                                              
Query: 1372 ttgctgaggagttgaggacaagattgtccgcaaaatcaaagttatgaagg 1421
            |||||||||| || || ||||||||||| | || ||| ||||||||||||
Sbjct: 1395 ttgctgaggatttaagaacaagattgtcagtaacatccaagttatgaagg 1444



to top

>dbj|AK072762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023139I05, full
            insert sequence
          Length = 1859

 Score = 1455 bits (734), Expect = 0.0
 Identities = 1121/1250 (89%)
 Strand = Plus / Plus

                                                                        
Query: 172  ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
            ||||||||||||||||||||   || ||||||||| ||||||||||||||||||||||||
Sbjct: 199  ccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtgatgaga 258

                                                                        
Query: 232  tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
            |||| ||| |||| ||||||||||||||||||||||||||||| |||||| ||||| |||
Sbjct: 259  tgactcgagttatttggaaatggatcaaagataagcttatattccctttcttggacttgg 318

                                                                        
Query: 292  acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
            |||||||||||| |||||||||||||||||| ||||||||||||||||| ||||| || |
Sbjct: 319  acataaaatactatgacttaggtctacctaatcgtgacgctactggggacaaagttacaa 378

                                                                        
Query: 352  tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
            |||| ||||||||||| |||||||||||||| || |||||||||||||||||| | || |
Sbjct: 379  tagagagtgcagaagcgaccctaaagtataatgtagccatcaaatgtgcaactataactc 438

                                                                        
Query: 412  cagatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatggga 471
            |||||||||||||||| ||||||||||||||||  || ||||||| ||||||||||||||
Sbjct: 439  cagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatggga 498

                                                                        
Query: 472  caataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttc 531
            ||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 499  caataaggaacattttgaatggaactgttttccgagaaccaatcatctgcaagaatattc 558

                                                                        
Query: 532  ctcggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatc 591
            |||||||||| ||||| |||| ||| ||||||||||||||  ||||||| ||||||||||
Sbjct: 559  ctcggcttgtacctgggtggataaagcccatatgcattggacgacatgcatttggtgatc 618

                                                                        
Query: 592  aataccgagcaacagatataatcattagagggacagggaagctcaagttgatatttgatg 651
            |||||||||||||||||| | | |||| |||  | |||||| | |||||  |||||||||
Sbjct: 619  aataccgagcaacagatacagttattaaaggtcctgggaagttgaagttagtatttgatg 678

                                                                        
Query: 652  gcatagaggaacaaatagagttggatgtgttcaactttagtggtgctggtggagtagcat 711
            ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
Sbjct: 679  gcagagaggaacaaatagagttggatgtgttcaactttactggtgctggtggagtagcct 738

                                                                        
Query: 712  tatctatgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatgg 771
            | ||||||||||| ||||| ||||||||| | ||||| ||||||||||| ||||||||||
Sbjct: 739  tgtctatgtataatactgacgagtctatttgggcattcgctgaagcttccatgaacatgg 798

                                                                        
Query: 772  cttaccagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatg 831
            |||||||||| |||||||||||||||||||| || || ||||| ||||| |||||||| |
Sbjct: 799  cttaccagaaaagatggccactttatcttagcaccaaaaacacgatcctcaaaaaatacg 858

                                                                        
Query: 832  acggaaggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttg 891
            | |||||||||||||| ||||| ||  | |||||||||||||| ||||||  || |||||
Sbjct: 859  atggaaggtttaaagatatatttcaggagaactatgaaacaaaatggagagccaagtttg 918

                                                                        
Query: 892  aggatgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaa 951
            | ||||||||||||||||| |||||| | ||||||||||||||||||||||||||||| |
Sbjct: 919  atgatgcaggaatatggtacgaacatcggctgattgatgatatggtggcctatgccctta 978

                                                                        
Query: 952  agagtgaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatc 1011
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 979  agagtgaaggtggctatgtttgggcttgcaagaactatgatggagatgtgcagagcgatc 1038

                                                                        
Query: 1012 taattgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatg 1071
            ||||||||||||||||||||||| ||||||| |||||||| ||| |||||||||||||||
Sbjct: 1039 taattgctcaaggttttggatcgctaggtctaatgacatcagttctggtgtgccctgatg 1098

                                                                        
Query: 1072 gtagaacagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccacc 1131
            |||||||  |||||||||||||||| || |||||||||||||| ||||||||||| ||||
Sbjct: 1099 gtagaaccattgaagctgaagctgctcatggtacagtcacacgccattacagagttcacc 1158

                                                                        
Query: 1132 aaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggat 1191
            ||||||||||||||||||| ||||| |||||||| ||||| ||||| ||| | || ||| 
Sbjct: 1159 aaaaaggaggcgaaactagtacaaatagcattgcttcaatatttgcttggacaaccggac 1218

                                                                        
Query: 1192 tagcacatagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttg 1251
            ||| ||||||||||||||| |||||||| ||||||||||| |||||   |||||||||||
Sbjct: 1219 taggacatagggcaaagctcgatgacaataaaagactgttagattttgtacaaaaacttg 1278

                                                                        
Query: 1252 aagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctca 1311
            |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||  
Sbjct: 1279 aagctgcttgtgtgggaacagtggaatctggaaagatgacaaaggatctagctcttcttg 1338

                                                                        
Query: 1312 tccatgggccaactgttagtcgtgataagtatctgaacaccatggagttcattgatgcgg 1371
            | |||||||||| |||||| || ||||||||||| |||||  | |||||||| ||||| |
Sbjct: 1339 tacatgggccaaatgttagccgagataagtatcttaacactgttgagttcatcgatgctg 1398

                                                              
Query: 1372 ttgctgaggagttgaggacaagattgtccgcaaaatcaaagttatgaagg 1421
            |||||||||| || || ||||||||||| | || ||| ||||||||||||
Sbjct: 1399 ttgctgaggatttaagaacaagattgtcagtaacatccaagttatgaagg 1448



to top

>dbj|AK240999.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J065053C05, full
            insert sequence
          Length = 4588

 Score = 1162 bits (586), Expect = 0.0
 Identities = 904/1010 (89%)
 Strand = Plus / Plus

                                                                        
Query: 412  cagatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatggga 471
            |||||||||||||||| ||||||||||||||||  || ||||||| ||||||||||||||
Sbjct: 2679 cagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatggga 2738

                                                                        
Query: 472  caataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttc 531
            ||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 2739 caataaggaacattttgaatggaactgttttccgagaaccaatcatctgcaagaatattc 2798

                                                                        
Query: 532  ctcggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatc 591
            |||||||||| ||||| |||| ||| ||||||||||||||  ||||||| ||||||||||
Sbjct: 2799 ctcggcttgtacctgggtggataaagcccatatgcattggacgacatgcatttggtgatc 2858

                                                                        
Query: 592  aataccgagcaacagatataatcattagagggacagggaagctcaagttgatatttgatg 651
            |||||||||||||||||| | | |||| |||  | |||||| | |||||  |||||||||
Sbjct: 2859 aataccgagcaacagatacagttattaaaggtcctgggaagttgaagttagtatttgatg 2918

                                                                        
Query: 652  gcatagaggaacaaatagagttggatgtgttcaactttagtggtgctggtggagtagcat 711
            ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
Sbjct: 2919 gcagagaggaacaaatagagttggatgtgttcaactttactggtgctggtggagtagcct 2978

                                                                        
Query: 712  tatctatgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatgg 771
            | ||||||||||| ||||| ||||||||| | ||||| ||||||||||| ||||||||||
Sbjct: 2979 tgtctatgtataatactgacgagtctatttgggcattcgctgaagcttccatgaacatgg 3038

                                                                        
Query: 772  cttaccagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatg 831
            |||||||||| |||||||||||||||||||| || || ||||| ||||| |||||||| |
Sbjct: 3039 cttaccagaaaagatggccactttatcttagcaccaaaaacacgatcctcaaaaaatacg 3098

                                                                        
Query: 832  acggaaggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttg 891
            | |||||||||||||| ||||| ||  | |||||||||||||| ||||||  || |||||
Sbjct: 3099 atggaaggtttaaagatatatttcaggagaactatgaaacaaaatggagagccaagtttg 3158

                                                                        
Query: 892  aggatgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaa 951
            | ||||||||||||||||| |||||| | ||||||||||||||||||||||||||||| |
Sbjct: 3159 atgatgcaggaatatggtacgaacatcggctgattgatgatatggtggcctatgccctta 3218

                                                                        
Query: 952  agagtgaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatc 1011
            |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 3219 agagtgaaggtggctatgtttgggcttgcaagaactatgatggagatgtgcagagcgatc 3278

                                                                        
Query: 1012 taattgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatg 1071
            ||||||||||||||||||||||| ||||||| |||||||| ||| |||||||||||||||
Sbjct: 3279 taattgctcaaggttttggatcgctaggtctaatgacatcagttctggtgtgccctgatg 3338

                                                                        
Query: 1072 gtagaacagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccacc 1131
            |||||||  |||||||||||||||| || |||||||||||||| ||||||||||| ||||
Sbjct: 3339 gtagaaccattgaagctgaagctgctcatggtacagtcacacgccattacagagttcacc 3398

                                                                        
Query: 1132 aaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggat 1191
            ||||||||||||||||||| ||||| |||||||| ||||| ||||| ||| | || ||| 
Sbjct: 3399 aaaaaggaggcgaaactagtacaaatagcattgcttcaatatttgcttggacaaccggac 3458

                                                                        
Query: 1192 tagcacatagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttg 1251
            ||| ||||||||||||||| |||||||| ||||||||||| |||||   |||||||||||
Sbjct: 3459 taggacatagggcaaagctcgatgacaataaaagactgttagattttgtacaaaaacttg 3518

                                                                        
Query: 1252 aagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctca 1311
            |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||  
Sbjct: 3519 aagctgcttgtgtgggaacagtggaatctggaaagatgacaaaggatctagctcttcttg 3578

                                                                        
Query: 1312 tccatgggccaactgttagtcgtgataagtatctgaacaccatggagttcattgatgcgg 1371
            | |||||||||| |||||| || ||||||||||| |||||  | |||||||| ||||| |
Sbjct: 3579 tacatgggccaaatgttagccgagataagtatcttaacactgttgagttcatcgatgctg 3638

                                                              
Query: 1372 ttgctgaggagttgaggacaagattgtccgcaaaatcaaagttatgaagg 1421
            |||||||||| || || ||||||||||| | || ||| ||||||||||||
Sbjct: 3639 ttgctgaggatttaagaacaagattgtcagtaacatccaagttatgaagg 3688



 Score =  270 bits (136), Expect = 2e-68
 Identities = 190/208 (91%)
 Strand = Plus / Plus

                                                                        
Query: 172  ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
            ||||||||||||||||||||   || ||||||||| ||||||||||||||||||||||||
Sbjct: 2320 ccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtgatgaga 2379

                                                                        
Query: 232  tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
            |||| ||| |||| ||||||||||||||||||||||||||||| |||||| ||||| |||
Sbjct: 2380 tgactcgagttatttggaaatggatcaaagataagcttatattccctttcttggacttgg 2439

                                                                        
Query: 292  acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
            |||||||||||| |||||||||||||||||| ||||||||||||||||| ||||| || |
Sbjct: 2440 acataaaatactatgacttaggtctacctaatcgtgacgctactggggacaaagttacaa 2499

                                        
Query: 352  tagaaagtgcagaagctaccctaaagta 379
            |||| ||||||||||| |||||||||||
Sbjct: 2500 tagagagtgcagaagcgaccctaaagta 2527



 Score =  105 bits (53), Expect = 7e-19
 Identities = 83/93 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1887 gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
            |||||| |||||| ||||||||| || |||||||| ||||||||||||||||||||||  
Sbjct: 4209 gcagcagcaggcgtgctcaagaagctcgcgaggaaattgccgcgctcgtagaagtactcc 4268

                                             
Query: 1947 gccttctccaccttcatctcctcatcaacctaa 1979
            | ||||||||||||||||||||| || ||||||
Sbjct: 4269 gtcttctccaccttcatctcctcgtcgacctaa 4301



to top

>ref|NM_001050284.1| Oryza sativa (japonica cultivar-group) Os01g0654500 (Os01g0654500)
            mRNA, complete cds
          Length = 1686

 Score =  327 bits (165), Expect = 1e-85
 Identities = 519/637 (81%)
 Strand = Plus / Plus

                                                                        
Query: 673  tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
            |||| ||||||||||| | ||||||||| ||||| || || |||||||| ||||||||||
Sbjct: 586  tggaggtgttcaacttcactggtgctggaggagttgctttgtctatgtacaacactgatg 645

                                                                        
Query: 733  agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
            |||| || ||||| |||||||||||||| ||||  |  |||||  |||||| |||||| |
Sbjct: 646  agtcaatccgagcttttgctgaagcttctatgacaactgcttatgagaagaaatggccgc 705

                                                                        
Query: 793  tttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatat 852
            |||||||||| || || |||||||||||||| |||||||| |||||||| || || || |
Sbjct: 706  tttatcttagcaccaaaaacacaatcctgaagaaatatgatggaaggttcaaggatattt 765

                                                                        
Query: 853  tccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatg 912
            ||||  |   ||||||| |    |||| || || |||||||| ||| |||||||||||||
Sbjct: 766  tccaggaggtctatgaagctgggtggaaatccaagtttgaggctgccggaatatggtatg 825

                                                                        
Query: 913  aacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgttt 972
            | ||| | || || ||||| ||||| || ||||| || ||||||||||| |||||||| |
Sbjct: 826  agcatcgtctcatcgatgacatggttgcttatgcacttaagagtgaagggggctatgtgt 885

                                                                        
Query: 973  gggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttttggat 1032
            |||||||||||||||| ||||||||||||||||| ||| |  | |||||||| ||||| |
Sbjct: 886  gggcttgcaagaattacgatggagatgtgcagagtgatttcttagctcaaggctttggtt 945

                                                                        
Query: 1033 cgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagctgaag 1092
            | || ||| | |||||||| || ||||||||||||||||| | |||| ||||||||||||
Sbjct: 946  cattgggtttgatgacatcagtattggtgtgccctgatggaaaaacaattgaagctgaag 1005

                                                                        
Query: 1093 ctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagca 1152
            |||| || || || || || || |||| | | || ||||| || ||||| ||||| ||||
Sbjct: 1006 ctgcccatggcacggttacccgtcatttccgtgttcaccagaagggaggtgaaaccagca 1065

                                                                        
Query: 1153 caaacagcattgcgtcaatctttgcatggtctactggattagcacatagggcaaagctgg 1212
            ||||||||||||| ||||||||||| ||| | |  ||| | ||||| ||||||||||| |
Sbjct: 1066 caaacagcattgcttcaatctttgcttggaccagaggacttgcacacagggcaaagcttg 1125

                                                                        
Query: 1213 atgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtggggacag 1272
            | |||||    |||||  | || ||  ||| |||||||||||||||||| || || || |
Sbjct: 1126 acgacaatgctagacttcttgactttgcactaaaacttgaagctgcttgcgttggaaccg 1185

                                                 
Query: 1273 tggaatctggaaagatgacaaaggacctagctcttct 1309
            |||||||||| |||||||| || ||||| ||||||||
Sbjct: 1186 tggaatctgggaagatgaccaaagaccttgctcttct 1222



 Score =  111 bits (56), Expect = 1e-20
 Identities = 62/64 (96%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||
Sbjct: 85  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 144

               
Query: 232 tgac 235
           ||||
Sbjct: 145 tgac 148



 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 128/155 (82%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| ||| || ||||| ||||| ||||| ||  | ||||| ||||| ||| |||| 
Sbjct: 363 atgtggaagagccccaatggcacaattaggaatattatcaatggcactgtattcagagag 422

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| || ||||| ||||| ||  ||||||| || |||||||| || ||||| ||||||
Sbjct: 423 ccaattatatgcaaaaatgtcccaaggcttgttccaggatggactaagcccatttgcatt 482

                                              
Query: 570 ggcagacatgcttttggtgatcaataccgagcaac 604
           || || ||||||||||||||||| |||||||||||
Sbjct: 483 ggaaggcatgcttttggtgatcagtaccgagcaac 517



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1356 gagttcattgatgcggttgctgaggag 1382
            |||||||||||||||||||||| ||||
Sbjct: 1272 gagttcattgatgcggttgctgcggag 1298



to top

>dbj|AK061752.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-H06, full
            insert sequence
          Length = 1686

 Score =  327 bits (165), Expect = 1e-85
 Identities = 519/637 (81%)
 Strand = Plus / Plus

                                                                        
Query: 673  tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
            |||| ||||||||||| | ||||||||| ||||| || || |||||||| ||||||||||
Sbjct: 586  tggaggtgttcaacttcactggtgctggaggagttgctttgtctatgtacaacactgatg 645

                                                                        
Query: 733  agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
            |||| || ||||| |||||||||||||| ||||  |  |||||  |||||| |||||| |
Sbjct: 646  agtcaatccgagcttttgctgaagcttctatgacaactgcttatgagaagaaatggccgc 705

                                                                        
Query: 793  tttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatat 852
            |||||||||| || || |||||||||||||| |||||||| |||||||| || || || |
Sbjct: 706  tttatcttagcaccaaaaacacaatcctgaagaaatatgatggaaggttcaaggatattt 765

                                                                        
Query: 853  tccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatg 912
            ||||  |   ||||||| |    |||| || || |||||||| ||| |||||||||||||
Sbjct: 766  tccaggaggtctatgaagctgggtggaaatccaagtttgaggctgccggaatatggtatg 825

                                                                        
Query: 913  aacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgttt 972
            | ||| | || || ||||| ||||| || ||||| || ||||||||||| |||||||| |
Sbjct: 826  agcatcgtctcatcgatgacatggttgcttatgcacttaagagtgaagggggctatgtgt 885

                                                                        
Query: 973  gggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttttggat 1032
            |||||||||||||||| ||||||||||||||||| ||| |  | |||||||| ||||| |
Sbjct: 886  gggcttgcaagaattacgatggagatgtgcagagtgatttcttagctcaaggctttggtt 945

                                                                        
Query: 1033 cgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagctgaag 1092
            | || ||| | |||||||| || ||||||||||||||||| | |||| ||||||||||||
Sbjct: 946  cattgggtttgatgacatcagtattggtgtgccctgatggaaaaacaattgaagctgaag 1005

                                                                        
Query: 1093 ctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagca 1152
            |||| || || || || || || |||| | | || ||||| || ||||| ||||| ||||
Sbjct: 1006 ctgcccatggcacggttacccgtcatttccgtgttcaccagaagggaggtgaaaccagca 1065

                                                                        
Query: 1153 caaacagcattgcgtcaatctttgcatggtctactggattagcacatagggcaaagctgg 1212
            ||||||||||||| ||||||||||| ||| | |  ||| | ||||| ||||||||||| |
Sbjct: 1066 caaacagcattgcttcaatctttgcttggaccagaggacttgcacacagggcaaagcttg 1125

                                                                        
Query: 1213 atgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtggggacag 1272
            | |||||    |||||  | || ||  ||| |||||||||||||||||| || || || |
Sbjct: 1126 acgacaatgctagacttcttgactttgcactaaaacttgaagctgcttgcgttggaaccg 1185

                                                 
Query: 1273 tggaatctggaaagatgacaaaggacctagctcttct 1309
            |||||||||| |||||||| || ||||| ||||||||
Sbjct: 1186 tggaatctgggaagatgaccaaagaccttgctcttct 1222



 Score =  111 bits (56), Expect = 1e-20
 Identities = 62/64 (96%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||
Sbjct: 85  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 144

               
Query: 232 tgac 235
           ||||
Sbjct: 145 tgac 148



 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 128/155 (82%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| ||| || ||||| ||||| ||||| ||  | ||||| ||||| ||| |||| 
Sbjct: 363 atgtggaagagccccaatggcacaattaggaatattatcaatggcactgtattcagagag 422

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| || ||||| ||||| ||  ||||||| || |||||||| || ||||| ||||||
Sbjct: 423 ccaattatatgcaaaaatgtcccaaggcttgttccaggatggactaagcccatttgcatt 482

                                              
Query: 570 ggcagacatgcttttggtgatcaataccgagcaac 604
           || || ||||||||||||||||| |||||||||||
Sbjct: 483 ggaaggcatgcttttggtgatcagtaccgagcaac 517



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1356 gagttcattgatgcggttgctgaggag 1382
            |||||||||||||||||||||| ||||
Sbjct: 1272 gagttcattgatgcggttgctgcggag 1298



to top

>gb|AF155333.2|AF155333 Oryza sativa NADP-specific isocitrate dehydrogenase mRNA, complete
            cds
          Length = 1594

 Score =  327 bits (165), Expect = 1e-85
 Identities = 519/637 (81%)
 Strand = Plus / Plus

                                                                        
Query: 673  tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
            |||| ||||||||||| | ||||||||| ||||| || || |||||||| ||||||||||
Sbjct: 565  tggaggtgttcaacttcactggtgctggaggagttgctttgtctatgtacaacactgatg 624

                                                                        
Query: 733  agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
            |||| || ||||| |||||||||||||| ||||  |  |||||  |||||| |||||| |
Sbjct: 625  agtcaatccgagcttttgctgaagcttctatgacaactgcttatgagaagaaatggccgc 684

                                                                        
Query: 793  tttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatat 852
            |||||||||| || || |||||||||||||| |||||||| |||||||| || || || |
Sbjct: 685  tttatcttagcaccaaaaacacaatcctgaagaaatatgatggaaggttcaaggatattt 744

                                                                        
Query: 853  tccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatg 912
            ||||  |   ||||||| |    |||| || || |||||||| ||| |||||||||||||
Sbjct: 745  tccaggaggtctatgaagctgggtggaaatccaagtttgaggctgccggaatatggtatg 804

                                                                        
Query: 913  aacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgttt 972
            | ||| | || || ||||| ||||| || ||||| || ||||||||||| |||||||| |
Sbjct: 805  agcatcgtctcatcgatgacatggttgcttatgcacttaagagtgaagggggctatgtgt 864

                                                                        
Query: 973  gggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttttggat 1032
            |||||||||||||||| ||||||||||||||||| ||| |  | |||||||| ||||| |
Sbjct: 865  gggcttgcaagaattacgatggagatgtgcagagtgatttcttagctcaaggctttggtt 924

                                                                        
Query: 1033 cgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagctgaag 1092
            | || ||| | |||||||| || ||||||||||||||||| | |||| ||||||||||||
Sbjct: 925  cattgggtttgatgacatcagtattggtgtgccctgatggaaaaacaattgaagctgaag 984

                                                                        
Query: 1093 ctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagca 1152
            |||| || || || || || || |||| | | || ||||| || ||||| ||||| ||||
Sbjct: 985  ctgcccatggcacggttacccgtcatttccgtgttcaccagaagggaggtgaaaccagca 1044

                                                                        
Query: 1153 caaacagcattgcgtcaatctttgcatggtctactggattagcacatagggcaaagctgg 1212
            ||||||||||||| ||||||||||| ||| | |  ||| | ||||| ||||||||||| |
Sbjct: 1045 caaacagcattgcttcaatctttgcttggaccagaggacttgcacacagggcaaagcttg 1104

                                                                        
Query: 1213 atgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtggggacag 1272
            | |||||    |||||  | || ||  ||| |||||||||||||||||| || || || |
Sbjct: 1105 acgacaatgctagacttcttgactttgcactaaaacttgaagctgcttgcgttggaaccg 1164

                                                 
Query: 1273 tggaatctggaaagatgacaaaggacctagctcttct 1309
            |||||||||| |||||||| || ||||| ||||||||
Sbjct: 1165 tggaatctgggaagatgaccaaagaccttgctcttct 1201



 Score =  111 bits (56), Expect = 1e-20
 Identities = 62/64 (96%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||
Sbjct: 64  ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggtgatgaga 123

               
Query: 232 tgac 235
           ||||
Sbjct: 124 tgac 127



 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 128/155 (82%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| ||| || ||||| ||||| ||||| ||  | ||||| ||||| ||| |||| 
Sbjct: 342 atgtggaagagccccaatggcacaattaggaatattatcaatggcactgtattcagagag 401

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| || ||||| ||||| ||  ||||||| || |||||||| || ||||| ||||||
Sbjct: 402 ccaattatatgcaaaaatgtcccaaggcttgttccaggatggactaagcccatttgcatt 461

                                              
Query: 570 ggcagacatgcttttggtgatcaataccgagcaac 604
           || || ||||||||||||||||| |||||||||||
Sbjct: 462 ggaaggcatgcttttggtgatcagtaccgagcaac 496



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1356 gagttcattgatgcggttgctgaggag 1382
            |||||||||||||||||||||| ||||
Sbjct: 1251 gagttcattgatgcggttgctgcggag 1277



to top

>emb|CT832096.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN039P11, full
            insert sequence
          Length = 1353

 Score =  274 bits (138), Expect = 1e-69
 Identities = 183/198 (92%)
 Strand = Plus / Plus

                                                                        
Query: 412  cagatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatggga 471
            |||||||||||||||| ||||||||||||||||  || ||||||| ||||||||||||||
Sbjct: 939  cagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatggga 998

                                                                        
Query: 472  caataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttc 531
            ||||||||||||| || ||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 999  caataaggaacattttgaatggaactgttttccgagaaccaatcatctgcaagaatattc 1058

                                                                        
Query: 532  ctcggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatc 591
            |||||||||| ||||| |||| ||| ||||||||||||||  ||||||| ||||||||||
Sbjct: 1059 ctcggcttgtacctgggtggataaagcccatatgcattggacgacatgcatttggtgatc 1118

                              
Query: 592  aataccgagcaacagata 609
            ||||||||||||||||||
Sbjct: 1119 aataccgagcaacagata 1136



 Score =  149 bits (75), Expect = 5e-32
 Identities = 105/115 (91%)
 Strand = Plus / Plus

                                                                       
Query: 265 agcttatatttcctttcctggacctggacataaaatactttgacttaggtctacctaacc 324
           |||||||||| |||||| ||||| ||||||||||||||| |||||||||||||||||| |
Sbjct: 463 agcttatattccctttcttggacttggacataaaatactatgacttaggtctacctaatc 522

                                                                  
Query: 325 gtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagta 379
           |||||||||||||||| ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 523 gtgacgctactggggacaaagttacaatagagagtgcagaagcgaccctaaagta 577



 Score =  125 bits (63), Expect = 7e-25
 Identities = 87/95 (91%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           ||||||||||||||||||||   || ||||||||| ||||||||||||||||||||||||
Sbjct: 176 ccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtgatgaga 235

                                              
Query: 232 tgacacgaattatatggaaatggatcaaagataag 266
           |||| ||| |||| |||||||||||||||||||||
Sbjct: 236 tgactcgagttatttggaaatggatcaaagataag 270



to top

>emb|X77944.1|NTNIDH N.tabacum (Xanthi) NADP-dependent Isocitrate dehydrogenase mRNA
          Length = 1584

 Score =  270 bits (136), Expect = 2e-68
 Identities = 427/524 (81%)
 Strand = Plus / Plus

                                                                        
Query: 683  caactttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcg 742
            |||||||| |||||||||||||||||| ||||| ||||| ||||| ||||||||  | ||
Sbjct: 600  caactttactggtgctggtggagtagctttatccatgtacaacacagatgagtccgtccg 659

                                                                        
Query: 743  agcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttag 802
              |||||||||| ||||| ||||||||||| ||||| |||| ||||||||| ||||||||
Sbjct: 660  ctcatttgctgaggcttcaatgaacatggcataccaaaagaaatggccactctatcttag 719

                                                                        
Query: 803  tacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaa 862
            ||| ||||| || || || || |||||||| || |||||||| ||||| |||||| ||  
Sbjct: 720  tacaaagaatactattcttaagaaatatgatgggaggtttaaggacatcttccaagaagt 779

                                                                        
Query: 863  ctatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatgaacatagact 922
             |||||| |||||||||  | || || |||||| |||||||| |||||||||||  | ||
Sbjct: 780  ttatgaagcaaattggaagtccaagtatgaggaagcaggaatttggtatgaacaccgtct 839

                                                                        
Query: 923  gattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaa 982
             || || |||||||  || |||||  |||||||||||||||| ||||| ||||| |||||
Sbjct: 840  tatcgacgatatggctgcttatgctttaaagagtgaaggtggttatgtatgggcctgcaa 899

                                                                        
Query: 983  gaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtct 1042
            ||| |||||||| ||||| ||||| ||| |  | || |||||||||||||| || ||  |
Sbjct: 900  gaactatgatggggatgtacagagtgatttcttagcacaaggttttggatccttgggctt 959

                                                                        
Query: 1043 catgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacgg 1102
             |||||||| ||  ||||||| |||||||| |  ||  |||| |||||||| || || ||
Sbjct: 960  gatgacatctgtcctggtgtgtcctgatggcaagaccattgaggctgaagcagcccatgg 1019

                                                                        
Query: 1103 tacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcat 1162
             || ||||| || || ||||| || ||||| |||||||| ||||| ||||||||||| ||
Sbjct: 1020 aactgtcacccgccactacagggttcaccagaaaggaggtgaaaccagcacaaacagtat 1079

                                                        
Query: 1163 tgcgtcaatctttgcatggtctactggattagcacatagggcaa 1206
            ||||||||||||||| ||| ||  |||| | ||||| |||||||
Sbjct: 1080 tgcgtcaatctttgcctggactcgtggacttgcacacagggcaa 1123



 Score =  153 bits (77), Expect = 3e-33
 Identities = 149/173 (86%)
 Strand = Plus / Plus

                                                                       
Query: 426 gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataaggaacatc 485
           |||||||||||||| || ||| | ||||||||||| |||||||||||||| || ||||||
Sbjct: 337 gtaaaagagtttaacttgaaatccatgtggaggagcccaaatgggacaattagaaacatc 396

                                                                       
Query: 486 ttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcct 545
            |||||||||| || ||| |||||||||| || ||||| ||| |||| || ||||| || 
Sbjct: 397 ctaaatggaacggtcttcagagaaccaattatgtgcaaaaatattccccgacttgtccca 456

                                                                
Query: 546 ggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccg 598
           || ||||| ||||| ||||||||||| |||||||||||||| |||||||||||
Sbjct: 457 ggttggactaaaccaatatgcattggtagacatgcttttggagatcaataccg 509



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 107/129 (82%)
 Strand = Plus / Plus

                                                                       
Query: 180 ttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgacacga 239
           ||||| || ||| ||||||  ||||| ||||| ||||||||||| ||||| ||||| || 
Sbjct: 91  ttcgacaaaatcaaggttgaaaaccctatcgttgagatggacggagatgaaatgactcgt 150

                                                                       
Query: 240 attatatggaaatggatcaaagataagcttatatttcctttcctggacctggacataaaa 299
            |||| ||||||| |||||| |||||||| || | |||||| |||||  |||| ||||||
Sbjct: 151 gttatttggaaatcgatcaaggataagctcatctgtccttttctggagttggatataaaa 210

                    
Query: 300 tactttgac 308
           |||||||||
Sbjct: 211 tactttgac 219



to top

>gb|AY105031.1| Zea mays PCO072845 mRNA sequence
          Length = 1614

 Score =  264 bits (133), Expect = 1e-66
 Identities = 409/501 (81%)
 Strand = Plus / Plus

                                                                        
Query: 681  ttcaactttagtggtgctggtggagtagcattatctatgtataacactgatgagtctatt 740
            |||||||| | ||||||||| ||||| || || |||||||| ||||| || ||||| || 
Sbjct: 605  ttcaacttcactggtgctggaggagttgccttgtctatgtacaacaccgacgagtcaatc 664

                                                                        
Query: 741  cgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatctt 800
            ||||| |||||||| ||||| ||||  |  |||||  |||||| ||||||||| || |||
Sbjct: 665  cgagcttttgctgaggcttctatgacaactgcttatgagaagaaatggccactctacctt 724

                                                                        
Query: 801  agtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaa 860
            || || || ||||||||||||||||||||||| || |||||||| ||||| |||||  | 
Sbjct: 725  agcaccaaaaacacaatcctgaaaaaatatgatggcaggtttaaggacattttccaggag 784

                                                                        
Query: 861  aactatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatgaacataga 920
              ||||||| |  | ||||  | ||  ||||||| ||| |||||||||||||| ||| | 
Sbjct: 785  gtctatgaagctgactggaagtccaaatttgaggctgctggaatatggtatgagcatcgt 844

                                                                        
Query: 921  ctgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgc 980
            || |||||||| ||||| || || || || ||||| ||||| |||||||| |||||||||
Sbjct: 845  cttattgatgacatggttgcgtacgcgcttaagagcgaaggaggctatgtgtgggcttgc 904

                                                                        
Query: 981  aagaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggt 1040
            ||||| || ||||||||||||||||| ||| |  | ||||||||||||||||| || |||
Sbjct: 905  aagaactacgatggagatgtgcagagtgatttcttagctcaaggttttggatctttgggt 964

                                                                        
Query: 1041 ctcatgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacac 1100
             | |||||||| || ||||||||||||||||| | |||  | |||||||||||||| || 
Sbjct: 965  ttgatgacatcagtgttggtgtgccctgatggaaaaaccatcgaagctgaagctgcccat 1024

                                                                        
Query: 1101 ggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagc 1160
            || || || || || |||| | | |||||||| |||||||||||||| ||||| ||||||
Sbjct: 1025 gggacggttacccgtcatttccgtgtccaccagaaaggaggcgaaaccagcacgaacagc 1084

                                 
Query: 1161 attgcgtcaatctttgcatgg 1181
            ||||| || ||||||||||||
Sbjct: 1085 attgcttcgatctttgcatgg 1105



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 60/64 (93%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||||||||||||| ||||  ||||||| |||||||||||||||||||||||||
Sbjct: 96  ccatggcgttcgagaagatcaaggtctccaacccaatcgtcgagatggacggtgatgaga 155

               
Query: 232 tgac 235
           ||||
Sbjct: 156 tgac 159



 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 125/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| ||| |||||||| ||||| ||||||||  ||||||| ||||| ||| |||| 
Sbjct: 374 atgtggaagagcccaaatggcacaattaggaacattataaatggcactgtgttcagagag 433

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || || || ||||| || |||||  | ||||| || |||||||| || ||||| ||||||
Sbjct: 434 cctattatatgcaaaaacgttccaagacttgttccaggatggactaagcccatctgcatt 493

                                           
Query: 570 ggcagacatgcttttggtgatcaataccgagc 601
           || || ||||| || |||||||||||||||||
Sbjct: 494 ggaaggcatgccttcggtgatcaataccgagc 525



to top

>gb|BT019016.1| Zea mays clone Contig512.F mRNA sequence
          Length = 1390

 Score =  248 bits (125), Expect = 7e-62
 Identities = 407/501 (81%)
 Strand = Plus / Plus

                                                                        
Query: 681  ttcaactttagtggtgctggtggagtagcattatctatgtataacactgatgagtctatt 740
            |||||||| | ||||||||| ||||| || || |||||||| |||||||| ||||| || 
Sbjct: 424  ttcaacttcactggtgctggaggagttgccttgtctatgtacaacactgacgagtcaatc 483

                                                                        
Query: 741  cgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatctt 800
            ||||| ||||| || ||||| ||||  |  |||||  |||||| |||||| || || |||
Sbjct: 484  cgagcttttgccgaggcttctatgacaactgcttatgagaagaaatggccgctctacctt 543

                                                                        
Query: 801  agtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaa 860
            || || || ||||||||||||||||||||||| || |||||||| ||||| |||||  | 
Sbjct: 544  agcaccaaaaacacaatcctgaaaaaatatgatggcaggtttaaggacattttccaggag 603

                                                                        
Query: 861  aactatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatgaacataga 920
              ||||||| |  | ||||  | ||  ||||||| ||| |||||||||||||| ||| | 
Sbjct: 604  gtctatgaagctgactggaagtccaaatttgaggctgctggaatatggtatgagcatcgt 663

                                                                        
Query: 921  ctgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgc 980
            || |||||||| ||||| || || || || ||||| ||||| |||||||| |||||||||
Sbjct: 664  cttattgatgacatggttgcgtacgcgcttaagagcgaaggaggctatgtgtgggcttgc 723

                                                                        
Query: 981  aagaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggt 1040
            ||||| || ||||||||||||||||| ||| |  | |||||||||||||| || || |||
Sbjct: 724  aagaactacgatggagatgtgcagagtgatttcttagctcaaggttttgggtctttgggt 783

                                                                        
Query: 1041 ctcatgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacac 1100
             | |||||||| || ||||||||||||||||| | |||  | |||||||||||||| || 
Sbjct: 784  ttgatgacatcagtgttggtgtgccctgatggaaaaaccatcgaagctgaagctgcccat 843

                                                                        
Query: 1101 ggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagc 1160
            || || || || || |||| | | |||||||| |||||||||||||| ||||| ||||||
Sbjct: 844  ggcacggttacccgtcatttccgtgtccaccagaaaggaggcgaaaccagcacgaacagc 903

                                 
Query: 1161 attgcgtcaatctttgcatgg 1181
            ||||| || ||||||||||||
Sbjct: 904  attgcttcgatctttgcatgg 924



 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 125/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| ||| |||||||| ||||| ||||||||  ||||||| ||||| ||| |||| 
Sbjct: 193 atgtggaagagcccaaatggcacaattaggaacattataaatggcactgtgttcagagag 252

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || || || ||||| || |||||  | ||||| || |||||||| || ||||| ||||||
Sbjct: 253 cctattatatgcaaaaacgttccaagacttgttccaggatggactaagcccatctgcatt 312

                                           
Query: 570 ggcagacatgcttttggtgatcaataccgagc 601
           || || ||||| || |||||||||||||||||
Sbjct: 313 ggaaggcatgccttcggtgatcaataccgagc 344



to top

>ref|NM_001062916.1| Oryza sativa (japonica cultivar-group) Os05g0573200 (Os05g0573200)
            mRNA, complete cds
          Length = 1503

 Score =  246 bits (124), Expect = 3e-61
 Identities = 280/332 (84%)
 Strand = Plus / Plus

                                                                        
Query: 888  tttgaggatgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgcc 947
            ||||||| ||| |||||||||||||| ||| | || |||||||| ||||| |||||||| 
Sbjct: 798  tttgaggctgctggaatatggtatgagcatcgtctcattgatgacatggttgcctatgca 857

                                                                        
Query: 948  ctaaagagtgaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagc 1007
            || ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| 
Sbjct: 858  ctcaagagtgaaggaggctatgtttgggcttgcaagaactatgatggagatgtgcagagt 917

                                                                        
Query: 1008 gatctaattgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccct 1067
            ||| |  | || |||||||||||||| || ||| | |||||||| |||||||| || |||
Sbjct: 918  gatttcttagcacaaggttttggatcattgggtttgatgacatcagttttggtatgtcct 977

                                                                        
Query: 1068 gatggtagaacagttgaagctgaagctgcacacggtacagtcacacgacattacagagtc 1127
            ||||| | |||  |||||||||||||||| || || || ||||| || |||||| | || 
Sbjct: 978  gatgggaaaaccattgaagctgaagctgcccatgggactgtcacccgtcattaccgtgtt 1037

                                                                        
Query: 1128 caccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctact 1187
            || || ||||| || ||||||||||||||||||||||| ||||||||||| ||| | |  
Sbjct: 1038 catcagaaaggtggtgaaactagcacaaacagcattgcctcaatctttgcctggacaaga 1097

                                            
Query: 1188 ggattagcacatagggcaaagctggatgacaa 1219
            ||| | ||||| ||||||||||| ||||||||
Sbjct: 1098 ggacttgcacacagggcaaagctagatgacaa 1129



 Score =  121 bits (61), Expect = 1e-23
 Identities = 199/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 gcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccccagatgaa 419
           ||||| |||||||| ||||| || ||||||||||| ||||||||  | || |||||||||
Sbjct: 270 gcagaggctaccctcaagtacaatgtggccatcaagtgtgcaaccattacaccagatgaa 329

                                                                       
Query: 420 ggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataagg 479
           | | | || |||||||| |   ||||| | ||||||| ||| ||||| || ||||| || 
Sbjct: 330 gcaagggttaaagagttcagcctaaaatccatgtggaagagcccaaacggcacaattaga 389

                                                                       
Query: 480 aacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcctcggctt 539
           || ||| ||||||| ||||| ||| |||||||||| |||||||| ||  | |||||||||
Sbjct: 390 aatatcctaaatggcactgtgttcagagaaccaataatctgcaaaaacatccctcggctt 449

                                                                       
Query: 540 gtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccga 599
           || || |||||||| || ||||| |||||||| || || || ||||||||||| ||||| 
Sbjct: 450 gttccaggatggactaagcccatttgcattggaaggcacgcatttggtgatcagtaccgt 509

                
Query: 600 gcaac 604
           |||||
Sbjct: 510 gcaac 514



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 186 aagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgacacgaattata 245
           |||||| |||| ||||||||||| |||||||||||||||||||||||||| ||| |  | 
Sbjct: 96  aagatcaaggtcgccaaccccattgtcgagatggacggtgatgagatgactcgagtattc 155

                                                                       
Query: 246 tggaaatggatcaaagataagcttatatttcctttcctggacctggacataaaatacttt 305
           |||||||  ||||| || |||||||| || || ||| ||||  ||||||| || ||||||
Sbjct: 156 tggaaatctatcaaggacaagcttatcttcccgttcttggagttggacattaagtacttt 215

             
Query: 306 ga 307
           ||
Sbjct: 216 ga 217



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 673 tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
           |||| ||||||||||| | ||||||||| ||||| |||   |||||||| |||||||| |
Sbjct: 583 tggaggtgttcaacttcactggtgctggaggagtggcacagtctatgtacaacactgacg 642

               
Query: 733 agtc 736
           ||||
Sbjct: 643 agtc 646



to top

>gb|AF155334.1|AF155334 Oryza sativa NADP-specific isocitrate dehydrogenase mRNA, complete
            cds
          Length = 1503

 Score =  246 bits (124), Expect = 3e-61
 Identities = 280/332 (84%)
 Strand = Plus / Plus

                                                                        
Query: 888  tttgaggatgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgcc 947
            ||||||| ||| |||||||||||||| ||| | || |||||||| ||||| |||||||| 
Sbjct: 798  tttgaggctgctggaatatggtatgagcatcgtctcattgatgacatggttgcctatgca 857

                                                                        
Query: 948  ctaaagagtgaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagc 1007
            || ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| 
Sbjct: 858  ctcaagagtgaaggaggctatgtttgggcttgcaagaactatgatggagatgtgcagagt 917

                                                                        
Query: 1008 gatctaattgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccct 1067
            ||| |  | || |||||||||||||| || ||| | |||||||| |||||||| || |||
Sbjct: 918  gatttcttagcacaaggttttggatcattgggtttgatgacatcagttttggtatgtcct 977

                                                                        
Query: 1068 gatggtagaacagttgaagctgaagctgcacacggtacagtcacacgacattacagagtc 1127
            ||||| | |||  |||||||||||||||| || || || ||||| || |||||| | || 
Sbjct: 978  gatgggaaaaccattgaagctgaagctgcccatgggactgtcacccgtcattaccgtgtt 1037

                                                                        
Query: 1128 caccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctact 1187
            || || ||||| || ||||||||||||||||||||||| ||||||||||| ||| | |  
Sbjct: 1038 catcagaaaggtggtgaaactagcacaaacagcattgcctcaatctttgcctggacaaga 1097

                                            
Query: 1188 ggattagcacatagggcaaagctggatgacaa 1219
            ||| | ||||| ||||||||||| ||||||||
Sbjct: 1098 ggacttgcacacagggcaaagctagatgacaa 1129



 Score =  121 bits (61), Expect = 1e-23
 Identities = 199/245 (81%)
 Strand = Plus / Plus

                                                                       
Query: 360 gcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccccagatgaa 419
           ||||| |||||||| ||||| || ||||||||||| ||||||||  | || |||||||||
Sbjct: 270 gcagaggctaccctcaagtacaatgtggccatcaagtgtgcaaccattacaccagatgaa 329

                                                                       
Query: 420 ggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataagg 479
           | | | || |||||||| |   ||||| | ||||||| ||| ||||| || ||||| || 
Sbjct: 330 gcaagggttaaagagttcagcctaaaatccatgtggaagagcccaaacggcacaattaga 389

                                                                       
Query: 480 aacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcctcggctt 539
           || ||| ||||||| ||||| ||| |||||||||| |||||||| ||  | |||||||||
Sbjct: 390 aatatcctaaatggcactgtgttcagagaaccaataatctgcaaaaacatccctcggctt 449

                                                                       
Query: 540 gtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccga 599
           || || |||||||| || ||||| |||||||| || || || ||||||||||| ||||| 
Sbjct: 450 gttccaggatggactaagcccatttgcattggaaggcacgcatttggtgatcagtaccgt 509

                
Query: 600 gcaac 604
           |||||
Sbjct: 510 gcaac 514



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 102/122 (83%)
 Strand = Plus / Plus

                                                                       
Query: 186 aagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgacacgaattata 245
           |||||| |||| ||||||||||| |||||||||||||||||||||||||| ||| |  | 
Sbjct: 96  aagatcaaggtcgccaaccccattgtcgagatggacggtgatgagatgactcgagtattc 155

                                                                       
Query: 246 tggaaatggatcaaagataagcttatatttcctttcctggacctggacataaaatacttt 305
           |||||||  ||||| || |||||||| || || ||| ||||  ||||||| || ||||||
Sbjct: 156 tggaaatctatcaaggacaagcttatcttcccgttcttggagttggacattaagtacttt 215

             
Query: 306 ga 307
           ||
Sbjct: 216 ga 217



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                       
Query: 673 tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
           |||| ||||||||||| | ||||||||| ||||| |||   |||||||| |||||||| |
Sbjct: 583 tggaggtgttcaacttcactggtgctggaggagtggcacagtctatgtacaacactgacg 642

               
Query: 733 agtc 736
           ||||
Sbjct: 643 agtc 646



to top

>gb|AF176669.1|AF176669 Citrus limon NADP-isocitrate dehydrogenase mRNA, complete cds
          Length = 1708

 Score =  218 bits (110), Expect = 6e-53
 Identities = 347/426 (81%)
 Strand = Plus / Plus

                                                                       
Query: 184 agaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgacacgaatta 243
           |||||||| |||| ||||| |||||||| || |||||||| ||||| ||||| ||| || 
Sbjct: 165 agaagatcaaggtcgccaatcccatcgttgaaatggacggagatgaaatgactcgagttt 224

                                                                       
Query: 244 tatggaaatggatcaaagataagcttatatttcctttcctggacctggacataaaatact 303
           | ||||||| ||| || ||||||||||| || ||||| |||||  |||||||||| ||||
Sbjct: 225 tctggaaatcgattaaggataagcttattttcccttttctggagttggacataaagtact 284

                                                                       
Query: 304 ttgacttaggtctacctaaccgtgacgctactggggataaagtaacgatagaaagtgcag 363
           | ||| | || || || || ||||| || ||||  || ||||| ||  | ||||||||||
Sbjct: 285 tcgaccttggccttccgaatcgtgatgcaactgatgacaaagttaccgttgaaagtgcag 344

                                                                       
Query: 364 aagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccccagatgaaggac 423
           |||| || || ||||| || || || ||||| ||||| ||| | || ||||||||||  |
Sbjct: 345 aagccactctcaagtacaatgtagcgatcaagtgtgctactattactccagatgaagctc 404

                                                                       
Query: 424 gcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataaggaaca 483
           | || || || |||   || |||   ||||||| |||||||||||||||||| ||||| |
Sbjct: 405 gtgttaaggaatttgtcttgaaacagatgtggaagagtccaaatgggacaatcaggaata 464

                                                                       
Query: 484 tcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgc 543
           | || ||||| ||||||||| ||||||||||||| ||||| ||||| ||||||||| | |
Sbjct: 465 ttttgaatggcactgttttcagagaaccaatcatttgcaaaaatgtccctcggcttattc 524

                                                                       
Query: 544 ctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaa 603
           | || |||||||| ||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 525 caggctggacaaagcccatatgcattggcaggcatgcttttggtgatcaatatcgagcaa 584

                 
Query: 604 cagata 609
           | ||||
Sbjct: 585 ctgata 590



 Score =  190 bits (96), Expect = 1e-44
 Identities = 489/620 (78%)
 Strand = Plus / Plus

                                                                        
Query: 699  ggtggagtagcattatctatgtataacactgatgagtctattcgagcatttgctgaagct 758
            |||||||| ||||| || |||||||||||||||||||| || |||   |||||||| |||
Sbjct: 686  ggtggagttgcattgtccatgtataacactgatgagtccatccgaagttttgctgaggct 745

                                                                        
Query: 759  tcgatgaacatggcttaccagaagagatggccactttatcttagtacgaagaacacaatc 818
            || |||||||  || || || || |  |||||||| ||||||||||| || ||||| |||
Sbjct: 746  tctatgaacactgcctatcaaaaaaagtggccactctatcttagtacaaaaaacactatc 805

                                                                        
Query: 819  ctgaaaaaatatgacggaaggtttaaagacatattccaacaaaactatgaaacaaattgg 878
            || ||||| ||||| ||||  || ||||||||||| ||| |    |||||  |||| |||
Sbjct: 806  cttaaaaattatgatggaaaattcaaagacatatttcaagaggtttatgaggcaaactgg 865

                                                                        
Query: 879  agatgcaggtttgaggatgcaggaatatggtatgaacatagactgattgatgatatggtg 938
            |  |  | |||||| | ||| || ||||||||||||||| | || |||||||||||||| 
Sbjct: 866  aagtcaaagtttgaagctgctggcatatggtatgaacatcgtctcattgatgatatggta 925

                                                                        
Query: 939  gcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaattatgatggagat 998
            || ||||| || || |||||||| || || || |||||||||||  ||||||||||| ||
Sbjct: 926  gcttatgctctcaaaagtgaaggaggttacgtgtgggcttgcaaagattatgatggaaat 985

                                                                        
Query: 999  gtgcagagcgatctaattgctcaaggttttggatcgttaggtctcatgacatcggttttg 1058
            || || || ||| |  | |||||||| ||||||||  | ||  | |||||||| ||  ||
Sbjct: 986  gtccaaagtgatttcctagctcaagggtttggatctcttggattgatgacatctgtactg 1045

                                                                        
Query: 1059 gtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgacat 1118
            || ||||||||||| | |||| ||||||| ||||| || || || |||||||| ||||| 
Sbjct: 1046 gtatgccctgatgggaaaacaattgaagccgaagcagcccatggaacagtcacccgacac 1105

                                                                        
Query: 1119 tacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgca 1178
            |||||||| || || ||||| || |||||||||||||||||||| || || |||||||| 
Sbjct: 1106 tacagagttcatcagaaaggtggtgaaactagcacaaacagcatagcctccatctttgct 1165

                                                                        
Query: 1179 tggtctactggattagcacatagggcaaagctggatgacaacaaaagactgttggatttc 1238
            |||||    ||  | ||||||||||| ||| ||||  ||||    || ||||||||||| 
Sbjct: 1166 tggtcacgagggcttgcacatagggcgaagttggacaacaatgctaggctgttggatttt 1225

                                                                        
Query: 1239 acacaaaaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggac 1298
            ||  | ||||| |||||||| ||||| || || || |||||||| |||||||| ||||| 
Sbjct: 1226 actgagaaactagaagctgcatgtgttggcactgttgaatctgggaagatgaccaaggat 1285

                                
Query: 1299 ctagctcttctcatccatgg 1318
            || || ||| | ||||||||
Sbjct: 1286 cttgcacttattatccatgg 1305



to top

>gb|AF367443.1| Prunus persica clone Icdh1 NADP-dependent isocitrate dehydrogenase
           (icdh1) mRNA, complete cds
          Length = 1561

 Score =  204 bits (103), Expect = 1e-48
 Identities = 349/431 (80%)
 Strand = Plus / Plus

                                                                       
Query: 174 atggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatg 233
           ||||| ||| |||||||| |||| |||||||||||||| ||||||||||| ||||| |||
Sbjct: 1   atggctttccagaagatcaaggtggccaaccccatcgtggagatggacggagatgaaatg 60

                                                                       
Query: 234 acacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctggac 293
           || ||| || | |||||||  || || ||||||||||| || || ||  ||||  |||||
Sbjct: 61  acgcgagttttctggaaatccataaaggataagcttattttaccctttttggaattggac 120

                                                                       
Query: 294 ataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgata 353
           || || ||||||||| | ||||| ||| | ||||| || ||||  |||||||| ||  | 
Sbjct: 121 atcaagtactttgaccttggtcttcctcatcgtgatgccactgatgataaagttactgtt 180

                                                                       
Query: 354 gaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcacccca 413
           ||||||||||| ||||| || ||||| || || || ||||||||||||||| |||| |||
Sbjct: 181 gaaagtgcagaggctactcttaagtacaatgtagcaatcaaatgtgcaactatcactcca 240

                                                                       
Query: 414 gatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggaca 473
           |||||||| || || || |||||||| || ||   ||||||||||||||| ||||| || 
Sbjct: 241 gatgaaggtcgtgttaaggagtttaacttgaagagtatgtggaggagtcccaatggcact 300

                                                                       
Query: 474 ataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcct 533
           || ||||| || || ||||| ||||||||| ||||||||||  | ||||| ||  | |||
Sbjct: 301 attaggaatattttgaatggtactgttttcagagaaccaattctttgcaaaaacatccct 360

                                                                       
Query: 534 cggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaa 593
           || ||| | || || |||||||| || ||||||||||| ||||||||||| |||||||| 
Sbjct: 361 cgccttatcccaggctggacaaagccaatatgcattggaagacatgctttcggtgatcag 420

                      
Query: 594 taccgagcaac 604
           || ||||||||
Sbjct: 421 tatcgagcaac 431



 Score =  163 bits (82), Expect = 3e-36
 Identities = 301/374 (80%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            ||||||||||||||||| ||||| || || ||||| ||||| ||||||||||| ||||||
Sbjct: 757  attgatgatatggtggcttatgcacttaaaagtgatggtgggtatgtttgggcatgcaag 816

                                                                        
Query: 984  aattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtctc 1043
            ||||||||||||||||||||||| ||| |  | |||||||| ||||| ||  | ||  | 
Sbjct: 817  aattatgatggagatgtgcagagtgatttcttagctcaagggtttggctctcttggattg 876

                                                                        
Query: 1044 atgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacggt 1103
            |||||||| ||  |||||||||| ||||| |  ||  | ||||| |||||||| ||||||
Sbjct: 877  atgacatcagtactggtgtgcccagatggaaagactatagaagcagaagctgcccacggt 936

                                                                        
Query: 1104 acagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcatt 1163
            ||||| || || |||||||| || ||||| |||||||| ||||| || ||||||||||| 
Sbjct: 937  acagttactcggcattacagggttcaccagaaaggaggtgaaaccagtacaaacagcata 996

                                                                        
Query: 1164 gcgtcaatctttgcatggtctactggattagcacatagggcaaagctggatgacaacaaa 1223
            || || |||||||| ||| | |  ||  | ||||| ||||||||| ||||||||||   |
Sbjct: 997  gcttctatctttgcttggacaagagggcttgcacacagggcaaagttggatgacaatgca 1056

                                                                        
Query: 1224 agactgttggatttcacacaaaaacttgaagctgcttgtgtggggacagtggaatctgga 1283
            |  || ||||||||||| || ||||| ||||  |||||  | || || ||||||||||| 
Sbjct: 1057 aagcttttggatttcactcagaaactggaagaagcttgcattggaactgtggaatctggg 1116

                          
Query: 1284 aagatgacaaagga 1297
            || ||||| |||||
Sbjct: 1117 aaaatgaccaagga 1130



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 121/152 (79%)
 Strand = Plus / Plus

                                                                       
Query: 702 ggagtagcattatctatgtataacactgatgagtctattcgagcatttgctgaagcttcg 761
           |||||||||||  | ||||| |||||||||||||| || || || ||||| || ||||| 
Sbjct: 535 ggagtagcattggccatgtacaacactgatgagtccatccgtgcttttgcagaggcttcc 594

                                                                       
Query: 762 atgaacatggcttaccagaagagatggccactttatcttagtacgaagaacacaatcctg 821
           |||| ||  |||||  |||| |  ||||| ||||||||||| || |||||||| || || 
Sbjct: 595 atgaccactgcttatgagaaaaagtggcctctttatcttagcacaaagaacactattctt 654

                                           
Query: 822 aaaaaatatgacggaaggtttaaagacatatt 853
           || || ||||| ||||| || || ||||||||
Sbjct: 655 aagaagtatgatggaagattcaaggacatatt 686



to top

>gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, complete sequence
          Length = 182756

 Score =  202 bits (102), Expect = 4e-48
 Identities = 117/122 (95%)
 Strand = Plus / Plus

                                                                          
Query: 907    ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
              |||| |||||| | ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 137330 ggtacgaacatcggctgattgatgatatggtggcctatgcccttaagagtgaaggtggct 137389

                                                                          
Query: 967    atgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggtt 1026
              ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 137390 atgtttgggcttgcaagaactatgatggagatgtgcagagcgatctaattgctcaaggtt 137449

                
Query: 1027   tt 1028
              ||
Sbjct: 137450 tt 137451



 Score =  161 bits (81), Expect = 1e-35
 Identities = 129/145 (88%)
 Strand = Plus / Plus

                                                                          
Query: 1058   ggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgaca 1117
              |||||||||||||||||||||  |||||||||||||||| || |||||||||||||| ||
Sbjct: 137757 ggtgtgccctgatggtagaaccattgaagctgaagctgctcatggtacagtcacacgcca 137816

                                                                          
Query: 1118   ttacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
              ||||||||| ||||||||||||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 137817 ttacagagttcaccaaaaaggaggcgaaactagtacaaatagcattgcttcaatatttgc 137876

                                       
Query: 1178   atggtctactggattagcacatagg 1202
               ||| | || ||| ||| |||||||
Sbjct: 137877 ttggacaaccggactaggacatagg 137901



 Score =  159 bits (80), Expect = 5e-35
 Identities = 113/124 (91%)
 Strand = Plus / Plus

                                                                          
Query: 1200   agggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgct 1259
              ||||||||||| |||||||| ||||||||||| |||||   |||||||||||||||||||
Sbjct: 138224 agggcaaagctcgatgacaataaaagactgttagattttgtacaaaaacttgaagctgct 138283

                                                                          
Query: 1260   tgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctcatccatggg 1319
              |||||||| ||||||||||||||||||||||||||||| |||||||||||  | ||||||
Sbjct: 138284 tgtgtgggaacagtggaatctggaaagatgacaaaggatctagctcttcttgtacatggg 138343

                  
Query: 1320   ccaa 1323
              ||||
Sbjct: 138344 ccaa 138347



 Score =  149 bits (75), Expect = 5e-32
 Identities = 105/115 (91%)
 Strand = Plus / Plus

                                                                          
Query: 265    agcttatatttcctttcctggacctggacataaaatactttgacttaggtctacctaacc 324
              |||||||||| |||||| ||||| ||||||||||||||| |||||||||||||||||| |
Sbjct: 134752 agcttatattccctttcttggacttggacataaaatactatgacttaggtctacctaatc 134811

                                                                     
Query: 325    gtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagta 379
              |||||||||||||||| ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 134812 gtgacgctactggggacaaagttacaatagagagtgcagaagcgaccctaaagta 134866



 Score =  125 bits (63), Expect = 7e-25
 Identities = 78/83 (93%)
 Strand = Plus / Plus

                                                                          
Query: 648    gatggcatagaggaacaaatagagttggatgtgttcaactttagtggtgctggtggagta 707
              ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 136799 gatggcagagaggaacaaatagagttggatgtgttcaactttactggtgctggtggagta 136858

                                     
Query: 708    gcattatctatgtataacactga 730
              || || ||||||||||| |||||
Sbjct: 136859 gccttgtctatgtataatactga 136881



 Score =  119 bits (60), Expect = 4e-23
 Identities = 96/108 (88%)
 Strand = Plus / Plus

                                                                          
Query: 733    agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
              |||||||| | ||||| ||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 136989 agtctatttgggcattcgctgaagcttccatgaacatggcttaccagaaaagatggccac 137048

                                                              
Query: 793    tttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
              |||||||||| || || ||||| ||||| |||||||| || |||||||
Sbjct: 137049 tttatcttagcaccaaaaacacgatcctcaaaaaatacgatggaaggt 137096



 Score =  107 bits (54), Expect = 2e-19
 Identities = 75/82 (91%)
 Strand = Plus / Plus

                                                                          
Query: 412    cagatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatggga 471
              |||||||||||||||| ||||||||||||||||  || ||||||| ||||||||||||||
Sbjct: 135227 cagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatggga 135286

                                    
Query: 472    caataaggaacatcttaaatgg 493
              ||||||||||||| || |||||
Sbjct: 135287 caataaggaacattttgaatgg 135308



 Score =  105 bits (53), Expect = 7e-19
 Identities = 83/93 (89%)
 Strand = Plus / Plus

                                                                          
Query: 1887   gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
              |||||| |||||| ||||||||| || |||||||| ||||||||||||||||||||||  
Sbjct: 139134 gcagcagcaggcgtgctcaagaagctcgcgaggaaattgccgcgctcgtagaagtactcc 139193

                                               
Query: 1947   gccttctccaccttcatctcctcatcaacctaa 1979
              | ||||||||||||||||||||| || ||||||
Sbjct: 139194 gtcttctccaccttcatctcctcgtcgacctaa 139226



 Score = 97.6 bits (49), Expect = 2e-16
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                          
Query: 1887   gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
              |||||| |||||||||||||||| || |||||||| |||||||| ||||||||| | |  
Sbjct: 124356 gcagcagcaggcgcgctcaagaagctcgcgaggaaattgccgcgttcgtagaagaattcc 124297

                                               
Query: 1947   gccttctccaccttcatctcctcatcaacctaa 1979
              |||||||| |||||||||||||| |||||||||
Sbjct: 124296 gccttctcaaccttcatctcctcgtcaacctaa 124264



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 54/56 (96%)
 Strand = Plus / Plus

                                                                      
Query: 492    ggaactgttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctgg 547
              |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 135418 ggaactgttttccgagaaccaatcatctgcaagaatattcctcggcttgtacctgg 135473



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                          
Query: 549    tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaacagat 608
              |||| ||| ||||||||||||||  ||||||| |||||||||||||||||||||||||||
Sbjct: 135547 tggataaagcccatatgcattggacgacatgcatttggtgatcaataccgagcaacagat 135606

               
Query: 609    a 609
              |
Sbjct: 135607 a 135607



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                          
Query: 1325   tgttagtcgtgataagtatctgaacaccatggagttcattgatgcggttgctgaggagtt 1384
              |||||| || ||||||||||| |||||  | |||||||| ||||| ||||||||||| ||
Sbjct: 138426 tgttagccgagataagtatcttaacactgttgagttcatcgatgctgttgctgaggattt 138485

                                                     
Query: 1385   gaggacaagattgtccgcaaaatcaaagttatgaaggta 1423
               || ||||||||||| | || ||| ||||||||||||||
Sbjct: 138486 aagaacaagattgtcagtaacatccaagttatgaaggta 138524



 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                     
Query: 172    ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtga 226
              ||||||||||||||||||||   || ||||||||| |||||||||||||||||||
Sbjct: 133624 ccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtga 133678



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                          
Query: 837    aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
              ||||||||||| ||||| ||  | |||||||||||||| ||||||  || |||||| |||
Sbjct: 137175 aggtttaaagatatatttcaggagaactatgaaacaaaatggagagccaagtttgatgat 137234

                            
Query: 897    gcaggaatatggta 910
              ||||||||||||||
Sbjct: 137235 gcaggaatatggta 137248



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                           
Query: 222    ggtgatgagatgacacgaattatatggaaatggatcaaagataag 266
              |||||||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 134515 ggtgatgagatgactcgagttatttggaaatggatcaaagataag 134559



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                      
Query: 1022   aggttttggatcgttaggtctcatgacatcggttttggtg 1061
              ||||||||||||| ||||||| |||||||| ||| |||||
Sbjct: 137539 aggttttggatcgctaggtctaatgacatcagttctggtg 137578



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  202 bits (102), Expect = 4e-48
 Identities = 117/122 (95%)
 Strand = Plus / Plus

                                                                           
Query: 907     ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
               |||| |||||| | ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 8173209 ggtacgaacatcggctgattgatgatatggtggcctatgcccttaagagtgaaggtggct 8173268

                                                                           
Query: 967     atgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggtt 1026
               ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 8173269 atgtttgggcttgcaagaactatgatggagatgtgcagagcgatctaattgctcaaggtt 8173328

                 
Query: 1027    tt 1028
               ||
Sbjct: 8173329 tt 8173330



 Score =  161 bits (81), Expect = 1e-35
 Identities = 129/145 (88%)
 Strand = Plus / Plus

                                                                           
Query: 1058    ggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgaca 1117
               |||||||||||||||||||||  |||||||||||||||| || |||||||||||||| ||
Sbjct: 8173636 ggtgtgccctgatggtagaaccattgaagctgaagctgctcatggtacagtcacacgcca 8173695

                                                                           
Query: 1118    ttacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
               ||||||||| ||||||||||||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 8173696 ttacagagttcaccaaaaaggaggcgaaactagtacaaatagcattgcttcaatatttgc 8173755

                                        
Query: 1178    atggtctactggattagcacatagg 1202
                ||| | || ||| ||| |||||||
Sbjct: 8173756 ttggacaaccggactaggacatagg 8173780



 Score =  159 bits (80), Expect = 5e-35
 Identities = 113/124 (91%)
 Strand = Plus / Plus

                                                                           
Query: 1200    agggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgct 1259
               ||||||||||| |||||||| ||||||||||| |||||   |||||||||||||||||||
Sbjct: 8174103 agggcaaagctcgatgacaataaaagactgttagattttgtacaaaaacttgaagctgct 8174162

                                                                           
Query: 1260    tgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctcatccatggg 1319
               |||||||| ||||||||||||||||||||||||||||| |||||||||||  | ||||||
Sbjct: 8174163 tgtgtgggaacagtggaatctggaaagatgacaaaggatctagctcttcttgtacatggg 8174222

                   
Query: 1320    ccaa 1323
               ||||
Sbjct: 8174223 ccaa 8174226



 Score =  149 bits (75), Expect = 5e-32
 Identities = 105/115 (91%)
 Strand = Plus / Plus

                                                                           
Query: 265     agcttatatttcctttcctggacctggacataaaatactttgacttaggtctacctaacc 324
               |||||||||| |||||| ||||| ||||||||||||||| |||||||||||||||||| |
Sbjct: 8170631 agcttatattccctttcttggacttggacataaaatactatgacttaggtctacctaatc 8170690

                                                                      
Query: 325     gtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagta 379
               |||||||||||||||| ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 8170691 gtgacgctactggggacaaagttacaatagagagtgcagaagcgaccctaaagta 8170745



 Score =  125 bits (63), Expect = 7e-25
 Identities = 78/83 (93%)
 Strand = Plus / Plus

                                                                           
Query: 648     gatggcatagaggaacaaatagagttggatgtgttcaactttagtggtgctggtggagta 707
               ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 8172678 gatggcagagaggaacaaatagagttggatgtgttcaactttactggtgctggtggagta 8172737

                                      
Query: 708     gcattatctatgtataacactga 730
               || || ||||||||||| |||||
Sbjct: 8172738 gccttgtctatgtataatactga 8172760



 Score =  119 bits (60), Expect = 4e-23
 Identities = 96/108 (88%)
 Strand = Plus / Plus

                                                                           
Query: 733     agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
               |||||||| | ||||| ||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 8172868 agtctatttgggcattcgctgaagcttccatgaacatggcttaccagaaaagatggccac 8172927

                                                               
Query: 793     tttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
               |||||||||| || || ||||| ||||| |||||||| || |||||||
Sbjct: 8172928 tttatcttagcaccaaaaacacgatcctcaaaaaatacgatggaaggt 8172975



 Score =  107 bits (54), Expect = 2e-19
 Identities = 75/82 (91%)
 Strand = Plus / Plus

                                                                           
Query: 412     cagatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatggga 471
               |||||||||||||||| ||||||||||||||||  || ||||||| ||||||||||||||
Sbjct: 8171106 cagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatggga 8171165

                                     
Query: 472     caataaggaacatcttaaatgg 493
               ||||||||||||| || |||||
Sbjct: 8171166 caataaggaacattttgaatgg 8171187



 Score =  105 bits (53), Expect = 7e-19
 Identities = 83/93 (89%)
 Strand = Plus / Plus

                                                                           
Query: 1887    gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
               |||||| |||||| ||||||||| || |||||||| ||||||||||||||||||||||  
Sbjct: 8175013 gcagcagcaggcgtgctcaagaagctcgcgaggaaattgccgcgctcgtagaagtactcc 8175072

                                                
Query: 1947    gccttctccaccttcatctcctcatcaacctaa 1979
               | ||||||||||||||||||||| || ||||||
Sbjct: 8175073 gtcttctccaccttcatctcctcgtcgacctaa 8175105



 Score = 97.6 bits (49), Expect = 2e-16
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                           
Query: 1887    gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
               |||||| |||||||||||||||| || |||||||| |||||||| ||||||||| | |  
Sbjct: 8160235 gcagcagcaggcgcgctcaagaagctcgcgaggaaattgccgcgttcgtagaagaattcc 8160176

                                                
Query: 1947    gccttctccaccttcatctcctcatcaacctaa 1979
               |||||||| |||||||||||||| |||||||||
Sbjct: 8160175 gccttctcaaccttcatctcctcgtcaacctaa 8160143



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 54/56 (96%)
 Strand = Plus / Plus

                                                                       
Query: 492     ggaactgttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctgg 547
               |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 8171297 ggaactgttttccgagaaccaatcatctgcaagaatattcctcggcttgtacctgg 8171352



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                            
Query: 927      gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
                ||||| ||||| || ||||| || ||||||||||| |||||||| |||||||||||||||
Sbjct: 26527772 gatgacatggttgcttatgcacttaagagtgaagggggctatgtgtgggcttgcaagaat 26527713

                                    
Query: 987      tatgatggagatgtgcagag 1006
                || |||||||||||||||||
Sbjct: 26527712 tacgatggagatgtgcagag 26527693



 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                     
Query: 172      ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggt 224
                |||||||||||||||||||| |||| |||||||||||||||||||||||||||
Sbjct: 26530282 ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 26530230



 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                            
Query: 1058     ggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgaca 1117
                ||||||||||||||| | |||| |||||||||||||||| || || || || || || ||
Sbjct: 26527371 ggtgtgccctgatggaaaaacaattgaagctgaagctgcccatggcacggttacccgtca 26527312

                                                                            
Query: 1118     ttacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
                || | | || ||||| || ||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 26527311 tttccgtgttcaccagaagggaggtgaaaccagcacaaacagcattgcttcaatctttgc 26527252



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                           
Query: 549     tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaacagat 608
               |||| ||| ||||||||||||||  ||||||| |||||||||||||||||||||||||||
Sbjct: 8171426 tggataaagcccatatgcattggacgacatgcatttggtgatcaataccgagcaacagat 8171485

                
Query: 609     a 609
               |
Sbjct: 8171486 a 8171486



 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                            
Query: 741      cgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatctt 800
                ||||| |||||||||||||| ||||  |  |||||  |||||| |||||| |||||||||
Sbjct: 26528167 cgagcttttgctgaagcttctatgacaactgcttatgagaagaaatggccgctttatctt 26528108

                                                        
Query: 801      agtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
                || || || |||||||||||||| |||||||| |||||||
Sbjct: 26528107 agcaccaaaaacacaatcctgaagaaatatgatggaaggt 26528068



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                           
Query: 1325    tgttagtcgtgataagtatctgaacaccatggagttcattgatgcggttgctgaggagtt 1384
               |||||| || ||||||||||| |||||  | |||||||| ||||| ||||||||||| ||
Sbjct: 8174305 tgttagccgagataagtatcttaacactgttgagttcatcgatgctgttgctgaggattt 8174364

                                                      
Query: 1385    gaggacaagattgtccgcaaaatcaaagttatgaaggta 1423
                || ||||||||||| | || ||| ||||||||||||||
Sbjct: 8174365 aagaacaagattgtcagtaacatccaagttatgaaggta 8174403



 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                      
Query: 172     ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtga 226
               ||||||||||||||||||||   || ||||||||| |||||||||||||||||||
Sbjct: 8169503 ccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtga 8169557



 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 546      ggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaac 604
                |||||||| || ||||| |||||||| || ||||||||||||||||| |||||||||||
Sbjct: 26528531 ggatggactaagcccatttgcattggaaggcatgcttttggtgatcagtaccgagcaac 26528473



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                           
Query: 837     aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
               ||||||||||| ||||| ||  | |||||||||||||| ||||||  || |||||| |||
Sbjct: 8173054 aggtttaaagatatatttcaggagaactatgaaacaaaatggagagccaagtttgatgat 8173113

                             
Query: 897     gcaggaatatggta 910
               ||||||||||||||
Sbjct: 8173114 gcaggaatatggta 8173127



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                            
Query: 1244     aaaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagc 1303
                |||||||||||||||||| || || || ||||||||||| |||||||| || ||||| ||
Sbjct: 26526977 aaaacttgaagctgcttgcgttggaaccgtggaatctgggaagatgaccaaagaccttgc 26526918

                      
Query: 1304     tcttct 1309
                ||||||
Sbjct: 26526917 tcttct 26526912



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                            
Query: 222     ggtgatgagatgacacgaattatatggaaatggatcaaagataag 266
               |||||||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 8170394 ggtgatgagatgactcgagttatttggaaatggatcaaagataag 8170438



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                            
Query: 673      tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
                |||| ||||||||||| | ||||||||| ||||| || || |||||||| ||||||||||
Sbjct: 26528314 tggaggtgttcaacttcactggtgctggaggagttgctttgtctatgtacaacactgatg 26528255

                  
Query: 733      ag 734
                ||
Sbjct: 26528254 ag 26528253



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                       
Query: 1022    aggttttggatcgttaggtctcatgacatcggttttggtg 1061
               ||||||||||||| ||||||| |||||||| ||| |||||
Sbjct: 8173418 aggttttggatcgctaggtctaatgacatcagttctggtg 8173457



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 1356     gagttcattgatgcggttgctgaggag 1382
                |||||||||||||||||||||| ||||
Sbjct: 26526744 gagttcattgatgcggttgctgcggag 26526718



to top

>dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0034C11
          Length = 139399

 Score =  202 bits (102), Expect = 4e-48
 Identities = 117/122 (95%)
 Strand = Plus / Plus

                                                                         
Query: 907   ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
             |||| |||||| | ||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 90927 ggtacgaacatcggctgattgatgatatggtggcctatgcccttaagagtgaaggtggct 90986

                                                                         
Query: 967   atgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggtt 1026
             ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 90987 atgtttgggcttgcaagaactatgatggagatgtgcagagcgatctaattgctcaaggtt 91046

               
Query: 1027  tt 1028
             ||
Sbjct: 91047 tt 91048



 Score =  161 bits (81), Expect = 1e-35
 Identities = 129/145 (88%)
 Strand = Plus / Plus

                                                                         
Query: 1058  ggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgaca 1117
             |||||||||||||||||||||  |||||||||||||||| || |||||||||||||| ||
Sbjct: 91354 ggtgtgccctgatggtagaaccattgaagctgaagctgctcatggtacagtcacacgcca 91413

                                                                         
Query: 1118  ttacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
             ||||||||| ||||||||||||||||||||||| ||||| |||||||| ||||| |||||
Sbjct: 91414 ttacagagttcaccaaaaaggaggcgaaactagtacaaatagcattgcttcaatatttgc 91473

                                      
Query: 1178  atggtctactggattagcacatagg 1202
              ||| | || ||| ||| |||||||
Sbjct: 91474 ttggacaaccggactaggacatagg 91498



 Score =  159 bits (80), Expect = 5e-35
 Identities = 113/124 (91%)
 Strand = Plus / Plus

                                                                         
Query: 1200  agggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgct 1259
             ||||||||||| |||||||| ||||||||||| |||||   |||||||||||||||||||
Sbjct: 91821 agggcaaagctcgatgacaataaaagactgttagattttgtacaaaaacttgaagctgct 91880

                                                                         
Query: 1260  tgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctcatccatggg 1319
             |||||||| ||||||||||||||||||||||||||||| |||||||||||  | ||||||
Sbjct: 91881 tgtgtgggaacagtggaatctggaaagatgacaaaggatctagctcttcttgtacatggg 91940

                 
Query: 1320  ccaa 1323
             ||||
Sbjct: 91941 ccaa 91944



 Score =  149 bits (75), Expect = 5e-32
 Identities = 105/115 (91%)
 Strand = Plus / Plus

                                                                         
Query: 265   agcttatatttcctttcctggacctggacataaaatactttgacttaggtctacctaacc 324
             |||||||||| |||||| ||||| ||||||||||||||| |||||||||||||||||| |
Sbjct: 88349 agcttatattccctttcttggacttggacataaaatactatgacttaggtctacctaatc 88408

                                                                    
Query: 325   gtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagta 379
             |||||||||||||||| ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 88409 gtgacgctactggggacaaagttacaatagagagtgcagaagcgaccctaaagta 88463



 Score =  125 bits (63), Expect = 7e-25
 Identities = 78/83 (93%)
 Strand = Plus / Plus

                                                                         
Query: 648   gatggcatagaggaacaaatagagttggatgtgttcaactttagtggtgctggtggagta 707
             ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 90396 gatggcagagaggaacaaatagagttggatgtgttcaactttactggtgctggtggagta 90455

                                    
Query: 708   gcattatctatgtataacactga 730
             || || ||||||||||| |||||
Sbjct: 90456 gccttgtctatgtataatactga 90478



 Score =  119 bits (60), Expect = 4e-23
 Identities = 96/108 (88%)
 Strand = Plus / Plus

                                                                         
Query: 733   agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
             |||||||| | ||||| ||||||||||| |||||||||||||||||||| ||||||||||
Sbjct: 90586 agtctatttgggcattcgctgaagcttccatgaacatggcttaccagaaaagatggccac 90645

                                                             
Query: 793   tttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
             |||||||||| || || ||||| ||||| |||||||| || |||||||
Sbjct: 90646 tttatcttagcaccaaaaacacgatcctcaaaaaatacgatggaaggt 90693



 Score =  107 bits (54), Expect = 2e-19
 Identities = 75/82 (91%)
 Strand = Plus / Plus

                                                                         
Query: 412   cagatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatggga 471
             |||||||||||||||| ||||||||||||||||  || ||||||| ||||||||||||||
Sbjct: 88824 cagatgaaggacgcgtgaaagagtttaatttaagtgcaatgtggaagagtccaaatggga 88883

                                   
Query: 472   caataaggaacatcttaaatgg 493
             ||||||||||||| || |||||
Sbjct: 88884 caataaggaacattttgaatgg 88905



 Score =  105 bits (53), Expect = 7e-19
 Identities = 83/93 (89%)
 Strand = Plus / Plus

                                                                         
Query: 1887  gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
             |||||| |||||| ||||||||| || |||||||| ||||||||||||||||||||||  
Sbjct: 92731 gcagcagcaggcgtgctcaagaagctcgcgaggaaattgccgcgctcgtagaagtactcc 92790

                                              
Query: 1947  gccttctccaccttcatctcctcatcaacctaa 1979
             | ||||||||||||||||||||| || ||||||
Sbjct: 92791 gtcttctccaccttcatctcctcgtcgacctaa 92823



 Score = 97.6 bits (49), Expect = 2e-16
 Identities = 82/93 (88%)
 Strand = Plus / Minus

                                                                         
Query: 1887  gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
             |||||| |||||||||||||||| || |||||||| |||||||| ||||||||| | |  
Sbjct: 77953 gcagcagcaggcgcgctcaagaagctcgcgaggaaattgccgcgttcgtagaagaattcc 77894

                                              
Query: 1947  gccttctccaccttcatctcctcatcaacctaa 1979
             |||||||| |||||||||||||| |||||||||
Sbjct: 77893 gccttctcaaccttcatctcctcgtcaacctaa 77861



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 54/56 (96%)
 Strand = Plus / Plus

                                                                     
Query: 492   ggaactgttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctgg 547
             |||||||||||||||||||||||||||||||||||| ||||||||||||| |||||
Sbjct: 89015 ggaactgttttccgagaaccaatcatctgcaagaatattcctcggcttgtacctgg 89070



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 56/61 (91%)
 Strand = Plus / Plus

                                                                         
Query: 549   tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaacagat 608
             |||| ||| ||||||||||||||  ||||||| |||||||||||||||||||||||||||
Sbjct: 89144 tggataaagcccatatgcattggacgacatgcatttggtgatcaataccgagcaacagat 89203

              
Query: 609   a 609
             |
Sbjct: 89204 a 89204



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 84/99 (84%)
 Strand = Plus / Plus

                                                                         
Query: 1325  tgttagtcgtgataagtatctgaacaccatggagttcattgatgcggttgctgaggagtt 1384
             |||||| || ||||||||||| |||||  | |||||||| ||||| ||||||||||| ||
Sbjct: 92023 tgttagccgagataagtatcttaacactgttgagttcatcgatgctgttgctgaggattt 92082

                                                    
Query: 1385  gaggacaagattgtccgcaaaatcaaagttatgaaggta 1423
              || ||||||||||| | || ||| ||||||||||||||
Sbjct: 92083 aagaacaagattgtcagtaacatccaagttatgaaggta 92121



 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 50/55 (90%)
 Strand = Plus / Plus

                                                                    
Query: 172   ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtga 226
             ||||||||||||||||||||   || ||||||||| |||||||||||||||||||
Sbjct: 87221 ccatggcgttcgagaagatcgtcgtggccaaccccgtcgtcgagatggacggtga 87275



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                         
Query: 837   aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
             ||||||||||| ||||| ||  | |||||||||||||| ||||||  || |||||| |||
Sbjct: 90772 aggtttaaagatatatttcaggagaactatgaaacaaaatggagagccaagtttgatgat 90831

                           
Query: 897   gcaggaatatggta 910
             ||||||||||||||
Sbjct: 90832 gcaggaatatggta 90845



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                          
Query: 222   ggtgatgagatgacacgaattatatggaaatggatcaaagataag 266
             |||||||||||||| ||| |||| |||||||||||||||||||||
Sbjct: 88112 ggtgatgagatgactcgagttatttggaaatggatcaaagataag 88156



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                     
Query: 1022  aggttttggatcgttaggtctcatgacatcggttttggtg 1061
             ||||||||||||| ||||||| |||||||| ||| |||||
Sbjct: 91136 aggttttggatcgctaggtctaatgacatcagttctggtg 91175



to top

>emb|X75638.1|STNICD S.tuberosum  mRNA for NADP-dependent isocitrate dehydrogenase
          Length = 1569

 Score =  200 bits (101), Expect = 1e-47
 Identities = 326/401 (81%)
 Strand = Plus / Plus

                                                                       
Query: 201 aaccccatcgtcgagatggacggtgatgagatgacacgaattatatggaaatggatcaaa 260
           ||||||||||| ||||||||||| ||||| ||||||||| |||| |||||||  ||||| 
Sbjct: 96  aaccccatcgttgagatggacggagatgaaatgacacgagttatttggaaatctatcaag 155

                                                                       
Query: 261 gataagcttatatttcctttcctggacctggacataaaatactttgacttaggtctacct 320
           |||||||| ||  |||| || |||||  |||||||||||||||||  | | || || || 
Sbjct: 156 gataagctcatccttccctttctggaattggacataaaatactttagccttggccttccc 215

                                                                       
Query: 321 aaccgtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagtat 380
            ||||||| || || |  ||||| || ||  | |||||||| ||||| || |  ||||| 
Sbjct: 216 caccgtgatgccacagatgataaggttacagttgaaagtgcggaagccactcagaagtac 275

                                                                       
Query: 381 aacgtggccatcaaatgtgcaactgtcaccccagatgaaggacgcgtaaaagagtttaat 440
           ||||| || ||||| ||||||||  ||||||||||||| |  || ||||| |||||||| 
Sbjct: 276 aacgtagctatcaagtgtgcaaccatcaccccagatgaggcccgtgtaaaggagtttaac 335

                                                                       
Query: 441 ttaaaagctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgtt 500
           || ||| | ||||||||||| |||||||||||||| || |||||||||||||||||||| 
Sbjct: 336 ttgaaatccatgtggaggagcccaaatgggacaatcagaaacatcttaaatggaactgtc 395

                                                                       
Query: 501 ttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaaccc 560
           ||  |||||||||| || ||||| ||| | ||  | ||||| || || ||||| ||||| 
Sbjct: 396 tttagagaaccaattatgtgcaaaaatatccccagacttgtcccaggttggactaaacca 455

                                                    
Query: 561 atatgcattggcagacatgcttttggtgatcaataccgagc 601
           || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 456 atttgcattggtagacatgcttttggagatcaataccgagc 496



 Score =  200 bits (101), Expect = 1e-47
 Identities = 482/609 (79%)
 Strand = Plus / Plus

                                                                        
Query: 683  caactttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcg 742
            |||||||| |||||||||||||||||| ||||| ||||| ||||| || |||||| ||||
Sbjct: 584  caactttactggtgctggtggagtagctttatccatgtacaacacagacgagtctgttcg 643

                                                                        
Query: 743  agcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttag 802
              |||||||||| ||||| ||||||||||| | ||| |||| ||||||||| ||||||||
Sbjct: 644  ttcatttgctgaggcttcaatgaacatggcattccaaaagaaatggccactctatcttag 703

                                                                        
Query: 803  tacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaa 862
            ||| ||||| || || || || |||||||| || ||||| || || || |||||| ||  
Sbjct: 704  tacaaagaataccattcttaagaaatatgatgggaggttcaaggatatcttccaagaagt 763

                                                                        
Query: 863  ctatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatgaacatagact 922
             |||||| |||||||||  | || ||  ||||| || ||||| ||||| |||||  | ||
Sbjct: 764  ttatgaagcaaattggaagtccaagtacgaggaagccggaatctggtacgaacaccgtct 823

                                                                        
Query: 923  gattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaa 982
             || || |||||||| || |||||  |||||||||||||||| || || |||||||||||
Sbjct: 824  tatcgacgatatggttgcttatgctttaaagagtgaaggtggttacgtatgggcttgcaa 883

                                                                        
Query: 983  gaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtct 1042
            ||| || ||||| ||||| ||||| ||| |  | || ||||||||||||||  | ||  |
Sbjct: 884  gaactacgatggggatgttcagagtgatttcttagcacaaggttttggatcccttgggtt 943

                                                                        
Query: 1043 catgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacgg 1102
             ||||| || ||  ||||||| |||||||| |  ||  |||| |||||||| || || ||
Sbjct: 944  gatgacttctgtcctggtgtgtcctgatggcaagaccattgaggctgaagcagcccatgg 1003

                                                                        
Query: 1103 tacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcat 1162
             || || || || || ||||| || ||||| |||||||| ||||| ||||||||||||||
Sbjct: 1004 aactgttacccgccactacagggttcaccagaaaggaggtgaaaccagcacaaacagcat 1063

                                                                        
Query: 1163 tgcgtcaatctttgcatggtctactggattagcacatagggcaaagctggatgacaacaa 1222
            ||| || |||||||| ||| ||  |||| | ||||| |||||||   ||||  ||||| |
Sbjct: 1064 tgcctctatctttgcctggactcgtggacttgcacacagggcaacattggacaacaacga 1123

                                                                        
Query: 1223 aagactgttggatttcacacaaaaacttgaagctgcttgtgtggggacagtggaatctgg 1282
            ||| || |||||||| ||  | ||||| || || || ||  | ||  |||||||||||||
Sbjct: 1124 aaggctcttggattttactgagaaactagaggcagcatgcattggtgcagtggaatctgg 1183

                     
Query: 1283 aaagatgac 1291
            |||||||||
Sbjct: 1184 aaagatgac 1192



to top

>gb|DQ125944.1| Populus alba x Populus tremula cytosolic NADP+-isocitrate
            dehydrogenase mRNA, complete cds
          Length = 1374

 Score =  182 bits (92), Expect = 4e-42
 Identities = 410/516 (79%)
 Strand = Plus / Plus

                                                                        
Query: 668  agagttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacac 727
            ||||||||| |||| ||| ||||  ||||||||||| || |||||  | |||||||||||
Sbjct: 612  agagttggaggtgtacaattttacaggtgctggtggggtggcattggccatgtataacac 671

                                                                        
Query: 728  tgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatg 787
             |||||||| || ||  | |||||||||||||| |||||||  |||||||| ||||  ||
Sbjct: 672  cgatgagtccatccgttcttttgctgaagcttctatgaacactgcttaccaaaagaagtg 731

                                                                        
Query: 788  gccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaaga 847
            |||||||||||| || || || || || ||||| || || || || ||||| || || ||
Sbjct: 732  gccactttatctcagcacaaaaaatactatccttaagaagtacgatggaagattcaagga 791

                                                                        
Query: 848  catattccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaatatg 907
            ||| || ||| ||  ||||||  | || |||| ||  | ||  |||| ||||||||||||
Sbjct: 792  catctttcaagaagtctatgaggctaactggaaatcaaagtacgaggctgcaggaatatg 851

                                                                        
Query: 908  gtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggcta 967
            |||||||||  |||| |||||||||||||| || ||||| || ||||||||||| || ||
Sbjct: 852  gtatgaacaccgactcattgatgatatggttgcatatgctctcaagagtgaaggaggtta 911

                                                                        
Query: 968  tgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttt 1027
            ||||||||| ||||| || |||||||| ||||||||||| ||| |  | || ||||||||
Sbjct: 912  tgtttgggcatgcaaaaactatgatggggatgtgcagagtgatttcttggcccaaggttt 971

                                                                        
Query: 1028 tggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagc 1087
            ||||||  | ||  | ||||| || || ||||||||||||||||| |  ||  | || ||
Sbjct: 972  tggatcacttggcttgatgacctctgtattggtgtgccctgatggaaagaccatagaggc 1031

                                                                        
Query: 1088 tgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaac 1147
             || || || || |||||||| || || |||||||| || ||||| ||||| || |||||
Sbjct: 1032 cgaggcagcccatggtacagttactcggcattacagggttcaccagaaaggtggtgaaac 1091

                                                
Query: 1148 tagcacaaacagcattgcgtcaatctttgcatggtc 1183
             ||||||||||| ||||| || || ||||| |||||
Sbjct: 1092 cagcacaaacagtattgcctctatttttgcttggtc 1127



 Score =  101 bits (51), Expect = 1e-17
 Identities = 336/431 (77%)
 Strand = Plus / Plus

                                                                       
Query: 174 atggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatg 233
           ||||| ||||| |||||| ||||||| ||||||||||| || ||||| || ||||| |||
Sbjct: 112 atggctttcgaaaagatcaaggttgctaaccccatcgttgaaatggatggagatgaaatg 171

                                                                       
Query: 234 acacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctggac 293
           ||  || || | ||| |||  || || || |||||||| || || ||  ||||  |||| 
Sbjct: 172 accagagttttctggcaatcaataaaggaaaagcttattttcccatttttggagttggat 231

                                                                       
Query: 294 ataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgata 353
           || || ||||||||| | || || ||| | || || || ||||  |||||||| || || 
Sbjct: 232 atcaagtactttgaccttggccttcctcatcgcgatgccactgatgataaagtcactatt 291

                                                                       
Query: 354 gaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcacccca 413
           |||||  |||| ||||| || ||||| || || || ||||| ||||||||| | || |||
Sbjct: 292 gaaagctcagaggctactcttaagtacaatgtagcaatcaagtgtgcaactattactcca 351

                                                                       
Query: 414 gatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggaca 473
           |||||||  || || || |||||||| || ||    ||||||| ||||||||| || |||
Sbjct: 352 gatgaagatcgtgtcaaggagtttaaattgaagcagatgtggaagagtccaaacggaaca 411

                                                                       
Query: 474 ataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcct 533
           || |||||||| || || || ||||| ||| |||||||||| || ||||| || ||||| 
Sbjct: 412 attaggaacattttgaacggtactgtcttcagagaaccaattatttgcaaaaacgttccc 471

                                                                       
Query: 534 cggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaa 593
           || ||||| || || ||||| ||  | || ||||| || |||||||||||||||||||||
Sbjct: 472 cgccttgtcccaggctggacgaaggcaatttgcatcggaagacatgcttttggtgatcaa 531

                      
Query: 594 taccgagcaac 604
           || ||||||||
Sbjct: 532 tatcgagcaac 542



to top

>gb|U80912.1|EGU80912 Eucalyptus globulus NADP-isocitrate dehydrogenase (EgICDH) mRNA,
            complete cds
          Length = 1645

 Score =  182 bits (92), Expect = 4e-42
 Identities = 389/488 (79%)
 Strand = Plus / Plus

                                                                        
Query: 696  gctggtggagtagcattatctatgtataacactgatgagtctattcgagcatttgctgaa 755
            ||||||||||| ||||| || ||||| ||||| |||||||| || ||  | |||||||| 
Sbjct: 689  gctggtggagttgcattgtccatgtacaacacagatgagtcaatccgttcttttgctgag 748

                                                                        
Query: 756  gcttcgatgaacatggcttaccagaagagatggccactttatcttagtacgaagaacaca 815
            ||||| |||||||  ||||| |||||||  ||||| || |||||||| || ||||| || 
Sbjct: 749  gcttcaatgaacactgcttatcagaagaagtggccgctctatcttagcacaaagaatacc 808

                                                                        
Query: 816  atcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaactatgaaacaaat 875
            ||||| ||||||||||| ||||| || || || ||||||||| ||   |||||| | || 
Sbjct: 809  atccttaaaaaatatgatggaagattcaaggatatattccaagaagtttatgaagccaac 868

                                                                        
Query: 876  tggagatgcaggtttgaggatgcaggaatatggtatgaacatagactgattgatgatatg 935
            ||||  |  | |||||||| ||| ||||| |||||||||||  | || ||||||||||||
Sbjct: 869  tggaagtcaaagtttgaggctgctggaatctggtatgaacaccgtcttattgatgatatg 928

                                                                        
Query: 936  gtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaattatgatgga 995
            ||||| ||||| |||||||| || || || ||||| ||||| |||||||| |||||||||
Sbjct: 929  gtggcttatgcgctaaagagcgacggaggttatgtgtgggcatgcaagaactatgatgga 988

                                                                        
Query: 996  gatgtgcagagcgatctaattgctcaaggttttggatcgttaggtctcatgacatcggtt 1055
            ||||| ||||| ||| |  | || ||||| ||||||||| | ||  | |||||||| || 
Sbjct: 989  gatgtccagagtgatttcttagcccaagggtttggatcgcttggcttgatgacatctgtc 1048

                                                                        
Query: 1056 ttggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacga 1115
            ||||| ||||| || || | |||  ||||||| ||||| || || ||||| || || || 
Sbjct: 1049 ttggtctgcccagacggaaaaactattgaagcagaagccgctcatggtacggttacccgc 1108

                                                                        
Query: 1116 cattacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatcttt 1175
            |||||  | ||||| || |||||||||||||| ||||| || |||||||| || || |||
Sbjct: 1109 cattatcgggtccatcagaaaggaggcgaaaccagcactaatagcattgcttctatattt 1168

                    
Query: 1176 gcatggtc 1183
            || |||||
Sbjct: 1169 gcttggtc 1176



 Score =  176 bits (89), Expect = 2e-40
 Identities = 335/417 (80%)
 Strand = Plus / Plus

                                                                       
Query: 180 ttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgacacga 239
           |||||||||||| |||| |  ||||||||||||||||||||||| ||||| ||||| |||
Sbjct: 167 ttcgagaagatcaaggtcgagaaccccatcgtcgagatggacggggatgaaatgacccga 226

                                                                       
Query: 240 attatatggaaatggatcaaagataagcttatatttcctttcctggacctggacataaaa 299
            |  | |||||||  ||||| ||||||||||| ||||| ||| ||||  |||| || || 
Sbjct: 227 gtgttctggaaatcaatcaaggataagcttatttttcccttcttggagttggatatcaag 286

                                                                       
Query: 300 tactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgatagaaagt 359
           ||||| ||| | ||||| ||| | ||||| || ||||  || || || || || ||||| 
Sbjct: 287 tacttcgaccttggtcttcctcatcgtgatgccactgatgacaaggttacaattgaaagc 346

                                                                       
Query: 360 gcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccccagatgaa 419
           |||||||| || || || || || ||||||||||||||||||||| | || |||||||||
Sbjct: 347 gcagaagcaactcttaaatacaatgtggccatcaaatgtgcaactattacaccagatgaa 406

                                                                       
Query: 420 ggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataagg 479
           |  ||  | || ||||||| ||| ||    |||||||  ||||| |||||||| || |||
Sbjct: 407 gctcggatgaaggagtttactttgaagcaaatgtggaaaagtcccaatgggacgattagg 466

                                                                       
Query: 480 aacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcctcggctt 539
           |||||||| ||||| ||||| ||| |||| ||||| || ||||| ||| |||| ||||||
Sbjct: 467 aacatcttgaatggcactgtcttcagagagccaataatgtgcaaaaatattccccggctt 526

                                                                    
Query: 540 gtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           || || || ||| | || || ||||||||||| ||||||||||||||||||||||||
Sbjct: 527 gtcccagggtggtccaagccaatatgcattggaagacatgcttttggtgatcaatac 583



to top

>gb|L12157.1|SOYIDH Glycine max NADP-specific isocitrate dehydrogenase (idh1) mRNA, 3'
            end
          Length = 1560

 Score =  178 bits (90), Expect = 5e-41
 Identities = 348/434 (80%)
 Strand = Plus / Plus

                                                                        
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaa 845
            ||||||||||||||||| || || || ||||| ||||| |||||||| ||||| || || 
Sbjct: 708  tggccactttatcttagcaccaaaaatacaattctgaagaaatatgatggaagattcaag 767

                                                                        
Query: 846  gacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaata 905
            |||||||| ||| ||   |||||  |||  |||| ||  | |||||||| ||| || |||
Sbjct: 768  gacatatttcaagaagtttatgaggcaagctggaaatcaaagtttgaggctgctggtata 827

                                                                        
Query: 906  tggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggc 965
            |||||||| ||| |||| ||||||||||||||||| ||||| || ||||||||||| || 
Sbjct: 828  tggtatgagcatcgactcattgatgatatggtggcgtatgcacttaagagtgaaggaggt 887

                                                                        
Query: 966  tatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggt 1025
            ||||| ||||| ||||| || |||||||||||||| ||||| ||| |  | |||||||||
Sbjct: 888  tatgtatgggcatgcaaaaactatgatggagatgtccagagtgatttcttagctcaaggt 947

                                                                        
Query: 1026 tttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaa 1085
            ||||||||  | ||| | |||||||| || ||||| ||||||||||| |  ||  |||||
Sbjct: 948  tttggatcactgggtttgatgacatctgtattggtttgccctgatggaaagactattgaa 1007

                                                                        
Query: 1086 gctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaa 1145
            || ||||| || ||||| ||||| || || ||||  || || || || || |||||||||
Sbjct: 1008 gcagaagcagcccacggcacagttacccgccattttagggttcatcagaagggaggcgaa 1067

                                                                        
Query: 1146 actagcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagggca 1205
            || |||||||| ||||| || || |||||||| ||| | |  ||  |||| || ||||||
Sbjct: 1068 accagcacaaatagcatagcatccatctttgcctggacaagagggctagcccacagggca 1127

                          
Query: 1206 aagctggatgacaa 1219
            || |||||||||||
Sbjct: 1128 aaactggatgacaa 1141



 Score =  172 bits (87), Expect = 3e-39
 Identities = 336/419 (80%)
 Strand = Plus / Plus

                                                                       
Query: 177 gcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgaca 236
           |||||| |||||||| |||| |||||||||||||||||||||||||| ||||| ||||| 
Sbjct: 93  gcgttccagaagatcaaggtcgccaaccccatcgtcgagatggacggagatgaaatgact 152

                                                                       
Query: 237 cgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctggacata 296
            |  |||| ||||| |  ||||| || ||||| || || || ||| ||||  ||||||| 
Sbjct: 153 agggttatctggaagtcaatcaaggacaagctcattttgcccttcttggagttggacatc 212

                                                                       
Query: 297 aaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgatagaa 356
           || || | ||||||||| || ||| ||||||| |  || |  |||||||| || || |||
Sbjct: 213 aagtattatgacttaggccttccttaccgtgatgagaccgatgataaagttacaattgaa 272

                                                                       
Query: 357 agtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccccagat 416
           ||||| ||||| || || |||||||| ||||| || || || |||||| | || ||||||
Sbjct: 273 agtgcggaagcaactctcaagtataatgtggcaattaagtgcgcaactattactccagat 332

                                                                       
Query: 417 gaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaata 476
           ||||  || || || ||||||  | | ||  | ||||||| |||||||||||||||||| 
Sbjct: 333 gaagctcgtgtgaaggagtttggtctgaagtcaatgtggaagagtccaaatgggacaatt 392

                                                                       
Query: 477 aggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcctcgg 536
           |||||||| || ||||||||||| ||| ||||||||||  | ||||| ||  |||| || 
Sbjct: 393 aggaacattttgaatggaactgtcttcagagaaccaattctttgcaaaaacattccccgc 452

                                                                      
Query: 537 cttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaata 595
           ||||| ||||| ||||||||  | ||||||||||| |||||||| ||||||||||||||
Sbjct: 453 cttgttcctggttggacaaaggcaatatgcattggaagacatgcgtttggtgatcaata 511



to top

>gb|AY509880.1| Pisum sativum NADP-dependent isocitrate dehydrogenase mRNA, complete
            cds
          Length = 1564

 Score =  176 bits (89), Expect = 2e-40
 Identities = 260/317 (82%)
 Strand = Plus / Plus

                                                                        
Query: 903  atatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggt 962
            ||||||||||| ||| |||| ||||||||||||||||| ||||| || ||||||||||| 
Sbjct: 814  atatggtatgagcatcgactcattgatgatatggtggcatatgcactcaagagtgaagga 873

                                                                        
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaa 1022
            || ||||| ||||| |||||||| |||||||||||||| ||||| ||| |  | ||||||
Sbjct: 874  ggttatgtatgggcatgcaagaactatgatggagatgtccagagtgatttcttagctcaa 933

                                                                        
Query: 1023 ggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagtt 1082
            |||||||||||||| ||| | |||||||| || ||||| ||||||||||| |  ||  ||
Sbjct: 934  ggttttggatcgttgggtttgatgacatctgtattggtttgccctgatgggaagactatt 993

                                                                        
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggc 1142
            ||||| ||||| || || || ||||| || || |||| ||| || || ||||| || || 
Sbjct: 994  gaagcagaagcagcccatgggacagttacccgtcatttcagggttcatcaaaagggcgga 1053

                                                                        
Query: 1143 gaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagg 1202
            ||||| ||||||||| |||| || || |||||||| ||| | |  ||  |||| ||||||
Sbjct: 1054 gaaaccagcacaaacggcatagcatccatctttgcttggacaagaggtctagcccatagg 1113

                             
Query: 1203 gcaaagctggatgacaa 1219
            |||||||| ||||||||
Sbjct: 1114 gcaaagctagatgacaa 1130



 Score =  139 bits (70), Expect = 5e-29
 Identities = 127/146 (86%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||||||||||||||| || ||||| || ||||||||||| ||| |||||
Sbjct: 355 atgtggaggagtccaaatgggacaattagaaacattttgaatggaactgtcttcagagaa 414

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| || ||||| ||||| ||||| ||| | ||||| |||||||| || ||||| |||
Sbjct: 415 ccaattatttgcaaaaatgtccctcgccttattcctggttggacaaagccaatatgtatt 474

                                     
Query: 570 ggcagacatgcttttggtgatcaata 595
           || || ||||||||||||||||||||
Sbjct: 475 ggaaggcatgcttttggtgatcaata 500



 Score = 97.6 bits (49), Expect = 2e-16
 Identities = 175/217 (80%)
 Strand = Plus / Plus

                                                                       
Query: 204 cccatcgtcgagatggacggtgatgagatgacacgaattatatggaaatggatcaaagat 263
           |||||||| ||||||||||| ||||| ||||| ||| |||| ||||| |  ||||| |||
Sbjct: 109 cccatcgttgagatggacggagatgaaatgacccgagttatctggaagtcaatcaaggat 168

                                                                       
Query: 264 aagcttatatttcctttcctggacctggacataaaatactttgacttaggtctacctaac 323
           ||||| || ||||||||| ||||  ||||||| || ||||||||| |||| || ||| | 
Sbjct: 169 aagctcatttttcctttcttggagttggacatcaagtactttgacctaggccttcctcat 228

                                                                       
Query: 324 cgtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagtataac 383
           |||||    ||||  |||||||| ||  | |||||||| ||||| || || |||||||| 
Sbjct: 229 cgtgatcagactgatgataaagttacagttgaaagtgccgaagcaactctcaagtataat 288

                                                
Query: 384 gtggccatcaaatgtgcaactgtcaccccagatgaag 420
           || || ||||| ||||||||| |||| ||||||||||
Sbjct: 289 gttgcaatcaagtgtgcaactatcactccagatgaag 325



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 111/139 (79%)
 Strand = Plus / Plus

                                                                       
Query: 715 ctatgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggctt 774
           ||||||| ||||||||||||||||||||  | |||||||| || || |||   |  ||||
Sbjct: 626 ctatgtacaacactgatgagtctattcgttcttttgctgaggcatctatggcaactgctt 685

                                                                       
Query: 775 accagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacg 834
              |||| | |||||||||||||||||| || || || ||||| || || |||||||| |
Sbjct: 686 tagagaaaaaatggccactttatcttagcaccaaaaatacaattcttaagaaatatgatg 745

                              
Query: 835 gaaggtttaaagacatatt 853
           |||| || || ||||||||
Sbjct: 746 gaagattcaaggacatatt 764



to top

>gb|AY107138.1| Zea mays PCO115488 mRNA sequence
          Length = 1634

 Score =  176 bits (89), Expect = 2e-40
 Identities = 260/317 (82%)
 Strand = Plus / Plus

                                                                        
Query: 903  atatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggt 962
            ||||||||||| ||  | || || ||||| ||||| || || || || ||||||||||| 
Sbjct: 858  atatggtatgagcaccgccttatcgatgacatggtagcatacgcacttaagagtgaagga 917

                                                                        
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaa 1022
            || ||||| ||||||||||||||||||||||||||||||||||||||| |  | ||||||
Sbjct: 918  gggtatgtctgggcttgcaagaattatgatggagatgtgcagagcgatttcttagctcaa 977

                                                                        
Query: 1023 ggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagtt 1082
            |||||||| || || ||| | ||||| |||||  |||||||||||||||| |  ||  | 
Sbjct: 978  ggttttggctcattgggtttgatgacttcggtactggtgtgccctgatggaaagacgatc 1037

                                                                        
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggc 1142
            |||||||||||||| || ||||| || || || |||||| | || ||||| |||||||| 
Sbjct: 1038 gaagctgaagctgcccatggtactgttacccgtcattaccgtgttcaccagaaaggaggt 1097

                                                                        
Query: 1143 gaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagg 1202
            |||||||| || ||||| ||||| ||||||||||| ||| | |  ||| | ||||| |||
Sbjct: 1098 gaaactagtacgaacagtattgcctcaatctttgcgtggacaagaggacttgcacacagg 1157

                             
Query: 1203 gcaaagctggatgacaa 1219
            |||||||| ||||||||
Sbjct: 1158 gcaaagcttgatgacaa 1174



 Score =  115 bits (58), Expect = 7e-22
 Identities = 322/410 (78%)
 Strand = Plus / Plus

                                                                       
Query: 447 gctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccga 506
           |||||||||| ||| |||||||| ||||| ||||| ||  | ||||| ||||| ||| ||
Sbjct: 402 gctatgtggaagagcccaaatggcacaattaggaatattctgaatggcactgtgttcaga 461

                                                                       
Query: 507 gaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgc 566
           ||||||||||||||||| ||  | || |||||||| || || |||||||||||||| |||
Sbjct: 462 gaaccaatcatctgcaaaaacatcccacggcttgttccagggtggacaaaacccatttgc 521

                                                                       
Query: 567 attggcagacatgcttttggtgatcaataccgagcaacagatataatcattagagggaca 626
           || || || ||||| || |||||||| ||||| ||||| |||  | | || |  ||| ||
Sbjct: 522 atcgggaggcatgcattcggtgatcagtaccgggcaactgatgcagttatcaaggggcca 581

                                                                       
Query: 627 gggaagctcaagttgatatttgatggcatagaggaacaaatagagttggatgtgttcaac 686
           |||||||| || ||  | ||||| || | ||| || ||| | ||| |||| |||||||||
Sbjct: 582 gggaagcttaaattagtttttgagggaaaagaagagcaagttgagctggaggtgttcaac 641

                                                                       
Query: 687 tttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcgagca 746
           || | |||||| || ||||| || ||||| ||||| |||||||| ||||| || |  || 
Sbjct: 642 ttcactggtgcaggaggagttgccttatcaatgtacaacactgacgagtccatccatgcc 701

                                                                       
Query: 747 tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
           |||||||| ||||| |||  ||  |||||  | |||| ||||||| | |||||||| || 
Sbjct: 702 tttgctgacgcttctatggccactgcttatgaaaagaaatggccattgtatcttagcacc 761

                                                             
Query: 807 aagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattcca 856
           || ||||| ||  |||| |||||||| || ||||| || ||||| |||||
Sbjct: 762 aaaaacactattttgaagaaatatgatggcaggttcaaggacattttcca 811



 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 111/136 (81%)
 Strand = Plus / Plus

                                                                       
Query: 173 catggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagat 232
           |||||| ||| | |||||| ||||  |||||||| |||||||||||||||| ||||||||
Sbjct: 128 catggccttcaacaagatcaaggtctccaaccccgtcgtcgagatggacggcgatgagat 187

                                                                       
Query: 233 gacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgga 292
           |||  |  |  | |||||||  ||||| || ||||||||||| |||||| | ||||| ||
Sbjct: 188 gaccagggtgttctggaaatctatcaaggacaagcttatattccctttcgtagacctcga 247

                           
Query: 293 cataaaatactttgac 308
           ||| ||||| ||||||
Sbjct: 248 catcaaatattttgac 263



to top

>gb|AY572426.1| Capsicum annuum NADP-dependent isocitrate dehydrogenase mRNA,
           partial cds
          Length = 418

 Score =  174 bits (88), Expect = 9e-40
 Identities = 244/296 (82%)
 Strand = Plus / Plus

                                                                       
Query: 687 tttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcgagca 746
           |||| |||||||||||||||||| ||||| ||||| ||||| || ||||||||||| |||
Sbjct: 112 tttactggtgctggtggagtagctttatccatgtacaacacagacgagtctattcgcgca 171

                                                                       
Query: 747 tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
           |||||||| ||||| ||||||||||| ||||| |||| ||||||||| ||||||||||| 
Sbjct: 172 tttgctgatgcttcaatgaacatggcataccaaaagaaatggccactctatcttagtaca 231

                                                                       
Query: 807 aagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaactat 866
           ||||| || || || || |||||||| || ||||| || ||||| |||||| ||   |||
Sbjct: 232 aagaataccattcttaagaaatatgatgggaggttcaaggacatcttccaagaagtttat 291

                                                                       
Query: 867 gaaacaaattggagatgcaggtttgaggatgcaggaatatggtatgaacatagactgatt 926
           ||| ||| |||||  | || ||  ||||| || ||||| |||||||||||  | || || 
Sbjct: 292 gaagcaagttggaagtccaagtacgaggaggctggaatctggtatgaacaccgtcttatc 351

                                                                   
Query: 927 gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaa 982
           ||||||||||| || |||||  | |||||||||||||| ||||| ||||| |||||
Sbjct: 352 gatgatatggttgcttatgctttgaagagtgaaggtggttatgtatgggcctgcaa 407



to top

>dbj|AB019327.1| Daucus carota mRNA for NADP specific isocitrate dehydrogenase,
           complete cds
          Length = 1512

 Score =  172 bits (87), Expect = 3e-39
 Identities = 348/435 (80%)
 Strand = Plus / Plus

                                                                       
Query: 174 atggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatg 233
           ||||||||  |||||||| |||| || || ||||||||||| |||||||| ||||| |||
Sbjct: 93  atggcgtttcagaagatcaaggtcgcgaatcccatcgtcgaaatggacggagatgaaatg 152

                                                                       
Query: 234 acacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctggac 293
           || ||  |  | |||||||  ||||| || |||||||||||||| ||| | || ||||| 
Sbjct: 153 actcgtgtattctggaaatctatcaaggacaagcttatatttcccttcgttgagctggat 212

                                                                       
Query: 294 ataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgata 353
           ||||||||||||||| | || || ||| ||||||| || ||||  |||||||| ||  | 
Sbjct: 213 ataaaatactttgaccttggccttcctcaccgtgatgcaactgatgataaagttactgtt 272

                                                                       
Query: 354 gaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcacccca 413
           ||||||||||| |||||||| |||||||| || || ||||||||||||||  | ||||||
Sbjct: 273 gaaagtgcagaggctaccctcaagtataatgtagctatcaaatgtgcaacaattacccca 332

                                                                       
Query: 414 gatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggaca 473
           |||||||  || || || ||||||   || |||   ||||||| ||||||||||||||||
Sbjct: 333 gatgaagctcgtgtgaaggagtttggcttgaaacagatgtggaagagtccaaatgggaca 392

                                                                       
Query: 474 ataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcct 533
           || || || || ||||| || || || ||  | |||||||| || ||||| ||| | || 
Sbjct: 393 attagaaatattttaaacggcacggtatttagggaaccaattatatgcaaaaatatccca 452

                                                                       
Query: 534 cggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaa 593
             |||  | ||||| |||||||| || ||||||||||| |||||||||||||| ||||| 
Sbjct: 453 aagctcatccctgggtggacaaagccaatatgcattggaagacatgcttttggcgatcag 512

                          
Query: 594 taccgagcaacagat 608
           ||||| |||||||||
Sbjct: 513 taccgcgcaacagat 527



 Score =  147 bits (74), Expect = 2e-31
 Identities = 395/502 (78%)
 Strand = Plus / Plus

                                                                        
Query: 683  caactttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcg 742
            |||||| | ||||||||| || || || || || ||||| ||||||||||||||||||||
Sbjct: 608  caacttcactggtgctggaggtgttgctttgtcgatgtacaacactgatgagtctattcg 667

                                                                        
Query: 743  agcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttag 802
              | |||||||||||||| |||  ||  |||||  | ||||  |||||||||||||||||
Sbjct: 668  ttcttttgctgaagcttcaatggccacagcttatgaaaagaagtggccactttatcttag 727

                                                                        
Query: 803  tacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaa 862
             || || || || || ||||| |||||||| ||||| ||||| |||||||||||| ||  
Sbjct: 728  cacaaaaaatactattctgaagaaatatgatggaagatttaaggacatattccaagaagt 787

                                                                        
Query: 863  ctatgaaacaaattggagatgcaggtttgaggatgcaggaatatggtatgaacatagact 922
             |||||| | |  |||| ||  | || ||| | |||||| |||||||| || ||  | ||
Sbjct: 788  ttatgaagccagctggaaatcgaagtatgatgctgcagggatatggtacgagcaccgtct 847

                                                                        
Query: 923  gattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaa 982
             |||||||||||||| || ||||| || || ||||| || || ||||| ||||| |||||
Sbjct: 848  tattgatgatatggttgcatatgctcttaaaagtgatggaggttatgtctgggcatgcaa 907

                                                                        
Query: 983  gaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtct 1042
             ||||||||||| ||||| || || ||| |  |||||||||||||||||||  | ||  |
Sbjct: 908  aaattatgatggggatgtccaaagtgatttccttgctcaaggttttggatctctggggtt 967

                                                                        
Query: 1043 catgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacgg 1102
             |||||||| ||  |||| ||||||||||| |  ||  | ||||||||||| || || ||
Sbjct: 968  gatgacatcagtcctggtatgccctgatggaaagaccatagaagctgaagcagcccatgg 1027

                                                                        
Query: 1103 tacagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcat 1162
             || || || || |||||||| || || || || || || || || ||||||||||||||
Sbjct: 1028 cactgttacccggcattacagggttcatcagaagggtggagagaccagcacaaacagcat 1087

                                  
Query: 1163 tgcgtcaatctttgcatggtct 1184
             || ||||||||||||||||||
Sbjct: 1088 agcatcaatctttgcatggtct 1109



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1243 aaaaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctag 1302
            |||| ||||| ||||||||||| || || ||||| ||||| |||||||| ||||| || |
Sbjct: 1168 aaaagcttgaggctgcttgtgttggtactgtggagtctgggaagatgactaaggatcttg 1227

                
Query: 1303 ctct 1306
            ||||
Sbjct: 1228 ctct 1231



to top

>gb|BT017177.1| Zea mays clone EL01N0369B08.c mRNA sequence
          Length = 1434

 Score =  168 bits (85), Expect = 5e-38
 Identities = 259/317 (81%)
 Strand = Plus / Plus

                                                                        
Query: 903  atatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggt 962
            ||||||||||| ||  | || || ||||| ||||| || || || || ||||||||||| 
Sbjct: 635  atatggtatgagcaccgccttatcgatgacatggtagcatacgcacttaagagtgaagga 694

                                                                        
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaa 1022
            || ||||| ||||||||||||||||||||||||||||||||||||||| |  | ||||||
Sbjct: 695  gggtatgtctgggcttgcaagaattatgatggagatgtgcagagcgatttcttagctcaa 754

                                                                        
Query: 1023 ggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagtt 1082
            ||||| || || || ||| | |||||||||||  |||||||||||||||| |  ||  | 
Sbjct: 755  ggtttcggctcattgggtttgatgacatcggtactggtgtgccctgatggaaagacgatc 814

                                                                        
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggc 1142
            |||||||||||||| || ||||| || || || |||||| | || ||||| |||||||| 
Sbjct: 815  gaagctgaagctgcccatggtactgttacccgtcattaccgtgttcaccagaaaggaggt 874

                                                                        
Query: 1143 gaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagg 1202
            ||||| || || ||||| ||||| ||||||||||| ||| | |  ||| | ||||| |||
Sbjct: 875  gaaaccagtacgaacagtattgcctcaatctttgcgtggacaagaggacttgcacacagg 934

                             
Query: 1203 gcaaagctggatgacaa 1219
            |||||||| ||||||||
Sbjct: 935  gcaaagcttgatgacaa 951



 Score = 99.6 bits (50), Expect = 4e-17
 Identities = 320/410 (78%)
 Strand = Plus / Plus

                                                                       
Query: 447 gctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccga 506
           |||||||||| ||| |||||||| ||||| ||||| ||  | ||||| ||||| ||| ||
Sbjct: 179 gctatgtggaagagcccaaatggcacaattaggaatattctgaatggcactgtgttcaga 238

                                                                       
Query: 507 gaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgc 566
           ||||||||||||||||| ||  | || |||||||| || || |||||||| ||||| |||
Sbjct: 239 gaaccaatcatctgcaaaaacatcccacggcttgttccagggtggacaaagcccatttgc 298

                                                                       
Query: 567 attggcagacatgcttttggtgatcaataccgagcaacagatataatcattagagggaca 626
           ||||| || ||||| || || ||||| ||||| ||||| |||  | | || |  ||| | 
Sbjct: 299 attgggaggcatgcattcggcgatcagtaccgggcaactgatgcagttatcaaggggccg 358

                                                                       
Query: 627 gggaagctcaagttgatatttgatggcatagaggaacaaatagagttggatgtgttcaac 686
           |||||||| || ||  | ||||| || | ||| || ||| | ||| |||| |||||||||
Sbjct: 359 gggaagcttaaattagtttttgagggaaaagaagagcaagttgagctggaggtgttcaac 418

                                                                       
Query: 687 tttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcgagca 746
           || | |||||| || ||||| || ||||| ||||| |||||||| ||||| || |  || 
Sbjct: 419 ttcactggtgccggaggagttgccttatcaatgtacaacactgacgagtccatccatgcc 478

                                                                       
Query: 747 tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
           |||||||| ||||| |||  ||  |||||  | |||| ||||||| | |||||||| || 
Sbjct: 479 tttgctgacgcttctatggccactgcttatgaaaagaaatggccattgtatcttagcacc 538

                                                             
Query: 807 aagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattcca 856
           || ||||| ||  |||| |||||||| || ||||| || ||||| |||||
Sbjct: 539 aaaaacactattttgaagaaatatgatggcaggttcaaggacattttcca 588



to top

>emb|AJ437269.1|CSA437269 Cucumis sativus mRNA for isocitrate dehydrogenase
          Length = 1551

 Score =  168 bits (85), Expect = 5e-38
 Identities = 391/493 (79%)
 Strand = Plus / Plus

                                                                        
Query: 692  tggtgctggtggagtagcattatctatgtataacactgatgagtctattcgagcatttgc 751
            ||||||||| ||||| || ||| | |||||||||||||||||||| || ||| | |||||
Sbjct: 577  tggtgctggaggagttgcgttagccatgtataacactgatgagtccatccgatcttttgc 636

                                                                        
Query: 752  tgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacgaagaa 811
            ||| || || |||  ||  |||||  |||||| |||||| ||||| ||||| || || ||
Sbjct: 637  tgaggcatcaatggccactgcttatgagaagaaatggcccctttaccttagcacaaaaaa 696

                                                                        
Query: 812  cacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaactatgaaac 871
             || || || || ||||| || ||||| || || || ||||||||| ||  ||| ||| |
Sbjct: 697  tactattctaaagaaatacgatggaagattcaaggatatattccaagaagtctacgaatc 756

                                                                        
Query: 872  aaattggagatgcaggtttgaggatgcaggaatatggtatgaacatagactgattgatga 931
              | |||| ||  | |||||||| ||| || ||||||||||||||  | || || |||||
Sbjct: 757  tcagtggaaatcaaagtttgaggctgctggcatatggtatgaacaccgtctcatcgatga 816

                                                                        
Query: 932  tatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaattatga 991
            ||||||||| |||||||| ||||||||||| || ||||| ||||| |||||||| |||||
Sbjct: 817  tatggtggcttatgcccttaagagtgaaggaggttatgtctgggcatgcaagaactatga 876

                                                                        
Query: 992  tggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtctcatgacatc 1051
            ||||||||| ||||| ||| |  | |||||||| ||||||||  | ||  | ||||| ||
Sbjct: 877  tggagatgttcagagtgatttcttagctcaaggatttggatctcttggcttgatgacttc 936

                                                                        
Query: 1052 ggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcac 1111
             || ||||| || |||||||| | |||| ||||||| ||||| || || || || || ||
Sbjct: 937  tgtattggtttgtcctgatggaaaaacaattgaagcagaagcagctcatggcactgttac 996

                                                                        
Query: 1112 acgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaat 1171
            ||||||||  || || || |||||||| || ||||| |||||||||||||| || || ||
Sbjct: 997  acgacattttagggttcatcaaaaaggtggtgaaaccagcacaaacagcatagcatccat 1056

                         
Query: 1172 ctttgcatggtct 1184
            |||||| ||||||
Sbjct: 1057 ctttgcttggtct 1069



 Score =  105 bits (53), Expect = 7e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| ||||||||||| ||||| ||||| ||  | ||||||||||| ||| |||||
Sbjct: 338 atgtggagaagtccaaatggaacaatcaggaatattctgaatggaactgtcttcagagaa 397

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || ||  | ||||| ||||||||||| ||||| || || ||||| || || || || |||
Sbjct: 398 ccgattctttgcaaaaatgttcctcgccttgtaccaggttggacgaagcctatctgtatt 457

                                                                
Query: 570 ggcagacatgcttttggtgatcaataccgagcaacagatataatcattagagg 622
           || |||||||||||||||||||||||| |||| || |||| | |||| |||||
Sbjct: 458 ggaagacatgcttttggtgatcaatacagagctactgatacagtcatcagagg 510



 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 184/232 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           ||||||| ||| |||||||| |||| ||||| |||||||| ||||||||||| ||||| |
Sbjct: 60  ccatggctttccagaagatcaaggtcgccaatcccatcgttgagatggacggagatgaaa 119

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           |||| ||| |||| ||| | |  || ||  |||||||||| || || ||  ||||  |||
Sbjct: 120 tgactcgagttatctgggagtcaattaagaataagcttattttcccatttttggaattgg 179

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           |||| || || |||||| | || || ||  ||||||| || || |  |||||||| || |
Sbjct: 180 acatcaagtattttgaccttggccttccacaccgtgatgccacagatgataaagttacaa 239

                                                               
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaac 403
           | |||||||||||||||||  ||||||| || || || ||||||||||||||
Sbjct: 240 ttgaaagtgcagaagctactttaaagtacaatgtagcaatcaaatgtgcaac 291



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                
Query: 1272 gtggaatctggaaagatgacaaaggacctagctctt 1307
            |||||||||||||||||||| ||||| || ||||||
Sbjct: 1157 gtggaatctggaaagatgaccaaggatcttgctctt 1192



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1355 ggagttcattgatgcggttgctgagga 1381
            ||||||||||||||| |||||||||||
Sbjct: 1240 ggagttcattgatgctgttgctgagga 1266



to top

>gb|M93672.1|ALFISDHYA Medicago sativa isocitrate dehydrogenase mRNA, 3' end cds
          Length = 1577

 Score =  163 bits (82), Expect = 3e-36
 Identities = 319/398 (80%)
 Strand = Plus / Plus

                                                                       
Query: 198 gccaaccccatcgtcgagatggacggtgatgagatgacacgaattatatggaaatggatc 257
           ||||| |||||||| ||||||||||| ||||| ||||| || ||||| ||||| |  |||
Sbjct: 90  gccaatcccatcgttgagatggacggagatgaaatgacccgtattatctggaagtatatc 149

                                                                       
Query: 258 aaagataagcttatatttcctttcctggacctggacataaaatactttgacttaggtcta 317
           || |||||||| || ||||| ||| ||||  ||||||| || ||||||||| |||| || 
Sbjct: 150 aaggataagctcatttttcccttcgtggagttggacatcaagtactttgacctaggcctt 209

                                                                       
Query: 318 cctaaccgtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaag 377
           ||| | ||||| |  ||    |||||||| ||  | || ||||||||||| ||||| |||
Sbjct: 210 ccttatcgtgatgagaccaatgataaagttacagttgagagtgcagaagcaaccctcaag 269

                                                                       
Query: 378 tataacgtggccatcaaatgtgcaactgtcaccccagatgaaggacgcgtaaaagagttt 437
           ||||| || || ||||| ||||||||| |||| ||||||||||  || || || ||||||
Sbjct: 270 tataatgtagcaatcaagtgtgcaactatcactccagatgaagctcgtgtcaaggagttt 329

                                                                       
Query: 438 aatttaaaagctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaact 497
               | ||   ||||||||||||||||||||| ||||| || ||||| || |||||||||
Sbjct: 330 ggcctgaagagtatgtggaggagtccaaatggaacaatcagaaacattttgaatggaact 389

                                                                       
Query: 498 gttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaa 557
           || ||| |||||||||| || ||||| ||  | ||||| ||| | ||||| |||||||| 
Sbjct: 390 gtcttcagagaaccaattatttgcaaaaacatccctcgccttattcctggttggacaaag 449

                                                 
Query: 558 cccatatgcattggcagacatgcttttggtgatcaata 595
           || ||||| ||||| || ||||||||||||||||||||
Sbjct: 450 ccaatatgtattggaaggcatgcttttggtgatcaata 487



 Score =  141 bits (71), Expect = 1e-29
 Identities = 344/435 (79%)
 Strand = Plus / Plus

                                                                        
Query: 785  atggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaa 844
            |||||||||||||||||| || || || ||||| || || |||||||| ||||| || ||
Sbjct: 683  atggccactttatcttagcaccaaaaatacaattcttaagaaatatgatggaagattcaa 742

                                                                        
Query: 845  agacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaat 904
             |||||||| ||| ||   |||||  ||   |||| ||  | || ||||| ||| || ||
Sbjct: 743  ggacatatttcaagaagtttatgaggcaggctggaaatcaaagtatgaggctgctggtat 802

                                                                        
Query: 905  atggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtgg 964
            ||||||||| ||  | || ||||||||||||||||| ||||| || ||||||||||| ||
Sbjct: 803  atggtatgagcaccggctcattgatgatatggtggcatatgcactcaagagtgaaggagg 862

                                                                        
Query: 965  ctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaagg 1024
             ||||| ||||| ||||| || |||||||||||||| ||||| ||| |  | ||||||||
Sbjct: 863  ttatgtatgggcatgcaaaaactatgatggagatgtccagagtgatttcttagctcaagg 922

                                                                        
Query: 1025 ttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttga 1084
            ||||||||| || ||| | ||||| || || ||||| ||||||||||| |  ||  | ||
Sbjct: 923  ttttggatcattgggtttgatgacttctgtattggtttgccctgatgggaagaccataga 982

                                                                        
Query: 1085 agctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcga 1144
            ||| ||||| || || || ||||| || || |||| ||| || |||||||| || || ||
Sbjct: 983  agcagaagcagcccatgggacagttacccgtcatttcagggttcaccaaaagggtggaga 1042

                                                                        
Query: 1145 aactagcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagggc 1204
            ||| |||||||| ||||| || || |||||||| ||| | |  ||  |||| ||||||||
Sbjct: 1043 aaccagcacaaatagcatagcatccatctttgcttggacaagaggtctagcccatagggc 1102

                           
Query: 1205 aaagctggatgacaa 1219
            ||| |||||||||||
Sbjct: 1103 aaaactggatgacaa 1117



to top

>dbj|AB019328.1| Daucus carota mRNA for NADP specific isocitrate dehydrogenase,
            complete cds
          Length = 1488

 Score =  153 bits (77), Expect = 3e-33
 Identities = 407/517 (78%)
 Strand = Plus / Plus

                                                                        
Query: 668  agagttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacac 727
            |||||| || || |||||||||| ||| ||||| ||||||||  | || ||||| |||||
Sbjct: 591  agagttagaggttttcaactttactggcgctggaggagtagctctttcaatgtacaacac 650

                                                                        
Query: 728  tgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatg 787
            ||| ||||| ||||  || |||||||| ||||| |||||||  |||||||| || |||||
Sbjct: 651  tgacgagtccattcatgcttttgctgaggcttctatgaacacagcttaccaaaaaagatg 710

                                                                        
Query: 788  gccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaaga 847
            |||||| |||||||| || ||||| || ||||| || ||||| || ||||| ||||| ||
Sbjct: 711  gccactatatcttagcactaagaatactatccttaagaaatacgatggaagatttaagga 770

                                                                        
Query: 848  catattccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaatatg 907
             || |||||| ||   ||||||| | | ||||  |  | ||||||   || |||||||||
Sbjct: 771  tattttccaagaagtttatgaaaaagagtggaagtcaaagtttgaatctgtaggaatatg 830

                                                                        
Query: 908  gtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggcta 967
            |||||| ||| |  | |||||||||||||| || ||||| || ||||| || || || ||
Sbjct: 831  gtatgagcatcgcttaattgatgatatggttgcttatgctcttaagagcgatggaggtta 890

                                                                        
Query: 968  tgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttt 1027
            ||| ||||| ||||| || |||||||||||||| || || ||  |  | || ||||| ||
Sbjct: 891  tgtatgggcatgcaaaaactatgatggagatgtccaaagtgactttttagcccaaggatt 950

                                                                        
Query: 1028 tggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagc 1087
             |||||  | ||| | |||||||| ||  |||| ||||| ||||| |  ||  |||||||
Sbjct: 951  cggatctcttggtttgatgacatctgtactggtatgcccggatggaaagaccattgaagc 1010

                                                                        
Query: 1088 tgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaac 1147
            |||||| || || || ||||| || || |||||  | ||||| ||||||||||| |||||
Sbjct: 1011 tgaagcagcccatggcacagttactcgtcattatcgtgtccatcaaaaaggaggtgaaac 1070

                                                 
Query: 1148 tagcacaaacagcattgcgtcaatctttgcatggtct 1184
            |||||| |||||||| || ||||||||||| ||||||
Sbjct: 1071 tagcactaacagcatagcttcaatctttgcttggtct 1107



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 126/152 (82%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| |||||| || ||||| ||  | ||||| |||||||||||||||||||| |||
Sbjct: 367 atgtggaagagtccgaacgggactattcgtaacatattaaatggaactgttttccgcgaa 426

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           |||||||| ||||| ||| | || || ||||| |  || ||||  || || |||||||||
Sbjct: 427 ccaatcatttgcaaaaatataccgcgacttgtccaaggctggaataagccaatatgcatt 486

                                           
Query: 570 ggcagacatgcttttggtgatcaataccgagc 601
           ||||| ||||||||||| |||||||| |||||
Sbjct: 487 ggcaggcatgcttttggagatcaatatcgagc 518



to top

>gb|BT025983.1| Arabidopsis thaliana At1g54340 mRNA, complete cds
          Length = 1251

 Score =  149 bits (75), Expect = 5e-32
 Identities = 369/467 (79%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            |||||||||||||||||||||||||| |||||||||||  | |||||| |||  ||||||
Sbjct: 547  atgtataacactgatgagtctattcgtgcatttgctgagtcctcgatgtacacagcttac 606

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
            ||||| |  ||||||||||| ||    || || ||||| ||||| |||| |||||| |||
Sbjct: 607  cagaaaaagtggccactttacctctccacaaaaaacaccatcctcaaaatatatgatgga 666

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || || || ||||||||| ||   |||||| | || ||||||| || || ||| |  
Sbjct: 667  agattcaaggatatattccaagaagtttatgaagctaactggagatccaagtatgaagca 726

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            ||||| ||||||||||| ||| |  |||| ||||||||||| || |||||| | || |||
Sbjct: 727  gcagggatatggtatgagcatcgtttgatagatgatatggttgcatatgccatgaaaagt 786

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            ||||| || || || ||||| ||||||||||| ||||||||||| ||||||||| |  | 
Sbjct: 787  gaagggggttacgtctgggcatgcaagaattacgatggagatgtacagagcgatttctta 846

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| | ||||||  | ||  | ||||| ||||| ||||| || || ||||| |  
Sbjct: 847  gcccaaggatatggatctctgggaatgatgacttcggtgttggtttgtccagatggaaag 906

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||| ||||| || || || ||||| ||||| || |||||||| ||||| |||
Sbjct: 907  accattgaagcagaagcagctcatggcacagttacacgccactacagagttcaccagaaa 966

                                                           
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            || || ||||| ||||| |||||||| || || || ||||| |||||
Sbjct: 967  ggtggtgaaacaagcaccaacagcatagcctctatttttgcttggtc 1013



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||| ||||| || ||||||||||| ||||| || || |||||| | |||
Sbjct: 277 atgtggaggagtcctaatggaactataaggaacattttaaacggcacagttttcagggaa 336

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || ||||| ||||  ||  | ||||| ||||| || |||||||| || || || || |||
Sbjct: 337 cctatcatttgcagaaacatccctcgtcttgttccaggatggacgaagccaatctgtatt 396

                                  
Query: 570 ggcagacatgcttttggtgatca 592
           || || |||||||||||||||||
Sbjct: 397 ggaaggcatgcttttggtgatca 419



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 231 atgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctg 290
           ||||| ||| |||| |||||||  |||||||| |||||||| || ||||||||||| |||
Sbjct: 58  atgactcgagttatctggaaattcatcaaagacaagcttattttccctttcctggagctg 117

                            
Query: 291 gacataaaatactttga 307
           || || |||||||||||
Sbjct: 118 gatatcaaatactttga 134



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1245 aaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagct 1304
            ||||| ||||| |||||  ||||||| ||||| ||||| || ||||| ||||| ||||||
Sbjct: 1075 aaactagaagcagcttgcatggggacggtggagtctggcaaaatgaccaaggatctagct 1134

                       
Query: 1305 cttctcatcca 1315
            ||||| |||||
Sbjct: 1135 cttctgatcca 1145



to top

>ref|NM_104312.2| Arabidopsis thaliana ICDH (isocitrate dehydrogenase); isocitrate
            dehydrogenase (NADP+)/ oxidoreductase (ICDH) mRNA,
            complete cds
          Length = 1571

 Score =  149 bits (75), Expect = 5e-32
 Identities = 369/467 (79%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            |||||||||||||||||||||||||| |||||||||||  | |||||| |||  ||||||
Sbjct: 587  atgtataacactgatgagtctattcgtgcatttgctgagtcctcgatgtacacagcttac 646

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
            ||||| |  ||||||||||| ||    || || ||||| ||||| |||| |||||| |||
Sbjct: 647  cagaaaaagtggccactttacctctccacaaaaaacaccatcctcaaaatatatgatgga 706

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || || || ||||||||| ||   |||||| | || ||||||| || || ||| |  
Sbjct: 707  agattcaaggatatattccaagaagtttatgaagctaactggagatccaagtatgaagca 766

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            ||||| ||||||||||| ||| |  |||| ||||||||||| || |||||| | || |||
Sbjct: 767  gcagggatatggtatgagcatcgtttgatagatgatatggttgcatatgccatgaaaagt 826

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            ||||| || || || ||||| ||||||||||| ||||||||||| ||||||||| |  | 
Sbjct: 827  gaagggggttacgtctgggcatgcaagaattacgatggagatgtacagagcgatttctta 886

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| | ||||||  | ||  | ||||| ||||| ||||| || || ||||| |  
Sbjct: 887  gcccaaggatatggatctctgggaatgatgacttcggtgttggtttgtccagatggaaag 946

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||| ||||| || || || ||||| ||||| || |||||||| ||||| |||
Sbjct: 947  accattgaagcagaagcagctcatggcacagttacacgccactacagagttcaccagaaa 1006

                                                           
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            || || ||||| ||||| |||||||| || || || ||||| |||||
Sbjct: 1007 ggtggtgaaacaagcaccaacagcatagcctctatttttgcttggtc 1053



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||| ||||| || ||||||||||| ||||| || || |||||| | |||
Sbjct: 317 atgtggaggagtcctaatggaactataaggaacattttaaacggcacagttttcagggaa 376

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || ||||| ||||  ||  | ||||| ||||| || |||||||| || || || || |||
Sbjct: 377 cctatcatttgcagaaacatccctcgtcttgttccaggatggacgaagccaatctgtatt 436

                                  
Query: 570 ggcagacatgcttttggtgatca 592
           || || |||||||||||||||||
Sbjct: 437 ggaaggcatgcttttggtgatca 459



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 231 atgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctg 290
           ||||| ||| |||| |||||||  |||||||| |||||||| || ||||||||||| |||
Sbjct: 98  atgactcgagttatctggaaattcatcaaagacaagcttattttccctttcctggagctg 157

                            
Query: 291 gacataaaatactttga 307
           || || |||||||||||
Sbjct: 158 gatatcaaatactttga 174



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1245 aaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagct 1304
            ||||| ||||| |||||  ||||||| ||||| ||||| || ||||| ||||| ||||||
Sbjct: 1115 aaactagaagcagcttgcatggggacggtggagtctggcaaaatgaccaaggatctagct 1174

                       
Query: 1305 cttctcatcca 1315
            ||||| |||||
Sbjct: 1175 cttctgatcca 1185



to top

>gb|AF316501.1|AF316501 Arabidopsis thaliana NADP-specific isocitrate dehydrogenase (ICDH)
            mRNA, complete cds
          Length = 1551

 Score =  149 bits (75), Expect = 5e-32
 Identities = 369/467 (79%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            |||||||||||||||||||||||||| |||||||||||  | |||||| |||  ||||||
Sbjct: 567  atgtataacactgatgagtctattcgtgcatttgctgagtcctcgatgtacacagcttac 626

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
            ||||| |  ||||||||||| ||    || || ||||| ||||| |||| |||||| |||
Sbjct: 627  cagaaaaagtggccactttacctctccacaaaaaacaccatcctcaaaatatatgatgga 686

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || || || ||||||||| ||   |||||| | || ||||||| || || ||| |  
Sbjct: 687  agattcaaggatatattccaagaagtttatgaagctaactggagatccaagtatgaagca 746

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            ||||| ||||||||||| ||| |  |||| ||||||||||| || |||||| | || |||
Sbjct: 747  gcagggatatggtatgagcatcgtttgatagatgatatggttgcatatgccatgaaaagt 806

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            ||||| || || || ||||| ||||||||||| ||||||||||| ||||||||| |  | 
Sbjct: 807  gaagggggttacgtctgggcatgcaagaattacgatggagatgtacagagcgatttctta 866

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| | ||||||  | ||  | ||||| ||||| ||||| || || ||||| |  
Sbjct: 867  gcccaaggatatggatctctgggaatgatgacttcggtgttggtttgtccagatggaaag 926

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||| ||||| || || || ||||| ||||| || |||||||| ||||| |||
Sbjct: 927  accattgaagcagaagcagctcatggcacagttacacgccactacagagttcaccagaaa 986

                                                           
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            || || ||||| ||||| |||||||| || || || ||||| |||||
Sbjct: 987  ggtggtgaaacaagcaccaacagcatagcctctatttttgcttggtc 1033



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||| ||||| || ||||||||||| ||||| || || |||||| | |||
Sbjct: 297 atgtggaggagtcctaatggaactataaggaacattttaaacggcacagttttcagggaa 356

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || ||||| ||||  ||  | ||||| ||||| || |||||||| || || || || |||
Sbjct: 357 cctatcatttgcagaaacatccctcgtcttgttccaggatggacgaagccaatctgtatt 416

                                  
Query: 570 ggcagacatgcttttggtgatca 592
           || || |||||||||||||||||
Sbjct: 417 ggaaggcatgcttttggtgatca 439



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 231 atgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctg 290
           ||||| ||| |||| |||||||  |||||||| |||||||| || ||||||||||| |||
Sbjct: 78  atgactcgagttatctggaaattcatcaaagacaagcttattttccctttcctggagctg 137

                            
Query: 291 gacataaaatactttga 307
           || || |||||||||||
Sbjct: 138 gatatcaaatactttga 154



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1245 aaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagct 1304
            ||||| ||||| |||||  ||||||| ||||| ||||| || ||||| ||||| ||||||
Sbjct: 1095 aaactagaagcagcttgcatggggacggtggagtctggcaaaatgaccaaggatctagct 1154

                       
Query: 1305 cttctcatcca 1315
            ||||| |||||
Sbjct: 1155 cttctgatcca 1165



to top

>emb|X97063.1|EGNADPID Eucalyptus globulus subsp. bicostata mRNA for NADP-dependent
            isocitrate dehydrogenase
          Length = 894

 Score =  147 bits (74), Expect = 2e-31
 Identities = 335/422 (79%)
 Strand = Plus / Plus

                                                                        
Query: 762  atgaacatggcttaccagaagagatggccactttatcttagtacgaagaacacaatcctg 821
            |||||||  ||||| |||||||  ||||| || |||||||| || ||||| || ||||| 
Sbjct: 4    atgaacactgcttatcagaagaagtggccgctctatcttagcacaaagaataccatcctt 63

                                                                        
Query: 822  aaaaaatatgacggaaggtttaaagacatattccaacaaaactatgaaacaaattggaga 881
            ||||||||||| ||||| || || || ||||||||| ||   |||||| | || ||||  
Sbjct: 64   aaaaaatatgatggaagattcaaggatatattccaagaagtttatgaagccaactggaag 123

                                                                        
Query: 882  tgcaggtttgaggatgcaggaatatggtatgaacatagactgattgatgatatggtggcc 941
            |  | |||||||| ||| ||||| |||||||||||  | || ||||||||||||||||| 
Sbjct: 124  tcaaagtttgaggctgctggaatctggtatgaacaccgtcttattgatgatatggtggct 183

                                                                        
Query: 942  tatgccctaaagagtgaaggtggctatgtttgggcttgcaagaattatgatggagatgtg 1001
            ||||| |||||||| || || || ||||| ||||| |||||||| |||||||||||||| 
Sbjct: 184  tatgcgctaaagagcgacggaggttatgtgtgggcatgcaagaactatgatggagatgtc 243

                                                                        
Query: 1002 cagagcgatctaattgctcaaggttttggatcgttaggtctcatgacatcggttttggtg 1061
            ||||| ||| |  | || ||||| ||||||||| | ||  | |||||||| || ||||| 
Sbjct: 244  cagagtgatttcttagcccaagggtttggatcgcttggcttgatgacatctgtcttggtc 303

                                                                        
Query: 1062 tgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgacattac 1121
            ||||| || || | |||  ||||||| ||||| || || ||||| || || || ||||| 
Sbjct: 304  tgcccagacggaaaaactattgaagcagaagccgctcatggtacggttacccgccattat 363

                                                                        
Query: 1122 agagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatgg 1181
             | ||||| || |||||||||||||| ||||| || |||||||| || || ||||| |||
Sbjct: 364  cgggtccatcagaaaggaggcgaaaccagcactaatagcattgcttctatatttgcttgg 423

              
Query: 1182 tc 1183
            ||
Sbjct: 424  tc 425



to top

>gb|AF095445.1|AF095445 Glycine max NADP-dependent isocitrate dehydrogenase (IDH1) mRNA,
           complete cds
          Length = 1827

 Score =  147 bits (74), Expect = 2e-31
 Identities = 326/410 (79%)
 Strand = Plus / Plus

                                                                       
Query: 200 caaccccatcgtcgagatggacggtgatgagatgacacgaattatatggaaatggatcaa 259
           ||||||||||||||| ||||| || ||||| ||||| ||| | || ||||||  ||| ||
Sbjct: 315 caaccccatcgtcgaaatggatggggatgaaatgacccgagtgatttggaaactgataaa 374

                                                                       
Query: 260 agataagcttatatttcctttcctggacctggacataaaatactttgacttaggtctacc 319
           |||||||||||| || ||||   |||| ||||| || || || |||||| | || || ||
Sbjct: 375 agataagcttattttcccttatttggagctggatattaagtattttgaccttggccttcc 434

                                                                       
Query: 320 taaccgtgacgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagta 379
           | | || || || |||   |||| ||| || || ||||| || |||||||| || |||||
Sbjct: 435 tcatcgcgatgccactaatgatagagttactattgaaagcgctgaagctacactcaagta 494

                                                                       
Query: 380 taacgtggccatcaaatgtgcaactgtcaccccagatgaaggacgcgtaaaagagtttaa 439
           ||| || || ||||||||||| ||| | || ||||||||||  || || || ||||||||
Sbjct: 495 taatgtagctatcaaatgtgctactataactccagatgaagctcgtgtcaaggagtttaa 554

                                                                       
Query: 440 tttaaaagctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgt 499
            ||||||   |||||||| |||||||||||||| ||  | ||||| |||||||| || ||
Sbjct: 555 cttaaaacaaatgtggagaagtccaaatgggacgatccgaaacattttaaatggtacagt 614

                                                                       
Query: 500 tttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacc 559
           |||  |||| ||||| ||||| |||||  ||||||| |||||  | ||||||||||| ||
Sbjct: 615 ttttagagagccaattatctgtaagaacattcctcgtcttgtttcaggatggacaaagcc 674

                                                             
Query: 560 catatgcattggcagacatgcttttggtgatcaataccgagcaacagata 609
            ||||||||||| |||||||||||||| || ||||| || ||||| ||||
Sbjct: 675 aatatgcattggaagacatgcttttggagaccaatatcgggcaactgata 724



 Score =  101 bits (51), Expect = 1e-17
 Identities = 102/119 (85%)
 Strand = Plus / Plus

                                                                       
Query: 684 aactttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcga 743
           ||||||| ||||||||| ||  |||| || || |||||||| ||||||||||| ||||||
Sbjct: 805 aactttactggtgctggaggcatagctttgtccatgtataatactgatgagtccattcga 864

                                                                      
Query: 744 gcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttag 802
           || |||||||| ||||| |||||| | ||||||||||||| |||||| || ||||||||
Sbjct: 865 gcttttgctgaggcttcaatgaactttgcttaccagaagaaatggcctctctatcttag 923



 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                        
Query: 896  tgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagag 955
            |||||| ||||||||||||||  | || || ||||||||||| || ||||| || || ||
Sbjct: 1017 tgcagggatatggtatgaacaccgtcttatagatgatatggttgcttatgctctcaaaag 1076

                                                               
Query: 956  tgaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagag 1006
            ||| || || ||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 1077 tgatggaggttatgtatgggcctgcaagaattatgatggtgatgtgcagag 1127



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            ||||| ||||| ||||||||||| ||||| ||||| ||||| |||||
Sbjct: 1258 ggaggtgaaaccagcacaaacagtattgcttcaatttttgcctggtc 1304



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1228 tgttggatttcacacaaaaacttgaagctgcttgtgtggggacagtggaatctggaaaga 1287
            ||||||| |||||| | ||||| ||||| |||||  | || ||||| ||||  |||||||
Sbjct: 1349 tgttggacttcacagagaaactggaagcagcttgcattggaacagttgaattgggaaaga 1408

                      
Query: 1288 tgacaaagga 1297
            ||||||||||
Sbjct: 1409 tgacaaagga 1418



to top

>gb|AY344584.1| Pinus pinaster NADP+-isocitrate dehydrogenase mRNA, complete cds
          Length = 1736

 Score =  139 bits (70), Expect = 5e-29
 Identities = 253/314 (80%)
 Strand = Plus / Plus

                                                                        
Query: 693  ggtgctggtggagtagcattatctatgtataacactgatgagtctattcgagcatttgct 752
            |||| ||| |||||||||||| | ||||| || ||||||||||| || ||  ||||||||
Sbjct: 639  ggtgatggaggagtagcattagccatgtacaatactgatgagtcgatacgttcatttgct 698

                                                                        
Query: 753  gaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacgaagaac 812
            || ||||| |||| | |||| ||  ||||||  |||||||| || ||||||||||| || 
Sbjct: 699  gaggcttcaatgaccgtggcctatgagaagaagtggccactctaccttagtacgaaaaat 758

                                                                        
Query: 813  acaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaactatgaaaca 872
            |||||  |||||||||| || |||||||| ||||| || |||||| |   ||||||| | 
Sbjct: 759  acaattttgaaaaaatacgatggaaggttcaaagatattttccaagaggtctatgaatcc 818

                                                                        
Query: 873  aattggagatgcaggtttgaggatgcaggaatatggtatgaacatagactgattgatgat 932
            || |||| | | |  | |||  | |||||||| |||||||||||||| || || ||||| 
Sbjct: 819  aactggaaaagtaaatatgaaaaagcaggaatctggtatgaacataggcttatcgatgac 878

                                                                        
Query: 933  atggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaattatgat 992
            ||||| ||||||||  ||||||||||||| |||||||| ||||| ||||| ||||| |||
Sbjct: 879  atggtagcctatgcattaaagagtgaagggggctatgtatgggcgtgcaaaaattacgat 938

                          
Query: 993  ggagatgtgcagag 1006
            || ||||| |||||
Sbjct: 939  ggtgatgtacagag 952



 Score =  113 bits (57), Expect = 3e-21
 Identities = 204/253 (80%)
 Strand = Plus / Plus

                                                                       
Query: 357 agtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccccagat 416
           ||||||||||| ||  |||| || || ||||||||||| ||||||||| |||| ||||||
Sbjct: 297 agtgcagaagccacattaaaatacaatgtggccatcaagtgtgcaactatcacaccagat 356

                                                                       
Query: 417 gaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaata 476
           ||||  || || || || ||  | || || |||||||||| |||||| |||||||| || 
Sbjct: 357 gaagctcgagtcaaggaattcgacttgaaggctatgtggaagagtcccaatgggactatc 416

                                                                       
Query: 477 aggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcctcgg 536
            | ||||| || ||||| || || ||| |||| |||||| | || ||||| || |||  |
Sbjct: 417 cgtaacattttgaatggtaccgtgttcagagagccaatcttatgtaagaacgtccctaag 476

                                                                       
Query: 537 cttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| || |||||||||||  ||||||| ||||| ||||||||||||||||| ||||||
Sbjct: 477 cttgttccaggatggacaaaggccatatgtattggaagacatgcttttggtgaccaatac 536

                        
Query: 597 cgagcaacagata 609
             |||||||||||
Sbjct: 537 aaagcaacagata 549



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                               
Query: 1131 caaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatgg 1181
            ||||| ||||| ||||||||||| ||||||||||| || || |||||||||
Sbjct: 1077 caaaagggaggtgaaactagcacgaacagcattgcttctatttttgcatgg 1127



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                       
Query: 174 atggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatg 233
           |||||||  ||||||||| |||| |  || |||||||||||||||||||| ||||| |||
Sbjct: 114 atggcgtcggagaagatcaaggtggagaatcccatcgtcgagatggacggggatgaaatg 173

             
Query: 234 ac 235
           ||
Sbjct: 174 ac 175



to top

>dbj|AB109114.1| Lupinus albus LaICDH1;2 mRNA for NADP-specific isocitrate
            dehydrogenase, complete cds
          Length = 1583

 Score =  137 bits (69), Expect = 2e-28
 Identities = 363/461 (78%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||||||||||||||||||||| || || ||||| || ||||| ||||  |  ||||| 
Sbjct: 592  atgtataacactgatgagtctatccgtgcttttgccgatgcttctatgacaactgcttat 651

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| | |||||||||||||||||| || ||||| ||||| || || |||||||| |||
Sbjct: 652  gagaaaaaatggccactttatcttagcaccaagaatacaattcttaagaaatatgatgga 711

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || || ||||| || ||| ||   |||||| |||  |||| ||  |  ||||||| |
Sbjct: 712  agattcaaggacatctttcaagaagtttatgaagcaagctggaaatcaaactttgaggct 771

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || || ||||||||||| ||| | || ||||||||||||||||| || ||  | ||||||
Sbjct: 772  gctggtatatggtatgagcatcggctcattgatgatatggtggcatacgcagtcaagagt 831

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            || || || ||||| ||||| ||||| || |||||||||||||| ||||| ||| |  | 
Sbjct: 832  gatggaggttatgtatgggcatgcaaaaactatgatggagatgttcagagtgatttctta 891

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            |||||||||||||||||  | ||  | |||||||| || ||||| ||||||||||| |  
Sbjct: 892  gctcaaggttttggatcactgggcttgatgacatctgtattggtttgccctgatggaaag 951

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  | ||||| ||||| || || || ||||| || || ||||  || || || || || 
Sbjct: 952  accatagaagcagaagcagcccatggcacagttacccgtcattttagggttcatcagaag 1011

                                                     
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
            ||||| ||||| |||||||||||||| || || ||||||||
Sbjct: 1012 ggaggggaaaccagcacaaacagcatagcatccatctttgc 1052



 Score = 99.6 bits (50), Expect = 4e-17
 Identities = 122/146 (83%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| |||||||||||||||||| ||||| || || || |||||||||||| |||||
Sbjct: 319 atgtggaagagtccaaatgggacaatcaggaatattttgaacggaactgttttcagagaa 378

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           |||||  | ||||| ||  | || || ||||| ||||| ||||  || || ||||| |||
Sbjct: 379 ccaattctttgcaaaaacatcccccgccttgttcctggttggaacaagccaatatgtatt 438

                                     
Query: 570 ggcagacatgcttttggtgatcaata 595
           || |||||||||||||||||||||||
Sbjct: 439 ggaagacatgcttttggtgatcaata 464



 Score = 73.8 bits (37), Expect = 2e-09
 Identities = 70/81 (86%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           ||||||| ||| |||||||| | || ||||||||||||||||| |||||||| ||||| |
Sbjct: 41  ccatggcattccagaagatcaacgtcgccaaccccatcgtcgaaatggacggagatgaaa 100

                                
Query: 232 tgacacgaattatatggaaat 252
           |||| ||| |||| |||||||
Sbjct: 101 tgactcgagttatctggaaat 121



to top

>dbj|AB109115.1| Lupinus albus LaICDH2;1 mRNA for NADP-specific isocitrate
            dehydrogenase, complete cds
          Length = 1794

 Score =  133 bits (67), Expect = 3e-27
 Identities = 127/147 (86%)
 Strand = Plus / Plus

                                                                        
Query: 902  aatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaagg 961
            |||||||||||| ||||| || |||||||| |||||||| |||||  | |||||||||||
Sbjct: 996  aatatggtatgagcataggctaattgatgacatggtggcatatgcggtcaagagtgaagg 1055

                                                                        
Query: 962  tggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctca 1021
            ||| ||||||||||||||||||||||||||||| ||||| || || ||| || | |||||
Sbjct: 1056 tggatatgtttgggcttgcaagaattatgatggtgatgtccaaagtgatttactagctca 1115

                                       
Query: 1022 aggttttggatcgttaggtctcatgac 1048
            ||| ||||| || || |||||||||||
Sbjct: 1116 aggatttggctcattgggtctcatgac 1142



 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 94/111 (84%)
 Strand = Plus / Plus

                                                                       
Query: 538 ttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaatacc 597
           |||| ||||| |||| |||||||||||| |||||||||||||||||||||||||| || |
Sbjct: 629 ttgttcctgggtggaaaaaacccatatgtattggcagacatgcttttggtgatcagtatc 688

                                                              
Query: 598 gagcaacagatataatcattagagggacagggaagctcaagttgatatttg 648
           | || || |||  ||| |||| |||  |||||||||| |||||| ||||||
Sbjct: 689 gtgccactgatgcaataattaaaggaccagggaagctgaagttggtatttg 739



 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 56/64 (87%)
 Strand = Plus / Plus

                                                                       
Query: 448 ctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgag 507
           |||||||||| || || ||||||||||| ||||| || |||||||| ||||||||||| |
Sbjct: 539 ctatgtggagaagccccaatgggacaatcaggaatattttaaatggtactgttttccgtg 598

               
Query: 508 aacc 511
           ||||
Sbjct: 599 aacc 602



 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 780 aagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaagg 839
           |||| ||||||||||||  | || || || |||||||| || || ||||||||||| || 
Sbjct: 874 aagaaatggccactttacttgagcaccaaaaacacaattctcaagaaatatgacggcaga 933

                            
Query: 840 tttaaagacatattcca 856
           |||||||||||||||||
Sbjct: 934 tttaaagacatattcca 950



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 59/71 (83%)
 Strand = Plus / Plus

                                                                       
Query: 216 atggacggtgatgagatgacacgaattatatggaaatggatcaaagataagcttatattt 275
           |||||||||||||| |||||  | |||||||||||   ||| || ||||| |||||||||
Sbjct: 307 atggacggtgatgaaatgaccaggattatatggaagatgataaaggataaacttatattt 366

                      
Query: 276 cctttcctgga 286
           || | ||||||
Sbjct: 367 ccgtacctgga 377



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1254 gctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctcat 1312
            ||||| ||||| | ||||||||| |||||||||||||| || || || || ||||||||
Sbjct: 1348 gctgcatgtgttgagacagtggagtctggaaagatgaccaaagatcttgcacttctcat 1406



to top

>gb|AC104284.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1735_C10,
              complete sequence
          Length = 187034

 Score =  119 bits (60), Expect = 4e-23
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                          
Query: 907    ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
              ||||||| ||| | || |||||||| ||||| |||||||| || ||||||||||| ||||
Sbjct: 113930 ggtatgagcatcgtctcattgatgacatggttgcctatgcactcaagagtgaaggaggct 113989

                                                      
Query: 967    atgtttgggcttgcaagaattatgatggagatgtgcagag 1006
              ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 113990 atgtttgggcttgcaagaactatgatggagatgtgcagag 114029



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                          
Query: 1081   ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
              |||||||||||||||| || || || ||||| || |||||| | || || || ||||| |
Sbjct: 114416 ttgaagctgaagctgcccatgggactgtcacccgtcattaccgtgttcatcagaaaggtg 114475

                                                   
Query: 1141   gcgaaactagcacaaacagcattgcgtcaatctttgc 1177
              | ||||||||||||||||||||||| |||||||||||
Sbjct: 114476 gtgaaactagcacaaacagcattgcctcaatctttgc 114512



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                     
Query: 186    aagatccaggttgccaaccccatcgtcgagatggacggt 224
              |||||| |||| ||||||||||| |||||||||||||||
Sbjct: 111582 aagatcaaggtcgccaaccccattgtcgagatggacggt 111620



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                         
Query: 546    ggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaac 604
              |||||||| || ||||| |||||||| || || || ||||||||||| ||||| |||||
Sbjct: 112904 ggatggactaagcccatttgcattggaaggcacgcatttggtgatcagtaccgtgcaac 112962



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                        
Query: 673    tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactga 730
              |||| ||||||||||| | ||||||||| ||||| |||   |||||||| ||||||||
Sbjct: 113418 tggaggtgttcaacttcactggtgctggaggagtggcacagtctatgtacaacactga 113475



to top

>dbj|AB243085.1| Codonopsis lanceolata mRNA for NADP-isocitrate dehydrogenase,
           complete cds
          Length = 1500

 Score =  119 bits (60), Expect = 4e-23
 Identities = 336/428 (78%)
 Strand = Plus / Plus

                                                                       
Query: 174 atggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatg 233
           |||||||| ||||||||| ||||||| ||||||||||| |||||||| || ||||| |||
Sbjct: 92  atggcgtttgagaagatcaaggttgcaaaccccatcgttgagatggatggagatgaaatg 151

                                                                       
Query: 234 acacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctggac 293
           || || ||  | ||| ||| ||| || ||||||||||| ||||| ||  |||| || || 
Sbjct: 152 actcgtatcttctggcaatcgataaaggataagcttatttttccctttttggagcttgat 211

                                                                       
Query: 294 ataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgata 353
           ||||| ||||||||| | || || ||| ||||||| || || |  || ||||| ||| ||
Sbjct: 212 ataaagtactttgaccttggccttcctcaccgtgatgccaccgatgacaaagtcacggta 271

                                                                       
Query: 354 gaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcacccca 413
           || ||||| |||||||| || ||||| || || || ||||| || |||||  | || |||
Sbjct: 272 gagagtgctgaagctactcttaagtacaatgttgcaatcaagtgcgcaaccattactcca 331

                                                                       
Query: 414 gatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggaca 473
           ||||| |  ||  | || |||||||   | |||  ||||||||  ||||||||||| |||
Sbjct: 332 gatgaggctcgtatgaaggagtttaccctgaaaagtatgtggaaaagtccaaatggaaca 391

                                                                       
Query: 474 ataaggaacatcttaaatggaactgttttccgagaaccaatcatctgcaagaatgttcct 533
           || ||||| || || ||||| || || ||| ||||||| || || ||||||||  |||| 
Sbjct: 392 attaggaatattttgaatggtacggtgttcagagaaccgattatttgcaagaacattccc 451

                                                                       
Query: 534 cggcttgtgcctggatggacaaaacccatatgcattggcagacatgcttttggtgatcaa 593
            ||||| | || ||||||||||| || ||||| ||||| || ||||||||||||||||| 
Sbjct: 452 aggcttatcccaggatggacaaagccaatatgtattggaaggcatgcttttggtgatcag 511

                   
Query: 594 taccgagc 601
           || |||||
Sbjct: 512 tatcgagc 519



 Score =  113 bits (57), Expect = 3e-21
 Identities = 396/509 (77%)
 Strand = Plus / Plus

                                                                        
Query: 669  gagttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacact 728
            |||||||| || | |||||| | ||||||||| || ||||| || || ||||| ||||||
Sbjct: 593  gagttggaggtttacaacttcactggtgctggaggggtagccttgtcaatgtacaacact 652

                                                                        
Query: 729  gatgagtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatgg 788
            |||||||| |||   || ||||| || ||||| |||||||  |||||  ||||||  |||
Sbjct: 653  gatgagtccatttttgcttttgcggaggcttcaatgaacactgcttatgagaagaagtgg 712

                                                                        
Query: 789  ccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagac 848
            || ||||| ||||| || || || || || || || ||||| || ||| | || || || 
Sbjct: 713  cctctttaccttagcacaaaaaatactattcttaagaaatacgatggaggattcaaggat 772

                                                                        
Query: 849  atattccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaatatgg 908
            || |||||| ||   |||||| | |||||||  |  | |||||||| ||| || ||||||
Sbjct: 773  atcttccaagaagtttatgaagccaattggaagtcaaagtttgaggctgctgggatatgg 832

                                                                        
Query: 909  tatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggctat 968
            ||| ||||  | || |||||||||||||| ||||||   || |||||||| || || |||
Sbjct: 833  tataaacaccgtctcattgatgatatggttgcctattgtcttaagagtgacggaggttat 892

                                                                        
Query: 969  gtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggtttt 1028
            || ||||| ||||| || |||||||| ||||||||||| ||| |  | || ||||| |||
Sbjct: 893  gtatgggcatgcaaaaactatgatggggatgtgcagagtgatatgttagcacaaggattt 952

                                                                        
Query: 1029 ggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagct 1088
            || ||  | ||  | | |||||| ||  ||||||||||||||||||  ||  | ||||||
Sbjct: 953  ggctcccttggattgaggacatctgtcctggtgtgccctgatggtaagaccatagaagct 1012

                                                                        
Query: 1089 gaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaact 1148
            || || || || || || || ||||| |||||||| || || || |||||||| ||||| 
Sbjct: 1013 gaggcagctcatggcactgttacacgtcattacagggtgcatcagaaaggaggggaaacc 1072

                                         
Query: 1149 agcacaaacagcattgcgtcaatctttgc 1177
            ||||| |||||||||||||||||||||||
Sbjct: 1073 agcacgaacagcattgcgtcaatctttgc 1101



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score =  119 bits (60), Expect = 4e-23
 Identities = 90/100 (90%)
 Strand = Plus / Plus

                                                                            
Query: 907      ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
                ||||||| ||| | || |||||||| ||||| |||||||| || ||||||||||| ||||
Sbjct: 28329688 ggtatgagcatcgtctcattgatgacatggttgcctatgcactcaagagtgaaggaggct 28329747

                                                        
Query: 967      atgtttgggcttgcaagaattatgatggagatgtgcagag 1006
                ||||||||||||||||||| ||||||||||||||||||||
Sbjct: 28329748 atgtttgggcttgcaagaactatgatggagatgtgcagag 28329787



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 83/97 (85%)
 Strand = Plus / Plus

                                                                            
Query: 1081     ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
                |||||||||||||||| || || || ||||| || |||||| | || || || ||||| |
Sbjct: 28330174 ttgaagctgaagctgcccatgggactgtcacccgtcattaccgtgttcatcagaaaggtg 28330233

                                                     
Query: 1141     gcgaaactagcacaaacagcattgcgtcaatctttgc 1177
                | ||||||||||||||||||||||| |||||||||||
Sbjct: 28330234 gtgaaactagcacaaacagcattgcctcaatctttgc 28330270



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 186      aagatccaggttgccaaccccatcgtcgagatggacggt 224
                |||||| |||| ||||||||||| |||||||||||||||
Sbjct: 28327340 aagatcaaggtcgccaaccccattgtcgagatggacggt 28327378



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                           
Query: 546      ggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaac 604
                |||||||| || ||||| |||||||| || || || ||||||||||| ||||| |||||
Sbjct: 28328662 ggatggactaagcccatttgcattggaaggcacgcatttggtgatcagtaccgtgcaac 28328720



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                          
Query: 673      tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactga 730
                |||| ||||||||||| | ||||||||| ||||| |||   |||||||| ||||||||
Sbjct: 28329176 tggaggtgttcaacttcactggtgctggaggagtggcacagtctatgtacaacactga 28329233



to top

>dbj|AB109113.1| Lupinus albus LaICDH1;1 mRNA for NADP-specific isocitrate
            dehydrogenase, complete cds
          Length = 1627

 Score =  117 bits (59), Expect = 2e-22
 Identities = 362/463 (78%)
 Strand = Plus / Plus

                                                                        
Query: 715  ctatgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggctt 774
            ||||||||||||| || |||||||| || || |||||||| ||||| ||||  |  ||||
Sbjct: 626  ctatgtataacaccgacgagtctatccgtgcttttgctgaggcttctatgacaactgctt 685

                                                                        
Query: 775  accagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacg 834
            |  |||| | |||||||||||||||||| || || || ||||| ||||| |||||||| |
Sbjct: 686  atgagaaaaaatggccactttatcttagcaccaaaaatacaattctgaagaaatatgatg 745

                                                                        
Query: 835  gaaggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgagg 894
            |||| || || ||||| || ||| ||   |||||| |||  |||| ||  | ||||||||
Sbjct: 746  gaagattcaaggacatctttcaagaagtttatgaagcaagctggaaatcgaagtttgagg 805

                                                                        
Query: 895  atgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaaga 954
             ||| || ||||||||||||||| | || || |||||||||||||| || ||  | || |
Sbjct: 806  ctgctggtatatggtatgaacatcggctcatcgatgatatggtggcatacgcagtcaaaa 865

                                                                        
Query: 955  gtgaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaa 1014
            |||| || || ||||| ||||| ||||| || |||||||||||||| ||||| ||| |  
Sbjct: 866  gtgatggaggttatgtatgggcatgcaaaaactatgatggagatgtccagagtgatttct 925

                                                                        
Query: 1015 ttgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggta 1074
            | || ||||||||||| ||  | ||  | |||||||| || ||||| ||||||||||| |
Sbjct: 926  tagcacaaggttttggttcactgggcttgatgacatctgtattggtttgccctgatggga 985

                                                                        
Query: 1075 gaacagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaa 1134
             |||  | ||| | ||||| || || || ||||| || || ||||  || || || || |
Sbjct: 986  aaactatagaatcagaagcagcccatggcacagttacccgtcattttagggttcatcaga 1045

                                                       
Query: 1135 aaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
            | ||||| ||||| |||||||||||||| || || ||||||||
Sbjct: 1046 agggaggggaaaccagcacaaacagcatagcatccatctttgc 1088



 Score =  115 bits (58), Expect = 7e-22
 Identities = 124/146 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||||||||||||||| |||||||| || ||||||||||||||| |||||
Sbjct: 355 atgtggaggagtccaaatgggacaattaggaacattttgaatggaactgttttcagagaa 414

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           |||||  | ||||| ||  | || || ||| | ||||| ||||  || || ||||| |||
Sbjct: 415 ccaattctttgcaaaaacatcccccgccttcttcctggctggaacaagccaatatgtatt 474

                                     
Query: 570 ggcagacatgcttttggtgatcaata 595
           || |||||||||||||||||||||||
Sbjct: 475 ggaagacatgcttttggtgatcaata 500



 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 197/247 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           ||||||| ||| |||||||| | || ||||| |||||||| ||||||||||| ||||| |
Sbjct: 77  ccatggcattccagaagatcaacgtcgccaatcccatcgttgagatggacggagatgaaa 136

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           |||| ||| |||| |||||||  ||||| |||||||| || ||||| ||| ||||  |||
Sbjct: 137 tgactcgagttatctggaaatcaatcaaggataagctcatttttcccttcttggagttgg 196

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           |||| || || | |||| | || || ||| |||||||||  || |  |||||||| ||  
Sbjct: 197 acatcaagtattatgaccttggccttccttaccgtgacgagacagatgataaagtcactg 256

                                                                       
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
           | |||||||| ||||| || || |||||||| || || ||||| ||||||||| | || |
Sbjct: 257 ttgaaagtgctgaagcaactctgaagtataatgtagcaatcaagtgtgcaactattactc 316

                  
Query: 412 cagatga 418
           |||||||
Sbjct: 317 cagatga 323



to top

>ref|NM_105265.2| Arabidopsis thaliana isocitrate dehydrogenase (NADP+)/
           oxidoreductase (AT1G65930) mRNA, complete cds
          Length = 1663

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 441 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 500

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 501 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 560

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 561 ggaaggcatgcttttggtgatcagtaccg 589



 Score =  111 bits (56), Expect = 1e-20
 Identities = 434/560 (77%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 708  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 767

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 768  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 827

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 828  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 887

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 888  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 947

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            || || |||||||||||||| ||||| || |||||||| ||||| || || ||| |  | 
Sbjct: 948  gagggaggctatgtttgggcatgcaaaaactatgatggtgatgtccaaagtgatttcttg 1007

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| || || ||  | ||  | |||||||| ||| |||| ||||| ||||| |  
Sbjct: 1008 gcacaaggattcgggtcacttggattgatgacatctgttctggtctgcccagatggaaag 1067

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||||||||| || || || || ||||| || || | ||| || || || |||
Sbjct: 1068 acgattgaagctgaagcggcccatggaactgtcacccgtcacttcagggttcatcagaaa 1127

                                                                        
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagca 1196
            || || || || |||||||||||||| || || || ||||| ||| ||  |||| | |||
Sbjct: 1128 ggtggtgagaccagcacaaacagcatagcctctatttttgcttggactcgtggacttgca 1187

                                                                        
Query: 1197 catagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagct 1256
            || ||||| ||| | |||||||||  || ||| |||||||||||  | || || ||||| 
Sbjct: 1188 cacagggctaagttagatgacaacgcaaaactcttggatttcactgagaagctggaagcc 1247

                                
Query: 1257 gcttgtgtggggacagtgga 1276
            |||||||| |||||||||||
Sbjct: 1248 gcttgtgttgggacagtgga 1267



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 198/250 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| |
Sbjct: 163 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 222

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           ||||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  |||
Sbjct: 223 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 282

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           | || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || |
Sbjct: 283 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 342

                                                                       
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
           | |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| |
Sbjct: 343 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 402

                     
Query: 412 cagatgaagg 421
           ||||||||||
Sbjct: 403 cagatgaagg 412



to top

>gb|AY097340.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1233

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 277 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 336

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 337 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 396

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 397 ggaaggcatgcttttggtgatcagtaccg 425



 Score =  111 bits (56), Expect = 1e-20
 Identities = 434/560 (77%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 544  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 603

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 604  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 663

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 664  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 723

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 724  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 783

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            || || |||||||||||||| ||||| || |||||||| ||||| || || ||| |  | 
Sbjct: 784  gagggaggctatgtttgggcatgcaaaaactatgatggtgatgtccaaagtgatttcttg 843

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| || || ||  | ||  | |||||||| ||| |||| ||||| ||||| |  
Sbjct: 844  gcacaaggattcgggtcacttggattgatgacatctgttctggtctgcccagatggaaag 903

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||||||||| || || || || ||||| || || | ||| || || || |||
Sbjct: 904  acgattgaagctgaagcggcccatggaactgtcacccgtcacttcagggttcatcagaaa 963

                                                                        
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagca 1196
            || || || || |||||||||||||| || || || ||||| ||| ||  |||| | |||
Sbjct: 964  ggtggtgagaccagcacaaacagcatagcctctatttttgcttggactcgtggacttgca 1023

                                                                        
Query: 1197 catagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagct 1256
            || ||||| ||| | |||||||||  || ||| |||||||||||  | || || ||||| 
Sbjct: 1024 cacagggctaagttagatgacaacgcaaaactcttggatttcactgagaagctggaagcc 1083

                                
Query: 1257 gcttgtgtggggacagtgga 1276
            |||||||| |||||||||||
Sbjct: 1084 gcttgtgttgggacagtgga 1103



 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 196/248 (79%)
 Strand = Plus / Plus

                                                                       
Query: 174 atggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatg 233
           |||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| |||
Sbjct: 1   atggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaatg 60

                                                                       
Query: 234 acacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctggac 293
           ||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  |||| 
Sbjct: 61  accagggttatttggaagtctatcaaggataagcttattactccttttgtggagttggat 120

                                                                       
Query: 294 ataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgata 353
           || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || || 
Sbjct: 121 atcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttactatt 180

                                                                       
Query: 354 gaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcacccca 413
           |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| |||
Sbjct: 181 gaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactcca 240

                   
Query: 414 gatgaagg 421
           ||||||||
Sbjct: 241 gatgaagg 248



to top

>gb|AY093091.1| Arabidopsis thaliana similar to NADP-specific isocitrate
           dehydrogenase (At1g65930) mRNA, complete cds
          Length = 1551

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 431 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 490

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 491 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 550

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 551 ggaaggcatgcttttggtgatcagtaccg 579



 Score =  111 bits (56), Expect = 1e-20
 Identities = 434/560 (77%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 698  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 757

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 758  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 817

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 818  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 877

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 878  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 937

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            || || |||||||||||||| ||||| || |||||||| ||||| || || ||| |  | 
Sbjct: 938  gagggaggctatgtttgggcatgcaaaaactatgatggtgatgtccaaagtgatttcttg 997

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| || || ||  | ||  | |||||||| ||| |||| ||||| ||||| |  
Sbjct: 998  gcacaaggattcgggtcacttggattgatgacatctgttctggtctgcccagatggaaag 1057

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||||||||| || || || || ||||| || || | ||| || || || |||
Sbjct: 1058 acgattgaagctgaagcggcccatggaactgtcacccgtcacttcagggttcatcagaaa 1117

                                                                        
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagca 1196
            || || || || |||||||||||||| || || || ||||| ||| ||  |||| | |||
Sbjct: 1118 ggtggtgagaccagcacaaacagcatagcctctatttttgcttggactcgtggacttgca 1177

                                                                        
Query: 1197 catagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagct 1256
            || ||||| ||| | |||||||||  || ||| |||||||||||  | || || ||||| 
Sbjct: 1178 cacagggctaagttagatgacaacgcaaaactcttggatttcactgagaagctggaagcc 1237

                                
Query: 1257 gcttgtgtggggacagtgga 1276
            |||||||| |||||||||||
Sbjct: 1238 gcttgtgttgggacagtgga 1257



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 198/250 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| |
Sbjct: 153 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 212

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           ||||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  |||
Sbjct: 213 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 272

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           | || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || |
Sbjct: 273 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 332

                                                                       
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
           | |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| |
Sbjct: 333 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 392

                     
Query: 412 cagatgaagg 421
           ||||||||||
Sbjct: 393 cagatgaagg 402



to top

>gb|AF419575.1|AF419575 Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1636

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 430 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 489

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 490 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 549

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 550 ggaaggcatgcttttggtgatcagtaccg 578



 Score =  111 bits (56), Expect = 1e-20
 Identities = 434/560 (77%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 697  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 756

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 757  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 816

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 817  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 876

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 877  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 936

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            || || |||||||||||||| ||||| || |||||||| ||||| || || ||| |  | 
Sbjct: 937  gagggaggctatgtttgggcatgcaaaaactatgatggtgatgtccaaagtgatttcttg 996

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| || || ||  | ||  | |||||||| ||| |||| ||||| ||||| |  
Sbjct: 997  gcacaaggattcgggtcacttggattgatgacatctgttctggtctgcccagatggaaag 1056

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||||||||| || || || || ||||| || || | ||| || || || |||
Sbjct: 1057 acgattgaagctgaagcggcccatggaactgtcacccgtcacttcagggttcatcagaaa 1116

                                                                        
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagca 1196
            || || || || |||||||||||||| || || || ||||| ||| ||  |||| | |||
Sbjct: 1117 ggtggtgagaccagcacaaacagcatagcctctatttttgcttggactcgtggacttgca 1176

                                                                        
Query: 1197 catagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagct 1256
            || ||||| ||| | |||||||||  || ||| |||||||||||  | || || ||||| 
Sbjct: 1177 cacagggctaagttagatgacaacgcaaaactcttggatttcactgagaagctggaagcc 1236

                                
Query: 1257 gcttgtgtggggacagtgga 1276
            |||||||| |||||||||||
Sbjct: 1237 gcttgtgttgggacagtgga 1256



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 198/250 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| |
Sbjct: 152 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 211

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           ||||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  |||
Sbjct: 212 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 271

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           | || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || |
Sbjct: 272 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 331

                                                                       
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
           | |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| |
Sbjct: 332 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 391

                     
Query: 412 cagatgaagg 421
           ||||||||||
Sbjct: 392 cagatgaagg 401



to top

>gb|AY088129.1| Arabidopsis thaliana clone 41544 mRNA, complete sequence
          Length = 1554

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 430 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 489

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 490 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 549

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 550 ggaaggcatgcttttggtgatcagtaccg 578



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 225/284 (79%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 697  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 756

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 757  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 816

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 817  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 876

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 877  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 936

                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgt 1000
             | || |||||||||||||| ||||| || |||||||| |||||
Sbjct: 937  aagggaggctatgtttgggcatgcaaaaactatgatggtgatgt 980



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 197/249 (79%)
 Strand = Plus / Plus

                                                                       
Query: 173 catggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagat 232
           ||||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| ||
Sbjct: 153 catggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaat 212

                                                                       
Query: 233 gacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgga 292
           |||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  ||||
Sbjct: 213 gaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgga 272

                                                                       
Query: 293 cataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgat 352
            || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || ||
Sbjct: 273 tatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttactat 332

                                                                       
Query: 353 agaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcacccc 412
            |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| ||
Sbjct: 333 tgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactcc 392

                    
Query: 413 agatgaagg 421
           |||||||||
Sbjct: 393 agatgaagg 401



to top

>gb|AY045631.1| Arabidopsis thaliana At1g65930/F12P19_10 mRNA, complete cds
          Length = 1653

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 430 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 489

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 490 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 549

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 550 ggaaggcatgcttttggtgatcagtaccg 578



 Score =  111 bits (56), Expect = 1e-20
 Identities = 434/560 (77%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 697  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 756

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 757  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 816

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 817  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 876

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 877  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 936

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            || || |||||||||||||| ||||| || |||||||| ||||| || || ||| |  | 
Sbjct: 937  gagggaggctatgtttgggcatgcaaaaactatgatggtgatgtccaaagtgatttcttg 996

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| || || ||  | ||  | |||||||| ||| |||| ||||| ||||| |  
Sbjct: 997  gcacaaggattcgggtcacttggattgatgacatctgttctggtctgcccagatggaaag 1056

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||||||||| || || || || ||||| || || | ||| || || || |||
Sbjct: 1057 acgattgaagctgaagcggcccatggaactgtcacccgtcacttcagggttcatcagaaa 1116

                                                                        
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagca 1196
            || || || || |||||||||||||| || || || ||||| ||| ||  |||| | |||
Sbjct: 1117 ggtggtgagaccagcacaaacagcatagcctctatttttgcttggactcgtggacttgca 1176

                                                                        
Query: 1197 catagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagct 1256
            || ||||| ||| | |||||||||  || ||| |||||||||||  | || || ||||| 
Sbjct: 1177 cacagggctaagttagatgacaacgcaaaactcttggatttcactgagaagctggaagcc 1236

                                
Query: 1257 gcttgtgtggggacagtgga 1276
            |||||||| |||||||||||
Sbjct: 1237 gcttgtgttgggacagtgga 1256



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 198/250 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| |
Sbjct: 152 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 211

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           ||||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  |||
Sbjct: 212 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 271

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           | || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || |
Sbjct: 272 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 331

                                                                       
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
           | |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| |
Sbjct: 332 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 391

                     
Query: 412 cagatgaagg 421
           ||||||||||
Sbjct: 392 cagatgaagg 401



to top

>emb|AJ437268.1|ATH437268 Arabidopsis thaliana mRNA for isocitrate dehydrogenase
          Length = 1610

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 441 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 500

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 501 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 560

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 561 ggaaggcatgcttttggtgatcagtaccg 589



 Score =  103 bits (52), Expect = 3e-18
 Identities = 226/284 (79%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 708  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 767

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 768  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 827

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 828  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 887

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 888  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 947

                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgt 1000
            || || |||||||||||||| ||||| || |||||||| |||||
Sbjct: 948  gagggaggctatgtttgggcatgcaaaaactatgatggtgatgt 991



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 198/250 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| |
Sbjct: 163 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 222

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           ||||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  |||
Sbjct: 223 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 282

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           | || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || |
Sbjct: 283 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 342

                                                                       
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
           | |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| |
Sbjct: 343 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 402

                     
Query: 412 cagatgaagg 421
           ||||||||||
Sbjct: 403 cagatgaagg 412



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 103/128 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1149 agcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagggcaaag 1208
            |||||||||||||| || || || ||||| ||| ||  |||| | ||||| ||||| |||
Sbjct: 1140 agcacaaacagcatagcctctatttttgcttggactcgtggacttgcacacagggctaag 1199

                                                                        
Query: 1209 ctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtgggg 1268
             | |||||||||  || ||| |||||||||||  | || || ||||| |||||||| |||
Sbjct: 1200 ttagatgacaacgcaaaactcttggatttcactgagaagctggaagccgcttgtgttggg 1259

                    
Query: 1269 acagtgga 1276
            ||||||||
Sbjct: 1260 acagtgga 1267



to top

>gb|BT002400.1| Arabidopsis thaliana isocitrate dehydrogenase, putative (At1g65930)
           mRNA, complete cds
          Length = 1581

 Score =  113 bits (57), Expect = 3e-21
 Identities = 126/149 (84%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||| |||||||||||||| || ||||| ||| | ||||||||||| ||  |||| 
Sbjct: 430 atgtggagaagtccaaatgggaccatcaggaatatcctgaatggaactgtatttagagag 489

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| |||||||| ||||||||   |||||| || || |||||||| ||||| ||||||
Sbjct: 490 ccaattatctgcaaaaatgttcccaagcttgtcccaggctggacaaagcccatctgcatt 549

                                        
Query: 570 ggcagacatgcttttggtgatcaataccg 598
           || || ||||||||||||||||| |||||
Sbjct: 550 ggaaggcatgcttttggtgatcagtaccg 578



 Score =  111 bits (56), Expect = 1e-20
 Identities = 434/560 (77%)
 Strand = Plus / Plus

                                                                        
Query: 717  atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
            ||||| |||||||||||||| || || || |||||||| || ||||||||||  ||||| 
Sbjct: 697  atgtacaacactgatgagtccatccgtgcttttgctgatgcatcgatgaacactgcttat 756

                                                                        
Query: 777  cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
             |||| |  ||||||||||| ||||| || ||||| || || || || ||||| || || 
Sbjct: 757  gagaaaaagtggccactttaccttagcacaaagaataccattcttaagaaatacgatggc 816

                                                                        
Query: 837  aggtttaaagacatattccaacaaaactatgaaacaaattggagatgcaggtttgaggat 896
            || || |||||||| |||||| ||  ||||||| | |  ||||  |  | || ||| | |
Sbjct: 817  agattcaaagacatcttccaagaagtctatgaagccagctggaagtcgaagtatgatgct 876

                                                                        
Query: 897  gcaggaatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagt 956
            || ||||| |||||||||||  | || |||||||||||||||||||| || || ||||||
Sbjct: 877  gctggaatctggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagt 936

                                                                        
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaatt 1016
            || || |||||||||||||| ||||| || |||||||| ||||| || || ||| |  | 
Sbjct: 937  gagggaggctatgtttgggcatgcaaaaactatgatggtgatgtccaaagtgatttcttg 996

                                                                        
Query: 1017 gctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtaga 1076
            || ||||| || || ||  | ||  | |||||||| ||| |||| ||||| ||||| |  
Sbjct: 997  gcacaaggattcgggtcacttggattgatgacatctgttctggtctgcccagatggaaag 1056

                                                                        
Query: 1077 acagttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaa 1136
            ||  ||||||||||||| || || || || ||||| || || | ||| || || || |||
Sbjct: 1057 acgattgaagctgaagcggcccatggaactgtcacccgtcacttcagggttcatcagaaa 1116

                                                                        
Query: 1137 ggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagca 1196
            || || || || |||||||||||||| || || || ||||| ||| ||  |||| | |||
Sbjct: 1117 ggtggtgagaccagcacaaacagcatagcctctatttttgcttggactcgtggacttgca 1176

                                                                        
Query: 1197 catagggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagct 1256
            || ||||| ||| | |||||||||  || ||| |||||||||||  | || || ||||| 
Sbjct: 1177 cacagggctaagttagatgacaacgcaaaactcttggatttcactgagaagctggaagcc 1236

                                
Query: 1257 gcttgtgtggggacagtgga 1276
            |||||||| |||||||||||
Sbjct: 1237 gcttgtgttgggacagtgga 1256



 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 198/250 (79%)
 Strand = Plus / Plus

                                                                       
Query: 172 ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgaga 231
           |||||||||| ||||||||| |||| || || ||||||||||||||||| |||||||| |
Sbjct: 152 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtgatgaaa 211

                                                                       
Query: 232 tgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgg 291
           ||||  |  |||| ||||| |  ||||| |||||||||||   ||||||  ||||  |||
Sbjct: 212 tgaccagggttatttggaagtctatcaaggataagcttattactccttttgtggagttgg 271

                                                                       
Query: 292 acataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacga 351
           | || || ||||| ||| | ||||| ||| ||||||| ||||| |  || ||||| || |
Sbjct: 272 atatcaagtacttcgaccttggtcttcctcaccgtgatgctacggatgacaaagttacta 331

                                                                       
Query: 352 tagaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcaccc 411
           | |||||||| ||||||||    ||||| || ||||| ||||| ||||| ||  |||| |
Sbjct: 332 ttgaaagtgctgaagctactaagaagtacaatgtggcgatcaagtgtgccaccatcactc 391

                     
Query: 412 cagatgaagg 421
           ||||||||||
Sbjct: 392 cagatgaagg 401



to top

>emb|X16648.1|HVPR1 Barley fungal pathogen induced mRNA for pathogen-related protein
          Length = 864

 Score =  113 bits (57), Expect = 3e-21
 Identities = 107/123 (86%), Gaps = 3/123 (2%)
 Strand = Plus / Minus

                                                                        
Query: 1856 tcctctcatcacagggcaacctgaagccgatgcagcaacag---gcgcgctcaagaaact 1912
            ||||||||||||||||||||||||||| ||||||| | |||   ||||  ||||||| ||
Sbjct: 739  tcctctcatcacagggcaacctgaagctgatgcagaagcagccggcgcagtcaagaagct 680

                                                                        
Query: 1913 tgcgaggaagttgccgcgctcgtagaagtactatgccttctccaccttcatctcctcatc 1972
             |||||||||||||| |||||||||||| ||| |||||||||||||||  | ||||||||
Sbjct: 679  cgcgaggaagttgccacgctcgtagaagaactctgccttctccaccttggtgtcctcatc 620

               
Query: 1973 aac 1975
            |||
Sbjct: 619  aac 617



to top

>gb|AY997861.1| Lathrocasis tenerrima voucher Johnson 93-103 WS clone 1 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 506

 Score =  111 bits (56), Expect = 1e-20
 Identities = 119/140 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1044 atgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacggt 1103
            |||||||||||  |||| ||||||||||| |  ||  ||||||||||||| || || |||
Sbjct: 183  atgacatcggtcctggtctgccctgatggaaagaccattgaagctgaagcagctcatggt 242

                                                                        
Query: 1104 acagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcatt 1163
            ||||| ||||| |||||||| || ||||||||||| || ||||| |||||||||||||| 
Sbjct: 243  acagttacacgccattacagggttcaccaaaaaggcggtgaaaccagcacaaacagcata 302

                                
Query: 1164 gcgtcaatctttgcatggtc 1183
            || ||||||||||| |||||
Sbjct: 303  gcctcaatctttgcctggtc 322



to top

>gb|AF173666.1|AF173666 Beta vulgaris clone ISORT isocitrate dehydrogenase (Icdh) mRNA,
           partial cds
          Length = 720

 Score =  111 bits (56), Expect = 1e-20
 Identities = 314/400 (78%)
 Strand = Plus / Plus

                                                                       
Query: 208 tcgtcgagatggacggtgatgagatgacacgaattatatggaaatggatcaaagataagc 267
           |||||||||||||||| ||||| |||||  || || | |||||||  || ||||| ||||
Sbjct: 1   tcgtcgagatggacggagatgaaatgactagagttttttggaaatccataaaagagaagc 60

                                                                       
Query: 268 ttatatttcctttcctggacctggacataaaatactttgacttaggtctacctaaccgtg 327
           ||||||  || || ||||| ||||| ||||| ||||||||  | || || || || ||||
Sbjct: 61  ttatatacccctttctggagctggatataaagtactttgatcttggcctcccaaatcgtg 120

                                                                       
Query: 328 acgctactggggataaagtaacgatagaaagtgcagaagctaccctaaagtataacgtgg 387
           | || ||    || ||||| || || ||||||||||||||||| || ||||||||||| |
Sbjct: 121 atgccaccaatgacaaagtcacaattgaaagtgcagaagctacactcaagtataacgttg 180

                                                                       
Query: 388 ccatcaaatgtgcaactgtcaccccagatgaaggacgcgtaaaagagtttaatttaaaag 447
           | || |||||||||||  |||| ||||||||||| || || || || || || || ||  
Sbjct: 181 caattaaatgtgcaaccatcacaccagatgaaggccgtgttaaggaattcaacttgaagc 240

                                                                       
Query: 448 ctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgag 507
             |||||||||||||||||||| || ||  | |||||| | ||||| || || ||| | |
Sbjct: 241 agatgtggaggagtccaaatggaactatccgaaacatccttaatggcacggtcttcaggg 300

                                                                       
Query: 508 aaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgca 567
           |||| || ||||||   || |||||   |||||| || || ||||||||||| || ||||
Sbjct: 301 aaccgataatctgccgaaacgttcccaagcttgttccaggttggacaaaaccaatctgca 360

                                                   
Query: 568 ttggcagacatgcttttggtgatcaataccgagcaacaga 607
           | || |||||||||||||||||||| ||||| ||| ||||
Sbjct: 361 tagggagacatgcttttggtgatcagtaccgtgcatcaga 400



 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 116/140 (82%)
 Strand = Plus / Plus

                                                                       
Query: 717 atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
           |||||||||||||||||||| || | ||| |||||||| ||||| ||||| |  |||  |
Sbjct: 516 atgtataacactgatgagtcaatacaagcttttgctgaggcttcaatgaatactgctctc 575

                                                                       
Query: 777 cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
           || |||| |||||| ||||||||||| ||||| ||||| || ||||| |||||||| || 
Sbjct: 576 caaaagaaatggcccctttatcttagcacgaaaaacaccattctgaagaaatatgatggg 635

                               
Query: 837 aggtttaaagacatattcca 856
           || || ||||| ||||||||
Sbjct: 636 agattcaaagatatattcca 655



to top

>gb|AY997909.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10d isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score =  109 bits (55), Expect = 4e-20
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1431

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| |||||||||||||| |||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcgtcaatctttgcctggtc 1474



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997908.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10c isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score =  109 bits (55), Expect = 4e-20
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1431

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| |||||||||||||| |||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcgtcaatctttgcctggtc 1474



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997907.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10b isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score =  109 bits (55), Expect = 4e-20
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1431

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| |||||||||||||| |||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcgtcaatctttgcctggtc 1474



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997901.1| Saltugilia caruifolia voucher Johnson 93-092 BRY clone 15c isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1537

 Score =  109 bits (55), Expect = 4e-20
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||||||||| |||||||| || ||||||||||| |
Sbjct: 1064 ttgaagctgaagcagctcacggcacagtcacacgccattacagggttcaccaaaaaggtg 1123

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1124 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1166



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || ||||| || |||||||| || || ||||| ||||| || || 
Sbjct: 618  attgatgatatggttgcttatgctcttaagagtgatggaggttatgtatgggcgtgtaaa 677

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||||||||| |||||
Sbjct: 678  aactacgatggagatgttcagag 700



to top

>gb|AY997899.1| Saltugilia caruifolia voucher Johnson 93-092 BRY clone 15a isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1537

 Score =  109 bits (55), Expect = 4e-20
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||||||||| |||||||| || ||||||||||| |
Sbjct: 1064 ttgaagctgaagcagctcacggcacagtcacacgccattacagggttcaccaaaaaggtg 1123

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1124 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1166



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || ||||| || |||||||| || || ||||| ||||| || || 
Sbjct: 618  attgatgatatggttgcttatgctcttaagagtgatggaggttatgtatgggcgtgtaaa 677

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||||||||| |||||
Sbjct: 678  aactacgatggagatgttcagag 700



to top

>gb|AY997898.1| Saltugilia caruifolia voucher Weese 01-032 BRY clone 01032 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1575

 Score =  109 bits (55), Expect = 4e-20
 Identities = 91/103 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||||||||| |||||||| || ||||||||||| |
Sbjct: 1333 ttgaagctgaagcagctcacggcacagtcacacgccattacagggttcaccaaaaaggtg 1392

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1393 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1435



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 581  gatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcgtgcaaaaac 640

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 641  tacgatggagatgttcagag 660



to top

>gb|BT016882.1| Zea mays clone Contig715 mRNA sequence
          Length = 1851

 Score =  105 bits (53), Expect = 7e-19
 Identities = 110/129 (85%)
 Strand = Plus / Minus

                                                                        
Query: 902  aatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaagg 961
            |||||||||||| || ||  |||||||||| ||||||||||||||  | || ||||| ||
Sbjct: 776  aatatggtatgagcacaggttgattgatgacatggtggcctatgctgtgaaaagtgatgg 717

                                                                        
Query: 962  tggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctca 1021
            ||| ||||||||||||||||| || ||||| |||||||| ||||||||| |  |||| ||
Sbjct: 716  tgggtatgtttgggcttgcaaaaactatgacggagatgtacagagcgattttcttgccca 657

                     
Query: 1022 aggttttgg 1030
            |||||||||
Sbjct: 656  aggttttgg 648



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 426  gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataaggaacatc 485
            ||||||||||||||  | ||  |||||||| ||||||||||||| ||||||||||| || 
Sbjct: 1252 gtaaaagagtttaaactcaagtctatgtggcggagtccaaatggcacaataaggaatatt 1193

                             
Query: 486  ttaaatggaactgtttt 502
             ||||||| ||||||||
Sbjct: 1192 ctaaatgggactgtttt 1176



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 97/119 (81%)
 Strand = Plus / Minus

                                                                        
Query: 1200 agggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgct 1259
            ||||||||||||||| | ||  | || ||| ||||||||||||| ||||||||| |||| 
Sbjct: 478  agggcaaagctggataaaaatgatagtctgctggatttcacacacaaacttgaatctgca 419

                                                                       
Query: 1260 tgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctcatccatgg 1318
            ||||| |  || ||||||||||| || ||||| |||| ||| || ||| | ||||||||
Sbjct: 418  tgtgttgaaacggtggaatctgggaaaatgactaaggcccttgcgctttttatccatgg 360



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                               
Query: 201  aaccccatcgtcgagatggacggtgatgagatgac 235
            ||||||||||||||||||||||| |||||||||||
Sbjct: 1477 aaccccatcgtcgagatggacggggatgagatgac 1443



to top

>gb|AY730588.2| Pisum sativum NADP-dependent isocitrate dehydrogenase I gene,
            complete cds
          Length = 4004

 Score =  105 bits (53), Expect = 7e-19
 Identities = 104/121 (85%)
 Strand = Plus / Plus

                                                                        
Query: 907  ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
            ||||||| ||| |||| ||||||||||||||||| ||||| || ||||||||||| || |
Sbjct: 2603 ggtatgagcatcgactcattgatgatatggtggcatatgcactcaagagtgaaggaggtt 2662

                                                                        
Query: 967  atgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggtt 1026
            |||| ||||| |||||||| |||||||||||||| ||||| ||| |  | ||||||||||
Sbjct: 2663 atgtatgggcatgcaagaactatgatggagatgtccagagtgatttcttagctcaaggtt 2722

             
Query: 1027 t 1027
            |
Sbjct: 2723 t 2723



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                        
Query: 450  atgtggaggagtccaaatgggacaataaggaacatcttaaatgg 493
            |||||||||||||||||||||||||| || ||||| || |||||
Sbjct: 1475 atgtggaggagtccaaatgggacaattagaaacattttgaatgg 1518



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                           
Query: 549  tggacaaaacccatatgcattggcagacatgcttttggtgatcaata 595
            |||||||| || ||||| ||||| || ||||||||||||||||||||
Sbjct: 1803 tggacaaagccaatatgtattggaaggcatgcttttggtgatcaata 1849



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                    
Query: 785  atggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||||||||||||| || || || ||||| || || |||||||| |||||||
Sbjct: 2299 atggccactttatcttagcaccaaaaatacaattcttaagaaatatgatggaaggt 2354



to top

>gb|AY997906.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            10a isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score =  105 bits (53), Expect = 7e-19
 Identities = 86/97 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1431

                                                 
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgc 1177
            | ||||| |||||||||||||| ||||||||||||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcgtcaatctttgc 1468



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY104847.1| Zea mays PCO066525 mRNA sequence
          Length = 1776

 Score =  105 bits (53), Expect = 7e-19
 Identities = 110/129 (85%)
 Strand = Plus / Plus

                                                                        
Query: 902  aatatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaagg 961
            |||||||||||| || ||  |||||||||| ||||||||||||||  | || ||||| ||
Sbjct: 1015 aatatggtatgagcacaggttgattgatgacatggtggcctatgctgtgaaaagtgatgg 1074

                                                                        
Query: 962  tggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctca 1021
            ||| ||||||||||||||||| || ||||| |||||||| ||||||||| |  |||| ||
Sbjct: 1075 tgggtatgtttgggcttgcaaaaactatgacggagatgtacagagcgattttcttgccca 1134

                     
Query: 1022 aggttttgg 1030
            |||||||||
Sbjct: 1135 aggttttgg 1143



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 99/119 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1200 agggcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgct 1259
            ||||||||||||||| | ||  | || ||| ||||||||||||| ||||||||| |||| 
Sbjct: 1313 agggcaaagctggataaaaatgatagtctgctggatttcacacacaaacttgaatctgca 1372

                                                                       
Query: 1260 tgtgtggggacagtggaatctggaaagatgacaaaggacctagctcttctcatccatgg 1318
            ||||| |  || ||||||||||| || ||||| |||||||| || ||||| ||||||||
Sbjct: 1373 tgtgttgaaacggtggaatctgggaaaatgactaaggaccttgcgcttcttatccatgg 1431



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 426 gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataaggaacatc 485
           ||||||||||||||  | ||  |||||||| ||||||||||||| ||||||||||| || 
Sbjct: 538 gtaaaagagtttaaactcaagtctatgtggcggagtccaaatggcacaataaggaatatt 597

                            
Query: 486 ttaaatggaactgtttt 502
            ||||||| ||||||||
Sbjct: 598 ctaaatgggactgtttt 614



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 201 aaccccatcgtcgagatggacggtgatgagatgac 235
           ||||||||||||||||||||||| |||||||||||
Sbjct: 313 aaccccatcgtcgagatggacggggatgagatgac 347



to top

>emb|X92486.1|STICDH2 S.tuberosum mRNA for NADP-isocitrate dehydrogenase
          Length = 1554

 Score =  103 bits (52), Expect = 3e-18
 Identities = 91/104 (87%)
 Strand = Plus / Plus

                                                                        
Query: 903  atatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggt 962
            ||||||||||| ||||||||||| ||||| ||||| || |||||  |||| ||||| |||
Sbjct: 961  atatggtatgagcatagactgatagatgacatggtagcttatgcattaaaaagtgagggt 1020

                                                        
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgtgcagag 1006
            || ||||||||||| |||||||| |||||||||||||| |||||
Sbjct: 1021 ggatatgtttgggcatgcaagaactatgatggagatgtccagag 1064



 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                       
Query: 204 cccatcgtcgagatggacggtgatgagatgacacgaattatatggaaatggatcaaagat 263
           ||||||||||| |||||||||||||| |||||  |  |||||||||||  ||||||||| 
Sbjct: 259 cccatcgtcgaaatggacggtgatgaaatgacgagggttatatggaaaatgatcaaagac 318

                           
Query: 264 aagcttatatttcctt 279
           ||||| |||| |||||
Sbjct: 319 aagctaatatatcctt 334



 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 116/145 (80%)
 Strand = Plus / Plus

                                                                       
Query: 448 ctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgag 507
           |||||||||  ||||| ||||| ||||| || ||||| ||||| || ||||||||||| |
Sbjct: 503 ctatgtggaaaagtcccaatggcacaatcagaaacattttaaacggtactgttttccggg 562

                                                                       
Query: 508 aaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgca 567
           | || ||  | |||| |||  ||||  || |||| ||||| ||||  |||||||| || |
Sbjct: 563 agcctatactatgcacgaacattcccaggattgttcctggttggaagaaacccatttgta 622

                                    
Query: 568 ttggcagacatgcttttggtgatca 592
           |||| || |||||||||||||||||
Sbjct: 623 ttggtaggcatgcttttggtgatca 647



to top

>ref|NM_001049119.1| Oryza sativa (japonica cultivar-group) Os01g0248500 (Os01g0248500)
            mRNA, complete cds
          Length = 1312

 Score =  101 bits (51), Expect = 1e-17
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1887 gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
            |||||| |||||| ||||||||| || |||||||| ||||||||||||||||||||||  
Sbjct: 886  gcagcagcaggcgtgctcaagaagctcgcgaggaaattgccgcgctcgtagaagtactcc 827

                                   
Query: 1947 gccttctccaccttcatctcctc 1969
            | |||||||||||||||||||||
Sbjct: 826  gtcttctccaccttcatctcctc 804



to top

>gb|AY997878.1| Saltugilia splendens subsp. splendens voucher Johnson 97-121 BRY
            isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 974

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 690  ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 749

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 750  gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 792



to top

>gb|AY997877.1| Saltugilia splendens subsp. splendens voucher Johnson 97-102 BRY
            isocitrate dehydrogenase gene, exons K-M and partial cds
          Length = 932

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 700  ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 759

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 760  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 802



to top

>gb|AY997876.1| Saltugilia splendens subsp. grantii voucher Johnson 96-008 BRY
            isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 974

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 690  ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 749

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 750  gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 792



to top

>gb|AY997874.1| Saltugilia latimeri voucher Johnson 92-021 WS isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 717

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||||||||| |||||||| || ||||||||||| |
Sbjct: 381  ttgaagctgaagcagctcacggcacagtcacacgccattacagggttcaccaaaaaggtg 440

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | || || |||||||||||||| || ||||||||||| |||||
Sbjct: 441  gtgagaccagcacaaacagcatagcctcaatctttgcctggtc 483



to top

>gb|AY997873.1| Saltugilia caruifolia voucher Johnson 97-100 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 1009

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||||||||| || ||||| || ||||||||||| |
Sbjct: 692  ttgaagctgaagcagctcacggcacagtcacacgccactacagggttcaccaaaaaggtg 751

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 752  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 794



to top

>gb|AY997870.1| Saltugilia australis voucher Johnson 97-049 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 885

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 380  ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 439

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 440  gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 482



to top

>gb|AY997858.1| Gilia scopulorum voucher Johnson304 BRY isocitrate dehydrogenase
            gene, exons K-N and partial cds
          Length = 1258

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 365  ttgaagctgaagcagctcacggcacagttacacgccattacagggttcaccaaaaaggtg 424

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 425  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 467



to top

>gb|AY997919.1| Saltugilia splendens subsp. splendens voucher Johnson 97-121 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1564

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1431

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1474



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || ||||| |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgcccttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997917.1| Saltugilia splendens subsp. splendens voucher Johnson 97-102 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1605

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1377 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1436

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1437 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1479



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 615  gatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaaaac 674

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 675  tacgatggagatgttcagag 694



to top

>gb|AY997916.1| Saltugilia splendens subsp. grantii voucher Johnson 97-107 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1564

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1431

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1474



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997915.1| Saltugilia splendens subsp. grantii voucher Johnson 96-008 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1564

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1431

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1474



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997912.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            13 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1562

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1370 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1429

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1430 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1472



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 616  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 675

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 676  aactatgatggagatgttcagag 698



to top

>gb|AY997911.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            12 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1542

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1350 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1409

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1410 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1452



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997910.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            11 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1542

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1350 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1409

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1410 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1452



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997905.1| Saltugilia latimeri voucher Johnson 92-021 WS isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1282

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||||||||| |||||||| || ||||||||||| |
Sbjct: 1038 ttgaagctgaagcagctcacggcacagtcacacgccattacagggttcaccaaaaaggtg 1097

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | || || |||||||||||||| || ||||||||||| |||||
Sbjct: 1098 gtgagaccagcacaaacagcatagcctcaatctttgcctggtc 1140



 Score = 42.1 bits (21), Expect = 8.2
 Identities = 60/73 (82%)
 Strand = Plus / Plus

                                                                       
Query: 927 gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
           ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 595 gatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaaaac 654

                        
Query: 987 tatgatggagatg 999
           || ||||||||||
Sbjct: 655 tacgatggagatg 667



to top

>gb|AY997903.1| Saltugilia caruifolia voucher Johnson 97-100 BRY clone 97100
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1612

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||||||||| || ||||| || ||||||||||| |
Sbjct: 1380 ttgaagctgaagcagctcacggcacagtcacacgccactacagggttcaccaaaaaggtg 1439

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1440 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1482



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || ||||| || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 626  gatgatatggttgcttatgctcttaagagtgatggaggttatgtatgggcgtgcaaaaac 685

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 686  tacgatggagatgttcagag 705



to top

>gb|AY997902.1| Saltugilia caruifolia voucher Johnson 97-099 BRY clone 97099
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1306

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1061 ttgaagctgaagcagctcacggcacagtgacacgccattacagggttcaccaaaaaggtg 1120

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1121 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1163



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 67/80 (83%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || ||||| || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 617  gatgatatggttgcttatgctcttaagagtgatggaggttatgtatgggcatgcaaaaac 676

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 677  tacgatggagatgttcagag 696



to top

>gb|AY997897.1| Saltugilia australis voucher Johnson 97-082 BRY clone 97082
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 1057 ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 1116

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1117 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1159



to top

>gb|AY997896.1| Saltugilia australis voucher Johnson 97-065 BRY clone 97065
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 1057 ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 1116

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1117 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1159



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 615  gatgatatggttgcttacgctctcaagagtgatggaggttatgtatgggcatgcaaaaac 674

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 675  tacgatggagatgttcagag 694



to top

>gb|AY997894.1| Saltugilia australis voucher Johnson 97-049 BRY clone 41 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1469

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 1057 ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 1116

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1117 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1159



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 615  gatgatatggttgcttacgctctcaagagtgatggaggttatgtatgggcatgcaaaaac 674

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 675  tacgatggagatgttcagag 694



to top

>gb|AY997893.1| Saltugilia australis voucher Johnson 97-049 BRY clone 40 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 1057 ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 1116

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1117 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1159



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 615  gatgatatggttgcttacgctctcaagagtgatggaggttatgtatgggcatgcaaaaac 674

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 675  tacgatggagatgttcagag 694



to top

>gb|AY997892.1| Saltugilia australis voucher Johnson 97-049 BRY clone 39 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 1057 ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 1116

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1117 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1159



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 615  gatgatatggttgcttacgctctcaagagtgatggaggttatgtatgggcatgcaaaaac 674

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 675  tacgatggagatgttcagag 694



to top

>gb|AY997891.1| Saltugilia australis voucher Johnson 97-049 BRY clone 37 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 1057 ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 1116

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1117 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1159



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 615  gatgatatggttgcttacgctctcaagagtgatggaggttatgtgtgggcatgcaaaaac 674

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 675  tacgatggagatgttcagag 694



to top

>gb|AY997890.1| Saltugilia australis voucher Johnson 97-049 BRY clone 36 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1470

 Score =  101 bits (51), Expect = 1e-17
 Identities = 90/103 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| |||||||| || |||||||| || ||||||||||| |
Sbjct: 1057 ttgaagctgaagcagctcacggcacagtcacgcgccattacagggttcaccaaaaaggtg 1116

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1117 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1159



to top

>dbj|AK059893.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-208-D11, full
            insert sequence
          Length = 1312

 Score =  101 bits (51), Expect = 1e-17
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                        
Query: 1887 gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
            |||||| |||||| ||||||||| || |||||||| ||||||||||||||||||||||  
Sbjct: 886  gcagcagcaggcgtgctcaagaagctcgcgaggaaattgccgcgctcgtagaagtactcc 827

                                   
Query: 1947 gccttctccaccttcatctcctc 1969
            | |||||||||||||||||||||
Sbjct: 826  gtcttctccaccttcatctcctc 804



to top

>emb|Y12540.1|AGIDHC A.graveolens mRNA for isocitrate dehydrogenase (NADP+)
          Length = 1535

 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 198/248 (79%)
 Strand = Plus / Plus

                                                                       
Query: 173 catggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagat 232
           |||||||||  |||||||  |||| || |||||||||||||| |||||||| ||||| ||
Sbjct: 60  catggcgtttcagaagattaaggtcgctaaccccatcgtcgaaatggacggagatgaaat 119

                                                                       
Query: 233 gacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctgga 292
           ||| ||  |  | |||||||  || || || |||||||||||||| ||  | || || ||
Sbjct: 120 gacccgtgtattttggaaatctattaaggacaagcttatatttccctttgttgagcttga 179

                                                                       
Query: 293 cataaaatactttgacttaggtctacctaaccgtgacgctactggggataaagtaacgat 352
            ||||||||||||||| | || || ||| ||||||| || || |  |||||||| ||  |
Sbjct: 180 tataaaatactttgaccttggccttcctcaccgtgatgcaaccgatgataaagttactgt 239

                                                                       
Query: 353 agaaagtgcagaagctaccctaaagtataacgtggccatcaaatgtgcaactgtcacccc 412
            ||||||||||| |||||||| |||||||| || || ||||||||||||||  | || ||
Sbjct: 240 tgaaagtgcagaggctaccctcaagtataatgtagcaatcaaatgtgcaacaattactcc 299

                   
Query: 413 agatgaag 420
           ||||||||
Sbjct: 300 agatgaag 307



 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 261/333 (78%)
 Strand = Plus / Plus

                                                                        
Query: 668  agagttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacac 727
            ||||||||| || | |||||||| ||||||||| || |||||  | || ||||| |||||
Sbjct: 561  agagttggaagtttacaactttactggtgctggaggtgtagctctgtcaatgtacaacac 620

                                                                        
Query: 728  tgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatg 787
             |||||||| |||||  | |||||||||||||| |||| ||  |||||  | ||||  ||
Sbjct: 621  agatgagtccattcgttcctttgctgaagcttctatgaccactgcttatgaaaagaagtg 680

                                                                        
Query: 788  gccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaaaga 847
            ||||||||||||||| || || || || || || || ||||| || ||||| || || ||
Sbjct: 681  gccactttatcttagcacaaaaaatactattcttaagaaatacgatggaagattcaagga 740

                                                                        
Query: 848  catattccaacaaaactatgaaacaaattggagatgcaggtttgaggatgcaggaatatg 907
            |||||||||| ||   |||||| | |  |||| ||  | || ||| | |||||| |||||
Sbjct: 741  catattccaagaagtttatgaagccagctggaaatcgaagtatgaagctgcagggatatg 800

                                                                        
Query: 908  gtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggcta 967
            |||||| ||  | || |||||||||||||| || ||||| || || ||||| || || ||
Sbjct: 801  gtatgagcaccgtcttattgatgatatggttgcatatgctcttaaaagtgatggaggtta 860

                                             
Query: 968  tgtttgggcttgcaagaattatgatggagatgt 1000
            ||| ||||| ||||| |||||||| || |||||
Sbjct: 861  tgtctgggcatgcaaaaattatgacggggatgt 893



 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 561 atatgcattggcagacatgcttttggtgatcaataccgagcaacagat 608
           |||||||| || |||||||||||||||||||||||||| |||||||||
Sbjct: 448 atatgcatcggaagacatgcttttggtgatcaataccgcgcaacagat 495



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 1149 agcacaaacagcattgcgtcaatctttgcatggtc 1183
            |||||||||||||| || |||||||||||||||||
Sbjct: 1042 agcacaaacagcatagcatcaatctttgcatggtc 1076



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                  
Query: 1254 gctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagctctt 1307
            ||||||||||| || || |||||  |||||| |||||| |||||||| ||||||
Sbjct: 1147 gctgcttgtgttggtactgtggaggctggaaggatgaccaaggaccttgctctt 1200



to top

>gb|AY997862.1| Lathrocasis tenerrima voucher Johnson 93-103 WS clone 2 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 464

 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 117/140 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1044 atgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacggt 1103
            |||||||||||  |||| ||||||||||| |  ||  ||||||||||||| || ||||| 
Sbjct: 169  atgacatcggtcctggtctgccctgatggaaagaccattgaagctgaagcagctcacggc 228

                                                                        
Query: 1104 acagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcatt 1163
            ||||| || || |||||||| || |||||||||||  | ||||| |||||||||||||| 
Sbjct: 229  acagttacccgccattacagggttcaccaaaaaggtagtgaaaccagcacaaacagcata 288

                                
Query: 1164 gcgtcaatctttgcatggtc 1183
            || ||||||||||| |||||
Sbjct: 289  gcctcaatctttgcctggtc 308



to top

>gb|AY997887.1| Lathrocasis tenerrima voucher Johnson 93-103 WS isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1046

 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 117/140 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1044 atgacatcggttttggtgtgccctgatggtagaacagttgaagctgaagctgcacacggt 1103
            |||||||||||  |||| ||||||||||| |  ||  ||||||||||||| || ||||| 
Sbjct: 849  atgacatcggtcctggtctgccctgatggaaagaccattgaagctgaagcagctcacggc 908

                                                                        
Query: 1104 acagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcatt 1163
            ||||| || || |||||||| || |||||||||||  | ||||| |||||||||||||| 
Sbjct: 909  acagttacccgccattacagggttcaccaaaaaggtagtgaaaccagcacaaacagcata 968

                                
Query: 1164 gcgtcaatctttgcatggtc 1183
            || ||||||||||| |||||
Sbjct: 969  gcctcaatctttgcctggtc 988



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || || || || |||||||| || || ||||| ||||| ||||||
Sbjct: 615  attgatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaag 674

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||| ||||| |||||
Sbjct: 675  aactacgatggggatgttcagag 697



to top

>dbj|AP003212.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
            clone:OSJNBa0049H05
          Length = 161934

 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||| ||||| || ||||| || ||||||||||| |||||||| |||||||||||||||
Sbjct: 1486 gatgacatggttgcttatgcacttaagagtgaagggggctatgtgtgggcttgcaagaat 1427

                                
Query: 987  tatgatggagatgtgcagag 1006
            || |||||||||||||||||
Sbjct: 1426 tacgatggagatgtgcagag 1407



 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                 
Query: 172  ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggt 224
            |||||||||||||||||||| |||| |||||||||||||||||||||||||||
Sbjct: 3996 ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 3944



 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                        
Query: 1058 ggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgaca 1117
            ||||||||||||||| | |||| |||||||||||||||| || || || || || || ||
Sbjct: 1085 ggtgtgccctgatggaaaaacaattgaagctgaagctgcccatggcacggttacccgtca 1026

                                                                        
Query: 1118 ttacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
            || | | || ||||| || ||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 1025 tttccgtgttcaccagaagggaggtgaaaccagcacaaacagcattgcttcaatctttgc 966



 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                        
Query: 741  cgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatctt 800
            ||||| |||||||||||||| ||||  |  |||||  |||||| |||||| |||||||||
Sbjct: 1881 cgagcttttgctgaagcttctatgacaactgcttatgagaagaaatggccgctttatctt 1822

                                                    
Query: 801  agtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            || || || |||||||||||||| |||||||| |||||||
Sbjct: 1821 agcaccaaaaacacaatcctgaagaaatatgatggaaggt 1782



 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 546  ggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaac 604
            |||||||| || ||||| |||||||| || ||||||||||||||||| |||||||||||
Sbjct: 2245 ggatggactaagcccatttgcattggaaggcatgcttttggtgatcagtaccgagcaac 2187



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                        
Query: 1244 aaaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagc 1303
            |||||||||||||||||| || || || ||||||||||| |||||||| || ||||| ||
Sbjct: 691  aaaacttgaagctgcttgcgttggaaccgtggaatctgggaagatgaccaaagaccttgc 632

                  
Query: 1304 tcttct 1309
            ||||||
Sbjct: 631  tcttct 626



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 673  tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
            |||| ||||||||||| | ||||||||| ||||| || || |||||||| ||||||||||
Sbjct: 2028 tggaggtgttcaacttcactggtgctggaggagttgctttgtctatgtacaacactgatg 1969

              
Query: 733  ag 734
            ||
Sbjct: 1968 ag 1967



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 1356 gagttcattgatgcggttgctgaggag 1382
            |||||||||||||||||||||| ||||
Sbjct: 458  gagttcattgatgcggttgctgcggag 432



to top

>dbj|AP003709.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBb0006H05
          Length = 154821

 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                          
Query: 927    gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
              ||||| ||||| || ||||| || ||||||||||| |||||||| |||||||||||||||
Sbjct: 136391 gatgacatggttgcttatgcacttaagagtgaagggggctatgtgtgggcttgcaagaat 136332

                                  
Query: 987    tatgatggagatgtgcagag 1006
              || |||||||||||||||||
Sbjct: 136331 tacgatggagatgtgcagag 136312



 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                   
Query: 172    ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggt 224
              |||||||||||||||||||| |||| |||||||||||||||||||||||||||
Sbjct: 138901 ccatggcgttcgagaagatcaaggtcgccaaccccatcgtcgagatggacggt 138849



 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                          
Query: 1058   ggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgaca 1117
              ||||||||||||||| | |||| |||||||||||||||| || || || || || || ||
Sbjct: 135990 ggtgtgccctgatggaaaaacaattgaagctgaagctgcccatggcacggttacccgtca 135931

                                                                          
Query: 1118   ttacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
              || | | || ||||| || ||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 135930 tttccgtgttcaccagaagggaggtgaaaccagcacaaacagcattgcttcaatctttgc 135871



 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 85/100 (85%)
 Strand = Plus / Minus

                                                                          
Query: 741    cgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatctt 800
              ||||| |||||||||||||| ||||  |  |||||  |||||| |||||| |||||||||
Sbjct: 136786 cgagcttttgctgaagcttctatgacaactgcttatgagaagaaatggccgctttatctt 136727

                                                      
Query: 801    agtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
              || || || |||||||||||||| |||||||| |||||||
Sbjct: 136726 agcaccaaaaacacaatcctgaagaaatatgatggaaggt 136687



 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 546    ggatggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagcaac 604
              |||||||| || ||||| |||||||| || ||||||||||||||||| |||||||||||
Sbjct: 137150 ggatggactaagcccatttgcattggaaggcatgcttttggtgatcagtaccgagcaac 137092



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 1244   aaaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagc 1303
              |||||||||||||||||| || || || ||||||||||| |||||||| || ||||| ||
Sbjct: 135596 aaaacttgaagctgcttgcgttggaaccgtggaatctgggaagatgaccaaagaccttgc 135537

                    
Query: 1304   tcttct 1309
              ||||||
Sbjct: 135536 tcttct 135531



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                          
Query: 673    tggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgatg 732
              |||| ||||||||||| | ||||||||| ||||| || || |||||||| ||||||||||
Sbjct: 136933 tggaggtgttcaacttcactggtgctggaggagttgctttgtctatgtacaacactgatg 136874

                
Query: 733    ag 734
              ||
Sbjct: 136873 ag 136872



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 1356   gagttcattgatgcggttgctgaggag 1382
              |||||||||||||||||||||| ||||
Sbjct: 135363 gagttcattgatgcggttgctgcggag 135337



to top

>gb|AY997872.1| Saltugilia caruifolia voucher Johnson 93-092 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 967

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            |||||||||| || || ||||| ||||| ||||| ||||||||||| ||||||||||| |
Sbjct: 639  ttgaagctgaggcagctcacggcacagttacacgccattacagagttcaccaaaaaggtg 698

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || |||||||| || |||||
Sbjct: 699  gtgaaaccagcacaaacagcatagcctcaatcttcgcctggtc 741



to top

>gb|AY997866.1| Navarretia breweri voucher Johnson 93-101 WS isocitrate dehydrogenase
            gene, exons K-N and partial cds
          Length = 920

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            |||||||||||||||| || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 401  ttgaagctgaagctgctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 460

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 461  gtgaaacgagcacaaacagcatagcttcaatctttgcctggtc 503



to top

>gb|AY997859.1| Gilia stellata voucher Johnson 97-006 BRY isocitrate dehydrogenase
            gene, exons K-N and partial cds
          Length = 793

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||||||| || ||||||||||  |
Sbjct: 279  ttgaagctgaagcagctcacggcacagttacacgccattacagggttcaccaaaaagatg 338

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 339  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 381



to top

>gb|AY997855.1| Gilia capitata voucher Johnson 92-015 WS isocitrate dehydrogenase
            gene, exons K-N and partial cds
          Length = 842

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 342  ttgaagctgaagcagctcacggcacagttacacgccatttcagggttcaccaaaaaggtg 401

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 402  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 444



to top

>gb|AY997854.1| Dayia scabra voucher Porter 15422 RSA isocitrate dehydrogenase gene,
            exons K-N and partial cds
          Length = 734

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 381  ttgaagctgaagcagctcatggcacagttacacgccattacagggttcaccaaaaaggtg 440

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            ||||||| |||||||||||||| || |||||||| || |||||
Sbjct: 441  gcgaaaccagcacaaacagcatagcctcaatcttcgcgtggtc 483



to top

>gb|AY997847.1| Aliciella latifolia voucher Johnson 93-018 WS clone 2 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 792

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            |||| |||||||| || || || ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 408  ttgaggctgaagcagctcatggcacagttacacgccattacagggttcaccaaaaaggtg 467

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            ||||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 468  gcgaaaccagcacaaacagcatagcctcaatctttgcgtggtc 510



to top

>gb|AY997846.1| Aliciella latifolia voucher Johnson 93-018 WS clone 1 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 838

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            |||| |||||||| || || || ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 473  ttgaggctgaagcagctcatggcacagttacacgccattacagggttcaccaaaaaggtg 532

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            ||||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 533  gcgaaaccagcacaaacagcatagcctcaatctttgcgtggtc 575



to top

>gb|AY997918.1| Saltugilia splendens subsp. splendens voucher Johnson 97-120 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1553

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1361 ttgaagctgaagcagctcatggcacagtgacacgccattacagggttcaccaaaaaggtg 1420

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1421 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1463



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 615  gatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaaaac 674

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 675  tacgatggagatgttcagag 694



to top

>gb|AY997913.1| Saltugilia splendens subsp. grantii voucher Johnson 94-057 BRY clone
            9 isocitrate dehydrogenase gene, exons H-M and partial
            cds
          Length = 1564

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| || ||||| || ||||||||||| |
Sbjct: 1372 ttgaagctgaagcagctcacggcacagtgacacgccactacagggttcaccaaaaaggtg 1431

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1432 gtgaaaccagcacaaacagcatagcatcaatctttgcctggtc 1474



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||| ||||| || || || || |||||||| || || ||||| ||||| ||||| 
Sbjct: 617  attgatgacatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaa 676

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || |||||||||||||| |||||
Sbjct: 677  aactatgatggagatgttcagag 699



to top

>gb|AY997900.1| Saltugilia caruifolia voucher Johnson 93-092 BRY clone 15b isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1537

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            |||||||||| || || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1064 ttgaagctgaggcagctcacggcacagttacacgccattacagggttcaccaaaaaggtg 1123

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1124 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1166



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || ||||| || |||||||| || || ||||| ||||| || || 
Sbjct: 618  attgatgatatggttgcttatgctcttaagagtgatggaggttatgtatgggcgtgtaaa 677

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||||||||| |||||
Sbjct: 678  aactacgatggagatgttcagag 700



to top

>gb|AY997885.1| Gilia stellata voucher Johnson 97-006 BRY isocitrate dehydrogenase
            gene, exons H-M and partial cds
          Length = 2016

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            |||| |||||||| || ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1370 ttgaggctgaagcagctcacggcacagttacacgccattacagggttcaccaaaaaggtg 1429

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1430 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1472



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || || || || |||||||| || || ||||| ||||| ||||||
Sbjct: 1001 attgatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaag 1060

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||||||||| |||||
Sbjct: 1061 aactacgatggagatgttcagag 1083



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 786 tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
           ||||| ||||||||||| ||||| || || ||||| || |||||||| |||||||
Sbjct: 152 tggcctctttatcttagcacgaaaaatactatcctcaagaaatatgatggaaggt 206



to top

>gb|AY997882.1| Dayia scabra voucher Porter 15422 RSA isocitrate dehydrogenase gene,
            exons H-M and partial cds
          Length = 1324

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 89/103 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 1074 ttgaagctgaagcagctcatggcacagttacacgccattacagggttcaccaaaaaggtg 1133

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            ||||||| |||||||||||||| || |||||||| || |||||
Sbjct: 1134 gcgaaaccagcacaaacagcatagcctcaatcttcgcgtggtc 1176



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || ||||| || |||||||| || || ||||| ||||| ||||| 
Sbjct: 628  attgatgatatggttgcttatgctcttaagagtgatggaggttatgtatgggcatgcaaa 687

                                                      
Query: 984  aattatgatggagatgtgcagagcgatctaattgctcaaggt 1025
            ||||||||||| ||||| || || ||| |  |||||||||||
Sbjct: 688  aattatgatggggatgttcaaagtgatttccttgctcaaggt 729



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                       
Query: 747 tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
           |||||||| ||||| |||| ||  |||||| |||| |  ||||| ||||||||||| || 
Sbjct: 117 tttgctgaggcttcaatgaccacagcttacgagaaaaagtggcctctttatcttagcacc 176

                                             
Query: 807 aagaacacaatcctgaaaaaatatgacggaaggt 840
           || || || ||||| || |||||||| |||||||
Sbjct: 177 aaaaatactatccttaagaaatatgatggaaggt 210



to top

>gb|AY997875.1| Saltugilia splendens subsp. grantii voucher Johnson 92-083 BRY
            isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 953

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| || || |||||||| || ||||||||||| |
Sbjct: 383  ttgaagctgaagcagctcacggcacagtgacgcgccattacagggttcaccaaaaaggtg 442

                                                      
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggt 1182
            | ||||| |||||||||||||| || ||||||||||| ||||
Sbjct: 443  gtgaaaccagcacaaacagcatagcctcaatctttgcctggt 484



to top

>gb|AY997845.1| Aliciella hutchinsifolia voucher Johnson 96-069 WS clone 2 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 835

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1086 gctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaa 1145
            |||||||| || || || ||||| || || |||||||| || ||||||||||| ||||||
Sbjct: 468  gctgaagcagctcatggcacagttactcgccattacagggttcaccaaaaaggtggcgaa 527

                                                  
Query: 1146 actagcacaaacagcattgcgtcaatctttgcatggtc 1183
            || |||||||||||||| || |||||||||||||||||
Sbjct: 528  accagcacaaacagcatagcctcaatctttgcatggtc 565



to top

>gb|AY997844.1| Aliciella hutchinsifolia voucher Johnson 96-069 WS clone 1 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 835

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1086 gctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaa 1145
            |||||||| || || || ||||| || || |||||||| || ||||||||||| ||||||
Sbjct: 468  gctgaagcagctcatggcacagttactcgccattacagggttcaccaaaaaggtggcgaa 527

                                                  
Query: 1146 actagcacaaacagcattgcgtcaatctttgcatggtc 1183
            || |||||||||||||| || |||||||||||||||||
Sbjct: 528  accagcacaaacagcatagcctcaatctttgcatggtc 565



to top

>gb|AY997914.1| Saltugilia splendens subsp. grantii voucher Johnson 92-083 BRY
            isocitrate dehydrogenase gene, exons H-M and partial cds
          Length = 1543

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 88/102 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| || || |||||||| || ||||||||||| |
Sbjct: 1066 ttgaagctgaagcagctcacggcacagtgacgcgccattacagggttcaccaaaaaggtg 1125

                                                      
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggt 1182
            | ||||| |||||||||||||| || ||||||||||| ||||
Sbjct: 1126 gtgaaaccagcacaaacagcatagcctcaatctttgcctggt 1167



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| || || || || |||||||| || || ||||| ||||| ||||| || 
Sbjct: 621  gatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaaaaac 680

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 681  tacgatggagatgttcagag 700



to top

>gb|AY997879.1| Aliciella hutchinsifolia voucher Johnson 93-069 WS isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1434

 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 85/98 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1086 gctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaa 1145
            |||||||| || || || ||||| || || |||||||| || ||||||||||| ||||||
Sbjct: 1156 gctgaagcagctcatggcacagttactcgccattacagggttcaccaaaaaggtggcgaa 1215

                                                  
Query: 1146 actagcacaaacagcattgcgtcaatctttgcatggtc 1183
            || |||||||||||||| || |||||||||||||||||
Sbjct: 1216 accagcacaaacagcatagcctcaatctttgcatggtc 1253



 Score = 67.9 bits (34), Expect = 1e-07
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || || || || |||||||| || || ||||| ||||| ||||||
Sbjct: 623  attgatgatatggttgcgtacgctctcaagagtgatggaggttatgtatgggcatgcaag 682

                                                      
Query: 984  aattatgatggagatgtgcagagcgatctaattgctcaaggt 1025
            || |||||||||||||| || || ||| |  |||||||||||
Sbjct: 683  aactatgatggagatgttcaaagtgatttccttgctcaaggt 724



to top

>emb|CR855213.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSIGBa0101P20,
             complete sequence
          Length = 96688

 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                         
Query: 922   tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
             |||||||||| |||||||| |||||  | || ||||||||||| ||||||||||||||||
Sbjct: 40789 tgattgatgacatggtggcatatgctgtgaaaagtgaaggtggatatgtttgggcttgca 40848

                                      
Query: 982   agaattatgatggagatgtgcagag 1006
             | || |||||||||||||| |||||
Sbjct: 40849 aaaactatgatggagatgttcagag 40873



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 200   caaccccatcgtcgagatggacggtg 225
             ||||||||||||||||||||||||||
Sbjct: 36990 caaccccatcgtcgagatggacggtg 37015



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                         
Query: 1231  tggatttcacacaaaaacttgaagctgcttgtgtggggacagtggaatctggaaagatga 1290
             ||||||||||| | ||||||||| |||| ||| | |  ||||| ||||| || |||||||
Sbjct: 41477 tggatttcacaaagaaacttgaatctgcatgtattgaaacagttgaatcggggaagatga 41536

                                         
Query: 1291  caaaggacctagctcttctcatccatgg 1318
             ||||||| || || || || ||||||||
Sbjct: 41537 caaaggatcttgcactccttatccatgg 41564



to top

>ref|NM_001059804.1| Oryza sativa (japonica cultivar-group) Os04g0508200 (Os04g0508200)
            mRNA, complete cds
          Length = 1762

 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                        
Query: 922  tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
            |||||||||| |||||||| |||||  | || ||||||||||| ||||||||||||||||
Sbjct: 990  tgattgatgacatggtggcatatgctgtgaaaagtgaaggtggatatgtttgggcttgca 1049

                                     
Query: 982  agaattatgatggagatgtgcagag 1006
            | || |||||||||||||| |||||
Sbjct: 1050 aaaactatgatggagatgttcagag 1074



 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 200 caaccccatcgtcgagatggacggtgatgagatgac 235
           ||||||||||||||||||||||||||| ||||||||
Sbjct: 268 caaccccatcgtcgagatggacggtgacgagatgac 303



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1152 acaaacagcattgcgtcaatctttgcatggtctactggattagcacatagggcaaagctg 1211
            ||||| |||||||| || || ||||| ||| ||  |||| ||| |||||| |||||||||
Sbjct: 1220 acaaatagcattgcttctatatttgcttggactcgtggactagaacatagagcaaagctg 1279

                                                                        
Query: 1212 gatgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtggggaca 1271
            ||| | ||  | || ||| ||||||||||| | ||||||||| |||| ||| | |  |||
Sbjct: 1280 gataaaaatgataggctgctggatttcacaaagaaacttgaatctgcatgtattgaaaca 1339

                                                           
Query: 1272 gtggaatctggaaagatgacaaaggacctagctcttctcatccatgg 1318
            || ||||| || |||||||||||||| || || || || ||||||||
Sbjct: 1340 gttgaatcggggaagatgacaaaggatcttgcactccttatccatgg 1386



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccg 505
           ||||||||||| |||||||| || || ||||| ||  |||||||||||||||||||
Sbjct: 518 atgtggaggagcccaaatggcaccatcaggaatattctaaatggaactgttttccg 573



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 785 atggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaa 844
           |||||| |||||||| || || |||||||||||  |||| |||||||| || ||||| ||
Sbjct: 853 atggcctctttatctcagcaccaagaacacaatattgaagaaatatgatggcaggttcaa 912

                       
Query: 845 agacatattcca 856
            ||||| |||||
Sbjct: 913 ggacatcttcca 924



to top

>ref|NM_001049117.1| Oryza sativa (japonica cultivar-group) Os01g0248300 (Os01g0248300)
            mRNA, complete cds
          Length = 723

 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                        
Query: 1887 gcagcaacaggcgcgctcaagaaacttgcgaggaagttgccgcgctcgtagaagtactat 1946
            |||||| |||||||||||||||| || |||||||| |||||||| ||||||||| | |  
Sbjct: 671  gcagcagcaggcgcgctcaagaagctcgcgaggaaattgccgcgttcgtagaagaattcc 612

                                         
Query: 1947 gccttctccaccttcatctcctcatcaac 1975
            |||||||| |||||||||||||| |||||
Sbjct: 611  gccttctcaaccttcatctcctcgtcaac 583



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4
          Length = 35498469

 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                            
Query: 922      tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
                |||||||||| |||||||| |||||  | || ||||||||||| ||||||||||||||||
Sbjct: 25367149 tgattgatgacatggtggcatatgctgtgaaaagtgaaggtggatatgtttgggcttgca 25367208

                                         
Query: 982      agaattatgatggagatgtgcagag 1006
                | || |||||||||||||| |||||
Sbjct: 25367209 aaaactatgatggagatgttcagag 25367233



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                          
Query: 200      caaccccatcgtcgagatggacggtg 225
                ||||||||||||||||||||||||||
Sbjct: 25363347 caaccccatcgtcgagatggacggtg 25363372



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                            
Query: 1231     tggatttcacacaaaaacttgaagctgcttgtgtggggacagtggaatctggaaagatga 1290
                ||||||||||| | ||||||||| |||| ||| | |  ||||| ||||| || |||||||
Sbjct: 25367837 tggatttcacaaagaaacttgaatctgcatgtattgaaacagttgaatcggggaagatga 25367896

                                            
Query: 1291     caaaggacctagctcttctcatccatgg 1318
                ||||||| || || || || ||||||||
Sbjct: 25367897 caaaggatcttgcactccttatccatgg 25367924



to top

>gb|AY997843.1| Acanthogilia gloriosa voucher Johnson 95-070 WS isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 806

 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 87/101 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggc 1142
            ||||||||||| || || || ||||| ||||| |||||||| || ||||||||||| || 
Sbjct: 418  gaagctgaagcagctcatggcacagttacacgccattacagggttcaccaaaaaggtggt 477

                                                     
Query: 1143 gaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 478  gaaaccagcacaaacagcatagcctcaatctttgcgtggtc 518



to top

>emb|AL662969.3|OSJN00169 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043L24,
             complete sequence
          Length = 164577

 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                         
Query: 922   tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
             |||||||||| |||||||| |||||  | || ||||||||||| ||||||||||||||||
Sbjct: 93708 tgattgatgacatggtggcatatgctgtgaaaagtgaaggtggatatgtttgggcttgca 93767

                                      
Query: 982   agaattatgatggagatgtgcagag 1006
             | || |||||||||||||| |||||
Sbjct: 93768 aaaactatgatggagatgttcagag 93792



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 200   caaccccatcgtcgagatggacggtg 225
             ||||||||||||||||||||||||||
Sbjct: 89906 caaccccatcgtcgagatggacggtg 89931



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 72/88 (81%)
 Strand = Plus / Plus

                                                                         
Query: 1231  tggatttcacacaaaaacttgaagctgcttgtgtggggacagtggaatctggaaagatga 1290
             ||||||||||| | ||||||||| |||| ||| | |  ||||| ||||| || |||||||
Sbjct: 94396 tggatttcacaaagaaacttgaatctgcatgtattgaaacagttgaatcggggaagatga 94455

                                         
Query: 1291  caaaggacctagctcttctcatccatgg 1318
             ||||||| || || || || ||||||||
Sbjct: 94456 caaaggatcttgcactccttatccatgg 94483



to top

>dbj|AK070042.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038I06, full
            insert sequence
          Length = 1765

 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 75/85 (88%)
 Strand = Plus / Plus

                                                                        
Query: 922  tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
            |||||||||| |||||||| |||||  | || ||||||||||| ||||||||||||||||
Sbjct: 993  tgattgatgacatggtggcatatgctgtgaaaagtgaaggtggatatgtttgggcttgca 1052

                                     
Query: 982  agaattatgatggagatgtgcagag 1006
            | || |||||||||||||| |||||
Sbjct: 1053 aaaactatgatggagatgttcagag 1077



 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 35/36 (97%)
 Strand = Plus / Plus

                                               
Query: 200 caaccccatcgtcgagatggacggtgatgagatgac 235
           ||||||||||||||||||||||||||| ||||||||
Sbjct: 271 caaccccatcgtcgagatggacggtgacgagatgac 306



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 133/167 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1152 acaaacagcattgcgtcaatctttgcatggtctactggattagcacatagggcaaagctg 1211
            ||||| |||||||| || || ||||| ||| ||  |||| ||| |||||| |||||||||
Sbjct: 1223 acaaatagcattgcttctatatttgcttggactcgtggactagaacatagagcaaagctg 1282

                                                                        
Query: 1212 gatgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtggggaca 1271
            ||| | ||  | || ||| ||||||||||| | ||||||||| |||| ||| | |  |||
Sbjct: 1283 gataaaaatgataggctgctggatttcacaaagaaacttgaatctgcatgtattgaaaca 1342

                                                           
Query: 1272 gtggaatctggaaagatgacaaaggacctagctcttctcatccatgg 1318
            || ||||| || |||||||||||||| || || || || ||||||||
Sbjct: 1343 gttgaatcggggaagatgacaaaggatcttgcactccttatccatgg 1389



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccg 505
           ||||||||||| |||||||| || || ||||| ||  |||||||||||||||||||
Sbjct: 521 atgtggaggagcccaaatggcaccatcaggaatattctaaatggaactgttttccg 576



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 60/72 (83%)
 Strand = Plus / Plus

                                                                       
Query: 785 atggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggtttaa 844
           |||||| |||||||| || || |||||||||||  |||| |||||||| || ||||| ||
Sbjct: 856 atggcctctttatctcagcaccaagaacacaatattgaagaaatatgatggcaggttcaa 915

                       
Query: 845 agacatattcca 856
            ||||| |||||
Sbjct: 916 ggacatcttcca 927



to top

>gb|AC126787.12| Medicago truncatula clone mth2-11c8, complete sequence
          Length = 124211

 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                         
Query: 924   attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
             ||||||||||||||||| ||||| || ||||||||||| || ||||| ||||| ||||| 
Sbjct: 44810 attgatgatatggtggcatatgcactcaagagtgaaggaggttatgtatgggcatgcaaa 44751

                                                         
Query: 984   aattatgatggagatgtgcagagcgatctaattgctcaaggttt 1027
             || |||||||||||||| ||||| ||| |  | |||||||||||
Sbjct: 44750 aactatgatggagatgtccagagtgatttcttagctcaaggttt 44707



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 549   tggacaaaacccatatgcattggcagacatgcttttggtgatcaata 595
             |||||||| || ||||| ||||| || ||||||||||||||||||||
Sbjct: 45633 tggacaaagccaatatgtattggaaggcatgcttttggtgatcaata 45587



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 449   tatgtggaggagtccaaatgggacaataaggaacatcttaaatgg 493
             ||||||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 45962 tatgtggaggagtccaaatggaacaatcagaaacattttgaatgg 45918



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 785   atggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
             |||||||||||||||||| || || || ||||| || || |||||||| |||||||
Sbjct: 45129 atggccactttatcttagcaccaaaaatacaattcttaagaaatatgatggaaggt 45074



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 77/95 (81%)
 Strand = Plus / Minus

                                                                         
Query: 1083  gaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggc 1142
             ||||| ||||| || || || ||||| || || |||| ||| || |||||||| || || 
Sbjct: 44038 gaagcagaagcagcccatgggacagttacccgtcatttcagggttcaccaaaagggtgga 43979

                                                
Query: 1143  gaaactagcacaaacagcattgcgtcaatctttgc 1177
             ||||| |||||||||||||| || || ||||||||
Sbjct: 43978 gaaaccagcacaaacagcatagcatccatctttgc 43944



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 195   gttgccaaccccatcgtcgagatggacggt 224
             |||||||| |||||||| ||||||||||||
Sbjct: 47815 gttgccaatcccatcgttgagatggacggt 47786



to top

>emb|X96728.1|NTNADPI N.tabacum mRNA for NADP-dependent isocitrate dehydrogenase
          Length = 1722

 Score = 87.7 bits (44), Expect = 2e-13
 Identities = 107/128 (83%)
 Strand = Plus / Plus

                                                                        
Query: 903  atatggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggt 962
            ||||||||||| |||||| |||| ||||| ||||| || |||||  |||| || |  |||
Sbjct: 1009 atatggtatgagcatagattgatagatgacatggtagcttatgcattaaaaagcgggggt 1068

                                                                        
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaa 1022
            || ||||||||||| |||||||| |||||||||||||| ||||| |||||  | ||||||
Sbjct: 1069 ggatatgtttgggcatgcaagaactatgatggagatgtccagagtgatctgctcgctcaa 1128

                    
Query: 1023 ggttttgg 1030
            || |||||
Sbjct: 1129 ggatttgg 1136



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 50/58 (86%)
 Strand = Plus / Plus

                                                                     
Query: 448 ctatgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccg 505
           |||||||||| ||||| ||||  ||||| || ||||| |||||||| |||||||||||
Sbjct: 551 ctatgtggagaagtcccaatgccacaatcagaaacattttaaatggtactgttttccg 608



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                       
Query: 210 gtcgagatggacggtgatgagatgacacgaattatatggaaatggatcaaagataagctt 269
           ||||| |||||||||||||| |||||  |  ||||||||| |  ||||||||| ||||| 
Sbjct: 313 gtcgaaatggacggtgatgaaatgacgagggttatatggacaatgatcaaagagaagcta 372

                     
Query: 270 atatttcctt 279
           |||| |||||
Sbjct: 373 atatatcctt 382



to top

>gb|DQ465384.1| Oreochromis mossambicus clone SSH #509 mitochondrial isocitrate
           dehydrogenase 2-like mRNA, complete cds; nuclear gene
           for mitochondrial product
          Length = 1674

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                       
Query: 501 ttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaaccc 560
           ||||| || |||||||||||||||||  |||| |||||||| ||||| |||||| | |||
Sbjct: 509 ttccgtgagccaatcatctgcaagaacattccccggcttgttcctggctggacacagccc 568

                                                          
Query: 561 atatgcattggcagacatgcttttggtgatcaataccgagcaacaga 607
           ||   |||||||||||| || ||||||||||| ||| ||||||||||
Sbjct: 569 atcaccattggcagacacgcctttggtgatcagtacagagcaacaga 615



to top

>ref|NM_121463.3| Arabidopsis thaliana isocitrate dehydrogenase (NADP+)/ oxidoreductase
            (AT5G14590) mRNA, complete cds
          Length = 1801

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 124/151 (82%)
 Strand = Plus / Plus

                                                                        
Query: 922  tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
            |||||||||| |||||||| || ||  | || ||||||||||||||||| ||||||||||
Sbjct: 1070 tgattgatgacatggtggcttacgcagtcaaaagtgaaggtggctatgtctgggcttgca 1129

                                                                        
Query: 982  agaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtc 1041
            | || || || || ||||| || ||||||||  |||| ||||| ||||| || ||||| |
Sbjct: 1130 aaaactacgacggtgatgttcaaagcgatcttcttgcccaagggtttggctcattaggcc 1189

                                           
Query: 1042 tcatgacatcggttttggtgtgccctgatgg 1072
            ||||||| || |||||| ||| | |||||||
Sbjct: 1190 tcatgacctccgttttgctgtccgctgatgg 1220



 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||| |||||||| || || |||||  || ||||||| || ||||| |||
Sbjct: 595 atgtggaggagtcctaatgggacgatcagaaacattctagatggaaccgtattccgtgaa 654

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || || || ||||  ||| | || |||||||| ||||| |||  ||| || |||||||||
Sbjct: 655 cctattatgtgcagcaatatcccccggcttgttcctggttgggaaaagcctatatgcatt 714

                               
Query: 570 ggcagacatgcttttggtga 589
           || |||||||| ||||||||
Sbjct: 715 ggtagacatgcctttggtga 734



to top

>gb|AY810390.1| Schistosoma japonicum SJCHGC05125 protein mRNA, partial cds
          Length = 756

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 139/171 (81%)
 Strand = Plus / Plus

                                                                        
Query: 968  tgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttt 1027
            |||||||||||| || || |||||||| ||||| ||||| ||| | ||||| || |||| 
Sbjct: 117  tgtttgggcttgtaaaaactatgatggtgatgttcagagtgatattattgcccagggtta 176

                                                                        
Query: 1028 tggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagc 1087
            ||||||  ||||||| |||||||| ||  || |||| |||||||| | |||  |||||||
Sbjct: 177  tggatcactaggtcttatgacatctgtactgatgtgtcctgatggaaaaactattgaagc 236

                                                               
Query: 1088 tgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaagg 1138
            |||||| ||||| ||||| || ||||| ||||| ||||  ||||| |||||
Sbjct: 237  tgaagcagcacatggtactgttacacgccattatagagaacaccagaaagg 287



to top

>gb|BT000276.1| Arabidopsis thaliana isocitrate dehydrogenase-like protein
            (At5g14590) mRNA, complete cds
          Length = 1514

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 124/151 (82%)
 Strand = Plus / Plus

                                                                        
Query: 922  tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
            |||||||||| |||||||| || ||  | || ||||||||||||||||| ||||||||||
Sbjct: 962  tgattgatgacatggtggcttacgcagtcaaaagtgaaggtggctatgtctgggcttgca 1021

                                                                        
Query: 982  agaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtc 1041
            | || || || || ||||| || ||||||||  |||| ||||| ||||| || ||||| |
Sbjct: 1022 aaaactacgacggtgatgttcaaagcgatcttcttgcccaagggtttggctcattaggcc 1081

                                           
Query: 1042 tcatgacatcggttttggtgtgccctgatgg 1072
            ||||||| || |||||| ||| | |||||||
Sbjct: 1082 tcatgacctccgttttgctgtccgctgatgg 1112



 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||| |||||||| || || |||||  || ||||||| || ||||| |||
Sbjct: 487 atgtggaggagtcctaatgggacgatcagaaacattctagatggaaccgtattccgtgaa 546

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || || || ||||  ||| | || |||||||| ||||| |||  ||| || |||||||||
Sbjct: 547 cctattatgtgcagcaatatcccccggcttgttcctggttgggaaaagcctatatgcatt 606

                               
Query: 570 ggcagacatgcttttggtga 589
           || |||||||| ||||||||
Sbjct: 607 ggtagacatgcctttggtga 626



to top

>gb|AF367449.1| Prunus persica clone Icdh2 NADP-dependent isocitrate dehydrogenase
           (icdh2) mRNA, partial cds
          Length = 396

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 175/219 (79%)
 Strand = Plus / Plus

                                                                       
Query: 683 caactttagtggtgctggtggagtagcattatctatgtataacactgatgagtctattcg 742
           |||||||| ||||||||| ||  |||| || || ||||||||||| ||||||||||| ||
Sbjct: 150 caactttactggtgctggaggcatagctttgtccatgtataacacggatgagtctatccg 209

                                                                       
Query: 743 agcatttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttag 802
            || |||||||| ||||| |||||||  || || ||||| |  |||||||| ||||||||
Sbjct: 210 tgcttttgctgaggcttccatgaacactgcctatcagaaaaagtggccactatatcttag 269

                                                                       
Query: 803 tacgaagaacacaatcctgaaaaaatatgacggaaggtttaaagacatattccaacaaaa 862
            || || || || || ||||| |||||||| ||||| || || ||||| |||||  ||  
Sbjct: 270 cactaaaaatactattctgaagaaatatgatggaagattcaaggacatcttccaggaagt 329

                                                  
Query: 863 ctatgaaacaaattggagatgcaggtttgaggatgcagg 901
            |||||| |  ||||||||| ||| ||||||| ||||||
Sbjct: 330 ttatgaagctcattggagatccagatttgaggctgcagg 368



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 555 aaacccatatgcattggcagacatgcttttggtgatcaataccgagcaac 604
           ||||| ||||||||||| || |||||||||||||| || |||||||||||
Sbjct: 16  aaaccaatatgcattgggaggcatgcttttggtgaccagtaccgagcaac 65



to top

>gb|AY099683.1| Arabidopsis thaliana isocitrate dehydrogenase-like protein
            (At5g14590) mRNA, complete cds
          Length = 1722

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 124/151 (82%)
 Strand = Plus / Plus

                                                                        
Query: 922  tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
            |||||||||| |||||||| || ||  | || ||||||||||||||||| ||||||||||
Sbjct: 1067 tgattgatgacatggtggcttacgcagtcaaaagtgaaggtggctatgtctgggcttgca 1126

                                                                        
Query: 982  agaattatgatggagatgtgcagagcgatctaattgctcaaggttttggatcgttaggtc 1041
            | || || || || ||||| || ||||||||  |||| ||||| ||||| || ||||| |
Sbjct: 1127 aaaactacgacggtgatgttcaaagcgatcttcttgcccaagggtttggctcattaggcc 1186

                                           
Query: 1042 tcatgacatcggttttggtgtgccctgatgg 1072
            ||||||| || |||||| ||| | |||||||
Sbjct: 1187 tcatgacctccgttttgctgtccgctgatgg 1217



 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 114/140 (81%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||| |||||||| || || |||||  || ||||||| || ||||| |||
Sbjct: 592 atgtggaggagtcctaatgggacgatcagaaacattctagatggaaccgtattccgtgaa 651

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || || || ||||  ||| | || |||||||| ||||| |||  ||| || |||||||||
Sbjct: 652 cctattatgtgcagcaatatcccccggcttgttcctggttgggaaaagcctatatgcatt 711

                               
Query: 570 ggcagacatgcttttggtga 589
           || |||||||| ||||||||
Sbjct: 712 ggtagacatgcctttggtga 731



to top

>gb|AY997871.1| Saltugilia australis voucher Johnson 92-011 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 873

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||| ||| || ||||| |||||||| || |||||||| || |||||| |||| |
Sbjct: 379  ttgaagctggagcagctcacggcacagtcacgcgccattacagggttcaccaagaaggtg 438

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 439  gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 481



to top

>gb|AY997869.1| Navarretia mellita voucher Johnson 94-072 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 950

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 390  ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 449

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 450  gtgaaaccagcacaaacagcatagcttcaatctttgcctggtc 492



to top

>gb|AY997867.1| Navarretia jepsonii voucher Johnson 96-011 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 942

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 379  ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 438

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 439  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 481



to top

>gb|AY997857.1| Gilia laciniata voucher Morrell 403 RSA clone 2 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 592

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 328  ttgaagctgaagcagctcacggcacagttacacgccatttcagggttcaccaaaaaggtg 387

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 388  gtgaaaccagcacaaacagcatagcctcgatctttgcctggtc 430



to top

>gb|AY997856.1| Gilia laciniata voucher Morrell 403 RSA clone 1 isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 567

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || | ||| ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 303  ttgaagctgaagcagctcgcggcacagttacacgccatttcagggttcaccaaaaaggtg 362

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 363  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 405



to top

>gb|AY997852.1| Collomia heterophylla voucher Johnson 94-076 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 722

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 400  ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 459

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 460  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 502



to top

>gb|AY997850.1| Allophyllum integrifolium voucher Johnson 93-111 WS clone 2
            isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 673

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 362  ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 421

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 422  gtgaaacgagcacaaacagcatagcttcaatctttgcctggtc 464



to top

>gb|AY997849.1| Allophyllum integrifolium voucher Johnson 93-111 WS clone 1
            isocitrate dehydrogenase gene, exons K-N and partial cds
          Length = 673

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 362  ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 421

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 422  gtgaaacgagcacaaacagcatagcttcaatctttgcctggtc 464



to top

>gb|AY997895.1| Saltugilia australis voucher Johnson 92-011 BRY clone 9211 isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1458

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||| ||| || ||||| |||||||| || |||||||| || |||||| |||| |
Sbjct: 1056 ttgaagctggagcagctcacggcacagtcacgcgccattacagggttcaccaagaaggtg 1115

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1116 gtgaaaccagcacaaacagcatagcctcaatctttgcttggtc 1158



to top

>gb|AY997884.1| Gilia laciniata voucher Morrell 403 RSA isocitrate dehydrogenase
            gene, exons H-M and partial cds
          Length = 1200

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || ||||| ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 987  ttgaagctgaagcagctcacggcacagttacacgccatttcagggttcaccaaaaaggtg 1046

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || || |||||||| |||||
Sbjct: 1047 gtgaaaccagcacaaacagcatagcctcgatctttgcctggtc 1089



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || || || || |||||||| || || ||||| ||||| ||||||
Sbjct: 594  attgatgatatggttgcttacgctctcaagagtgatggaggttatgtatgggcatgcaag 653

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||||||||| |||||
Sbjct: 654  aactacgatggagatgttcagag 676



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 47/55 (85%)
 Strand = Plus / Plus

                                                                  
Query: 786 tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
           ||||| ||||||||||| ||||| || || ||||| || |||||||| |||||||
Sbjct: 150 tggcctctttatcttagcacgaaaaatactatcctcaagaaatatgatggaaggt 204



to top

>gb|AY997880.1| Allophyllum integrifolium voucher Johnson 93-111 WS isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1252

 Score = 85.7 bits (43), Expect = 6e-13
 Identities = 88/103 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 1025 ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 1084

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1085 gtgaaacgagcacaaacagcatagcttcaatctttgcctggtc 1127



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || || || || |||||||| || || ||||| ||||| ||||||
Sbjct: 598  attgatgatatggttgcttacgctctcaagagtgatggaggttatgtatgggcatgcaag 657

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||||||||| |||||
Sbjct: 658  aactacgatggagatgttcagag 680



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                       
Query: 747 tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
           ||||| |||||||| |||| ||  |||||| |||| |  ||||| ||||||||||| || 
Sbjct: 112 tttgccgaagcttcaatgaccacagcttacgagaaaaagtggcctctttatcttagcacc 171

                                             
Query: 807 aagaacacaatcctgaaaaaatatgacggaaggt 840
           || || || ||||| || |||||||| |||||||
Sbjct: 172 aaaaataccatccttaagaaatatgatggaaggt 205



to top

>gb|AC009513.2|F12P19 Sequence of BAC F12P19 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 81490

 Score = 83.8 bits (42), Expect = 2e-12
 Identities = 81/94 (86%)
 Strand = Plus / Plus

                                                                         
Query: 907   ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
             ||||||||||  | || |||||||||||||||||||| || || |||||||| || ||||
Sbjct: 46375 ggtatgaacaccgtctcattgatgatatggtggcctacgctcttaagagtgagggaggct 46434

                                               
Query: 967   atgtttgggcttgcaagaattatgatggagatgt 1000
             |||||||||| ||||| || |||||||| |||||
Sbjct: 46435 atgtttgggcatgcaaaaactatgatggtgatgt 46468



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                    
Query: 172   ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtga 226
             |||||||||| ||||||||| |||| || || ||||||||||||||||| |||||
Sbjct: 44447 ccatggcgtttgagaagatcaaggtggcaaatcccatcgtcgagatggatggtga 44501



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 549   tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccg 598
             |||||||| ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 45602 tggacaaagcccatctgcattggaaggcatgcttttggtgatcagtaccg 45651



 Score = 42.1 bits (21), Expect = 8.2
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                         
Query: 1212  gatgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtggggaca 1271
             |||||||||  || ||| |||||||||||  | || || ||||| |||||||| ||||||
Sbjct: 46953 gatgacaacgcaaaactcttggatttcactgagaagctggaagccgcttgtgttgggaca 47012

                  
Query: 1272  gtgga 1276
             |||||
Sbjct: 47013 gtgga 47017



to top

>dbj|AK227755.1| Arabidopsis thaliana mRNA for NADP specific isocitrate
           dehydrogenase, complete cds, clone: RAFL14-33-D23
          Length = 1764

 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 116/141 (82%)
 Strand = Plus / Plus

                                                                       
Query: 717 atgtataacactgatgagtctattcgagcatttgctgaagcttcgatgaacatggcttac 776
           |||||||||||||||||||||||||| |||||||||||  | |||||| |||  ||||||
Sbjct: 587 atgtataacactgatgagtctattcgtgcatttgctgagtcctcgatgtacacagcttac 646

                                                                       
Query: 777 cagaagagatggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacgga 836
           ||||| |  ||||||||||| ||    || || ||||| ||||| |||| |||||| |||
Sbjct: 647 cagaaaaagtggccactttacctctccacaaaaaacaccatcctcaaaatatatgatgga 706

                                
Query: 837 aggtttaaagacatattccaa 857
           || || || || |||||||||
Sbjct: 707 agattcaaggatatattccaa 727



 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 117/143 (81%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           |||||||||||||| ||||| || ||||||||||| ||||| || || |||||| | |||
Sbjct: 317 atgtggaggagtcctaatggaactataaggaacattttaaacggcacagttttcagggaa 376

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || ||||| ||||  ||  | ||||| ||||| || |||||||| || || || || |||
Sbjct: 377 cctatcatttgcagaaacatccctcgtcttgttccaggatggacgaagccaatctgtatt 436

                                  
Query: 570 ggcagacatgcttttggtgatca 592
           || || |||||||||||||||||
Sbjct: 437 ggaaggcatgcttttggtgatca 459



 Score = 73.8 bits (37), Expect = 2e-09
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 922  tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
            |||| ||||||||||| || |||||| | || |||||||| || || || ||||| ||||
Sbjct: 869  tgatagatgatatggttgcatatgccatgaaaagtgaagggggttacgtctgggcatgca 928

                                         
Query: 982  agaattatgatggagatgtgcagagcgat 1010
            ||||||| ||||||||||| |||||||||
Sbjct: 929  agaattacgatggagatgtacagagcgat 957



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                       
Query: 231 atgacacgaattatatggaaatggatcaaagataagcttatatttcctttcctggacctg 290
           ||||| ||| |||| |||||||  |||||||| |||||||| || ||||||||||| |||
Sbjct: 98  atgactcgagttatctggaaattcatcaaagacaagcttattttccctttcctggagctg 157

                            
Query: 291 gacataaaatactttga 307
           || || |||||||||||
Sbjct: 158 gatatcaaatactttga 174



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1245 aaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagct 1304
            ||||| ||||| |||||  ||||||| ||||| ||||| || ||||| ||||| ||||||
Sbjct: 1297 aaactagaagcagcttgcatggggacggtggagtctggcaaaatgaccaaggatctagct 1356

                       
Query: 1305 cttctcatcca 1315
            ||||| |||||
Sbjct: 1357 cttctgatcca 1367



to top

>dbj|D21069.1|RICAK88B Oryza sativa mRNA for isocitrate dehydrogenase, partial cds
          Length = 187

 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 53/56 (94%), Gaps = 1/56 (1%)
 Strand = Plus / Plus

                                                                   
Query: 180 ttcgagaagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgac 235
           |||||||||||| |||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 67  ttcgagaagatcaaggtcgccaaccccatcgtcgagat-gacggtgatgagatgac 121



to top

>ref|XM_640192.1| Dictyostelium discoideum AX4 isocitrate dehydrogenase (NADP+) (idhM)
            mRNA, complete cds
          Length = 1287

 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                        
Query: 906  tggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggc 965
            ||||||||||||||||| |||||||||||||| || | ||| || |||||||| ||||| 
Sbjct: 796  tggtatgaacatagactcattgatgatatggttgcttttgcactcaagagtgagggtggt 855

                                               
Query: 966  tatgtttgggcttgcaagaattatgatggagatgt 1000
            |  ||||||||||| || || |||||||| |||||
Sbjct: 856  ttcgtttgggcttgtaaaaactatgatggtgatgt 890



 Score = 42.1 bits (21), Expect = 8.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                        
Query: 393 aaatgtgcaactgtcaccccagatgaaggacgcgtaaaagagttt 437
           |||||||||||  |||| || ||||||| ||| ||||||||||||
Sbjct: 283 aaatgtgcaaccatcacaccggatgaagcacgtgtaaaagagttt 327



to top

>gb|AC116963.2| Dictyostelium discoideum chromosome 2 map 4657875-4914984 strain AX4,
              complete sequence
          Length = 257109

 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 81/95 (85%)
 Strand = Plus / Plus

                                                                          
Query: 906    tggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggc 965
              ||||||||||||||||| |||||||||||||| || | ||| || |||||||| ||||| 
Sbjct: 168015 tggtatgaacatagactcattgatgatatggttgcttttgcactcaagagtgagggtggt 168074

                                                 
Query: 966    tatgtttgggcttgcaagaattatgatggagatgt 1000
              |  ||||||||||| || || |||||||| |||||
Sbjct: 168075 ttcgtttgggcttgtaaaaactatgatggtgatgt 168109



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                          
Query: 906    tggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggc 965
              |||||||| |||||||| || || || ||||| ||||||||  | |||||||| ||||||
Sbjct: 165735 tggtatgagcatagactcatcgacgacatggtcgcctatgctatgaagagtgagggtggc 165794

                                                 
Query: 966    tatgtttgggcttgcaagaattatgatggagatgt 1000
              |  ||||||||||| || || ||||| || |||||
Sbjct: 165795 ttcgtttgggcttgtaaaaactatgacggtgatgt 165829



 Score = 42.1 bits (21), Expect = 8.2
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                           
Query: 393    aaatgtgcaactgtcaccccagatgaaggacgcgtaaaagagttt 437
              |||||||||||  |||| || ||||||| ||| ||||||||||||
Sbjct: 167502 aaatgtgcaaccatcacaccggatgaagcacgtgtaaaagagttt 167546



to top

>gb|AY997853.1| Collomia tracyi voucher Johnson 94-075 BRY isocitrate dehydrogenase
            gene, exons K-M and partial cds
          Length = 667

 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| || | ||| || ||||||||||| |
Sbjct: 410  ttgaagctgaagcagctcatggcacagttacacgccacttcagggttcaccaaaaaggtg 469

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 470  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 512



to top

>gb|AY997851.1| Collomia diversifolia voucher Johnson 96-013 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 713

 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||| ||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 399  ttgaagcggaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 458

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 459  gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 501



to top

>gb|AY997848.1| Allophyllum glutinosum voucher Johnson 93-032 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 684

 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || ||||||||||| |
Sbjct: 379  ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcaccaaaaaggtg 438

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||| ||||| || ||||||||||| |||||
Sbjct: 439  gtgaaacgagcacaaatagcatagcttcaatctttgcctggtc 481



to top

>gb|AY997881.1| Collomia tracyi voucher Johnson 94-075 BRY isocitrate dehydrogenase
            gene, exons H-M and partial cds
          Length = 1266

 Score = 77.8 bits (39), Expect = 1e-10
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| || | ||| || ||||||||||| |
Sbjct: 1041 ttgaagctgaagcagctcatggcacagttacacgccacttcagggttcaccaaaaaggtg 1100

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1101 gtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1143



 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 68/80 (85%)
 Strand = Plus / Plus

                                                                        
Query: 927  gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
            ||||||||||| ||||| || || |||||||| || || ||||| ||||| |||||||| 
Sbjct: 569  gatgatatggttgcctacgctcttaagagtgatggaggttatgtgtgggcatgcaagaac 628

                                
Query: 987  tatgatggagatgtgcagag 1006
            || ||||||||||| |||||
Sbjct: 629  tacgatggagatgttcagag 648



to top

>gb|AY111294.1| Zea mays CL31612_1 mRNA sequence
          Length = 589

 Score = 75.8 bits (38), Expect = 6e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                              
Query: 1914 gcgaggaagttgccgcgctcgtagaagtactatgccttctccaccttcat 1963
            ||||||||||||||||||||||||||||||| || ||| |||||||||||
Sbjct: 237  gcgaggaagttgccgcgctcgtagaagtactctgacttgtccaccttcat 286



to top

>gb|AY111226.1| Zea mays CL7227_-2 mRNA sequence
          Length = 536

 Score = 75.8 bits (38), Expect = 6e-10
 Identities = 104/126 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1056 ttggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacga 1115
            ||||||||||||||||| | |||  ||||||||||||| || || || || || || || 
Sbjct: 13   ttggtgtgccctgatgggaaaaccattgaagctgaagcagcccatggcacggttacccgc 72

                                                                        
Query: 1116 cattacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatcttt 1175
            |||| | | || ||||| |||||||| ||||| || || ||||||||||| |||||||||
Sbjct: 73   catttccgtgttcaccagaaaggaggtgaaaccagtacgaacagcattgcttcaatcttt 132

                  
Query: 1176 gcatgg 1181
            ||||||
Sbjct: 133  gcatgg 138



to top

>gb|DQ448875.1| Theobroma cacao isocitrate dehydrogenase mRNA, partial cds
          Length = 301

 Score = 73.8 bits (37), Expect = 2e-09
 Identities = 166/209 (79%)
 Strand = Plus / Plus

                                                                        
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggc 1142
            ||||| || ||||| || ||||| || || |||||||||||||| |||||||| || || 
Sbjct: 78   gaagcagaggctgctcatggtacggttacgcgacattacagagttcaccaaaagggtggt 137

                                                                        
Query: 1143 gaaactagcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagg 1202
            ||||| |||||||||||||| || || |||||||| ||| |   |||  | ||||| |||
Sbjct: 138  gaaaccagcacaaacagcatagcatccatctttgcttggacacgtgggcttgcacacagg 197

                                                                        
Query: 1203 gcaaagctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgt 1262
            |||||  |||||||||| |  ||||| ||||| |||||  | |||||||| ||  |||||
Sbjct: 198  gcaaaattggatgacaatatcagactcttggagttcactgagaaacttgaggcgtcttgt 257

                                         
Query: 1263 gtggggacagtggaatctggaaagatgac 1291
             | ||  | ||||||||||| ||||||||
Sbjct: 258  attggagctgtggaatctgggaagatgac 286



to top

>gb|AC005287.4| Arabidopsis thaliana chromosome I BAC F20D21 genomic sequence, complete
             sequence
          Length = 143186

 Score = 73.8 bits (37), Expect = 2e-09
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                         
Query: 922   tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
             |||| ||||||||||| || |||||| | || |||||||| || || || ||||| ||||
Sbjct: 56885 tgatagatgatatggttgcatatgccatgaaaagtgaagggggttacgtctgggcatgca 56944

                                          
Query: 982   agaattatgatggagatgtgcagagcgat 1010
             ||||||| ||||||||||| |||||||||
Sbjct: 56945 agaattacgatggagatgtacagagcgat 56973



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                         
Query: 1245  aaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagct 1304
             ||||| ||||| |||||  ||||||| ||||| ||||| || ||||| ||||| ||||||
Sbjct: 57739 aaactagaagcagcttgcatggggacggtggagtctggcaaaatgaccaaggatctagct 57798

                        
Query: 1305  cttctcatcca 1315
             ||||| |||||
Sbjct: 57799 cttctgatcca 57809



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 450   atgtggaggagtccaaatgggacaataaggaacatcttaaa 490
             |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 55812 atgtggaggagtcctaatggaactataaggaacattttaaa 55852



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 54/64 (84%)
 Strand = Plus / Plus

                                                                         
Query: 733   agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
             |||||||||| |||||||||||  | |||||| |||  ||||||||||| |  |||||||
Sbjct: 56516 agtctattcgtgcatttgctgagtcctcgatgtacacagcttaccagaaaaagtggccac 56575

                 
Query: 793   ttta 796
             ||||
Sbjct: 56576 ttta 56579



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 265   agcttatatttcctttcctggacctggacataaaatactttga 307
             ||||||| || ||||||||||| ||||| || |||||||||||
Sbjct: 55385 agcttattttccctttcctggagctggatatcaaatactttga 55427



to top

>dbj|AP004491.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT17G08, TM0023,
             complete sequence
          Length = 91039

 Score = 73.8 bits (37), Expect = 2e-09
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                         
Query: 927   gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
             |||||||||||||| ||||| || ||||||||||| || ||||| ||||| ||||| || 
Sbjct: 15619 gatgatatggtggcatatgcacttaagagtgaaggaggttatgtatgggcatgcaaaaac 15560

                                                      
Query: 987   tatgatggagatgtgcagagcgatctaattgctcaaggttt 1027
             || ||||||||||| ||||| ||| |  | |||||||||||
Sbjct: 15559 tacgatggagatgtccagagtgatttcttagctcaaggttt 15519



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 172   ccatggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggt 224
             ||||||| ||||| |||||| |||| |||||||||||||| ||||||||||||
Sbjct: 18166 ccatggctttcgacaagatcaaggtcgccaaccccatcgttgagatggacggt 18114



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                             
Query: 450   atgtggaggagtccaaatgggacaataaggaa 481
             |||||||||||||||||||||||||| |||||
Sbjct: 16747 atgtggaggagtccaaatgggacaattaggaa 16716



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                     
Query: 785   atggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
             |||||||||||||||||| || || || ||||| || || |||||||| |||||||
Sbjct: 15934 atggccactttatcttagcaccaaaaatacaattcttaagaaatatgatggaaggt 15879



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 561   atatgcattggcagacatgcttttggtgatcaata 595
             ||||| ||||| ||||||||||||||||| |||||
Sbjct: 16414 atatgtattggaagacatgcttttggtgaccaata 16380



to top

>gb|DQ196974.1| Collomia cavanillesii clone 1327c NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1238

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 598 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 645



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 983  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1042

                                      
Query: 807  aagaacacaatcctgaaaaaatatga 832
            |||||||| || || |||| ||||||
Sbjct: 1043 aagaacactattcttaaaagatatga 1068



to top

>gb|DQ196973.1| Collomia grandiflora clone 14.1 NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1237

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 598 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 645



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 983  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1042

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1043 aagaacactattcttaaaagatatgatggaaggt 1076



to top

>gb|DQ196972.1| Collomia grandiflora NADP-dependent isocitrate dehydrogenase 1
           (idhA) gene, exons C-I and partial cds
          Length = 1236

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 598 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 645



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 983  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1042

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1043 aagaacactattcttaaaagatatgatggaaggt 1076



to top

>gb|DQ196971.1| Collomia wilkenii clone 99 NADP-dependent isocitrate dehydrogenase
           1 (idhA) gene, exons C-I and partial cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 818 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 877

              
Query: 732 gag 734
           |||
Sbjct: 878 gag 880



to top

>gb|DQ196970.1| Collomia wilkenii clone 75 NADP-dependent isocitrate dehydrogenase
           1 (idhA) gene, exons C-I and partial cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



to top

>gb|DQ196969.1| Collomia wilkenii clone 1524C NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 818 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 877

              
Query: 732 gag 734
           |||
Sbjct: 878 gag 880



to top

>gb|DQ196968.1| Collomia wilkenii clone 1523B NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



to top

>gb|DQ196967.1| Collomia wilkenii clone 1501A NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 818 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 877

              
Query: 732 gag 734
           |||
Sbjct: 878 gag 880



to top

>gb|DQ196966.1| Collomia tenella clone 1521A NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 818 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 877

              
Query: 732 gag 734
           |||
Sbjct: 878 gag 880



to top

>gb|DQ196965.1| Collomia tenella NADP-dependent isocitrate dehydrogenase 1 (idhA)
           gene, exons C-I and partial cds
          Length = 1221

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 818 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 877

              
Query: 732 gag 734
           |||
Sbjct: 878 gag 880



to top

>gb|DQ196964.1| Collomia renacta clone 1520i NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1237

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 982  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1041

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| ||| || |||||||
Sbjct: 1042 aagaacactattcttaaaagatacgatggaaggt 1075



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 818 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 877

              
Query: 732 gag 734
           |||
Sbjct: 878 gag 880



to top

>gb|DQ196963.1| Collomia cavanillesii clone 1327A NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1236

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 597 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 644



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 982  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1041

                                      
Query: 807  aagaacacaatcctgaaaaaatatga 832
            |||||||| || || |||| ||||||
Sbjct: 1042 aagaacactattcttaaaagatatga 1067



to top

>gb|DQ196961.1| Collomia wilkenii clone 74 NADP-dependent isocitrate dehydrogenase
           1 (idhA) gene, exons C-I and partial cds
          Length = 1233

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 594 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 641



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 978  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1037

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1038 aagaacactattcttaaaagatatgatggaaggt 1071



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 815 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 874

              
Query: 732 gag 734
           |||
Sbjct: 875 gag 877



to top

>gb|DQ196960.1| Collomia wilkenii clone 1524B NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1234

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 594 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 641



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 979  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1038

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1039 aagaacactattcttaaaagatatgatggaaggt 1072



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 815 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 874

              
Query: 732 gag 734
           |||
Sbjct: 875 gag 877



to top

>gb|DQ196959.1| Collomia wilkenii clone 1523A NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1234

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 594 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 641



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 979  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1038

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1039 aagaacactattcttaaaagatatgatggaaggt 1072



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 815 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 874

              
Query: 732 gag 734
           |||
Sbjct: 875 gag 877



to top

>gb|DQ196958.1| Collomia wilkenii clone 1501B NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1234

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 594 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 641



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 979  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1038

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1039 aagaacactattcttaaaagatatgatggaaggt 1072



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 815 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 874

              
Query: 732 gag 734
           |||
Sbjct: 875 gag 877



to top

>gb|DQ196957.1| Collomia linearis clone 1500C NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1234

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 594 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 641



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 979  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1038

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1039 aagaacactattcttaaaagatatgatggaaggt 1072



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 815 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 874

              
Query: 732 gag 734
           |||
Sbjct: 875 gag 877



to top

>gb|DQ196956.1| Collomia linearis clone 1526K NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1234

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 594 tggaccaaaccaatatgcattggccgacatgcttttggtgatcaatac 641



 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 71/85 (83%)
 Strand = Plus / Plus

                                                                        
Query: 756  gcttcgatgaacatggcttaccagaagagatggccactttatcttagtacgaagaacaca 815
            ||||| |||||||  ||||| |||||||  ||||| |||||||| || ||||||||||| 
Sbjct: 988  gcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacgaagaacact 1047

                                     
Query: 816  atcctgaaaaaatatgacggaaggt 840
            || || |||| |||||| |||||||
Sbjct: 1048 attcttaaaagatatgatggaaggt 1072



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 815 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 874

              
Query: 732 gag 734
           |||
Sbjct: 875 gag 877



to top

>emb|AJ973130.1| Andrographis paniculata partial idh gene for putative isocitrate
            dehydrogenase, exons 1-5, locus 1
          Length = 1264

 Score = 71.9 bits (36), Expect = 9e-09
 Identities = 99/120 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1058 ggtgtgccctgatggtagaacagttgaagctgaagctgcacacggtacagtcacacgaca 1117
            |||||||||||||||||  ||| | ||||| ||||| || || || || || || || ||
Sbjct: 336  ggtgtgccctgatggtaagacaatcgaagccgaagcagcccatggaactgttacccgtca 395

                                                                        
Query: 1118 ttacagagtccaccaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgc 1177
             ||||| || || ||||||||||| ||||| ||||||||||||||||| ||||| |||||
Sbjct: 396  ctacagggttcatcaaaaaggaggagaaaccagcacaaacagcattgcctcaatatttgc 455



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                
Query: 975  gcttgcaagaattatgatggagatgtgcagagcgat 1010
            ||||||||||| |||||||||||||| |||||||||
Sbjct: 1    gcttgcaagaactatgatggagatgtacagagcgat 36



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 1275 gaatctggaaagatgacaaaggacctagctcttctcatccatgg 1318
            ||||||||||||||||||||||| || || ||  ||||||||||
Sbjct: 1099 gaatctggaaagatgacaaaggatcttgcactcatcatccatgg 1142



to top

>gb|AC189484.1| Brassica rapa subsp. pekinensis clone KBrB083K19, complete sequence
          Length = 112573

 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                         
Query: 924   attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
             ||||||||||||||||| || || || ||||| || || |||||||| ||||||||||| 
Sbjct: 93767 attgatgatatggtggcttacgctctcaagagcgagggaggctatgtgtgggcttgcaaa 93826

                                        
Query: 984   aattatgatggagatgtgcagagcgat 1010
             || |||||||| ||||| || ||||||
Sbjct: 93827 aactatgatggtgatgtccaaagcgat 93853



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                  
Query: 174   atggcgttcgagaagatccaggttgccaaccccatcgtcgagatggacggtga 226
             |||||||||||||||||| ||||||| || |||||||| |||||||| |||||
Sbjct: 91705 atggcgttcgagaagatcaaggttgcaaatcccatcgtggagatggatggtga 91757



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 549   tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccg 598
             |||||||| ||||| |||||||| || ||||||||||||||||| |||||
Sbjct: 93006 tggacaaagcccatctgcattggaaggcatgcttttggtgatcagtaccg 93055



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                         
Query: 747   tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
             |||||||| || ||||||||||  |||||  ||||||  ||||||||||||||||| || 
Sbjct: 93416 tttgctgaggcatcgatgaacactgcttatgagaagaagtggccactttatcttagcaca 93475

                     
Query: 807   aagaacac 814
             ||||||||
Sbjct: 93476 aagaacac 93483



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 79/97 (81%)
 Strand = Plus / Plus

                                                                         
Query: 1081  ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
             ||||||||||||| ||||| || || || || || || ||||| || ||||| ||||| |
Sbjct: 94110 ttgaagctgaagcagcacatggaacggttacccgtcactacagggttcaccagaaaggtg 94169

                                                  
Query: 1141  gcgaaactagcacaaacagcattgcgtcaatctttgc 1177
             | || || |||||||||||||| || || ||||||||
Sbjct: 94170 gggagaccagcacaaacagcatagcctccatctttgc 94206



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 1248  cttgaagctgcttgtgtggggacagtggaatctggaaagatgac 1291
             ||||||||||||||||| || || ||||| |||||||| |||||
Sbjct: 94354 cttgaagctgcttgtgtcggtacggtggagtctggaaaaatgac 94397



to top

>gb|AY997868.1| Navarretia leptalea voucher Johnson 93-131 BRY isocitrate
            dehydrogenase gene, exons K-N and partial cds
          Length = 730

 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || || || ||||| |
Sbjct: 402  ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcatcagaaaggtg 461

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 462  gtgaaaccagcacaaacagcatagcttcaatctttgcctggtc 504



to top

>gb|AY997904.1| Saltugilia latimeri voucher Grant 8840 RSA isocitrate dehydrogenase
            gene, exons H-M and partial cds
          Length = 1934

 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 68/79 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1105 cagtcacacgacattacagagtccaccaaaaaggaggcgaaactagcacaaacagcattg 1164
            ||||||| || |||||||| || ||||||||||| || ||| | |||||||||||||| |
Sbjct: 1546 cagtcacgcgccattacagggttcaccaaaaaggtggtgaagccagcacaaacagcatag 1605

                               
Query: 1165 cgtcaatctttgcatggtc 1183
            | ||||||||||| |||||
Sbjct: 1606 cctcaatctttgcttggtc 1624



to top

>gb|AY997889.1| Navarretia leptalea voucher Johnson 93-131 BRY isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1262

 Score = 69.9 bits (35), Expect = 4e-08
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1081 ttgaagctgaagctgcacacggtacagtcacacgacattacagagtccaccaaaaaggag 1140
            ||||||||||||| || || || ||||| ||||| |||| ||| || || || ||||| |
Sbjct: 1035 ttgaagctgaagcagctcatggcacagttacacgccatttcagggttcatcagaaaggtg 1094

                                                       
Query: 1141 gcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            | ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1095 gtgaaaccagcacaaacagcatagcttcaatctttgcctggtc 1137



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 66/77 (85%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| ||||| || || |||||||| || || ||||| ||||| ||||||
Sbjct: 568  attgatgatatggttgcctacgctcttaagagtgatggaggttatgtatgggcatgcaag 627

                             
Query: 984  aattatgatggagatgt 1000
            || || |||||||||||
Sbjct: 628  aactacgatggagatgt 644



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 747 tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
           ||||| |||||||| |||| ||  |||||| |||| |  ||||| ||||||||||| || 
Sbjct: 113 tttgcagaagcttcaatgaccacagcttacgagaaaaagtggcctctttatcttagcacc 172

                                             
Query: 807 aagaacacaatcctgaaaaaatatgacggaaggt 840
           ||||| || ||||| || |||||||| |||||||
Sbjct: 173 aagaatactatccttaagaaatatgatggaaggt 206



to top

>gb|BC046379.1| Xenopus laevis, clone IMAGE:5542876, mRNA
          Length = 1808

 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 129/161 (80%)
 Strand = Plus / Plus

                                                                        
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaa 1022
            |||| |||||||||||||||||| |||||||||||||| |||   ||| |  ||||||||
Sbjct: 1077 ggctttgtttgggcttgcaagaactatgatggagatgttcagtcagatattcttgctcaa 1136

                                                                        
Query: 1023 ggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagtt 1082
            || ||||| ||  | ||| | ||||| || ||  |||| ||||| ||||| |  ||| ||
Sbjct: 1137 ggctttggttcccttggtttaatgacctcagtcctggtttgcccagatggaaagacaatt 1196

                                                     
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacag 1123
            ||||||||||| || || || |||||||| || ||||||||
Sbjct: 1197 gaagctgaagccgctcatggaacagtcactcgccattacag 1237



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 106/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| |||||| ||||| ||| | |||||||||||    ||||| || ||||| || 
Sbjct: 561 atgtggaagagtcccaatggtacagtcaggaacatcttgggcggaacagtattccgtgag 620

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| || ||||||||| ||||||| || || ||||| |||||| || ||||   ||||
Sbjct: 621 ccaattatttgcaagaatattcctcgtctagtacctggttggacacaagccattaccatt 680

                      
Query: 570 ggcagacatgc 580
           |||||||||||
Sbjct: 681 ggcagacatgc 691



to top

>gb|AY068151.1| Schmidtea mediterranea clone H.79.5h(T3) unknown mRNA sequence
          Length = 851

 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 141/177 (79%)
 Strand = Plus / Minus

                                                                        
Query: 972  tgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttttgga 1031
            ||||||||||||||||||||||| || || ||||| |||   ||||| ||||| || |||
Sbjct: 480  tgggcttgcaagaattatgatggcgacgtccagagtgattctattgcacaaggattcgga 421

                                                                        
Query: 1032 tcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagctgaa 1091
            || |||||  | ||||| || ||| || | || ||||| |||| ||| || ||||| |||
Sbjct: 420  tcattaggaatgatgacctcagttctgatttgtcctgacggtaaaacggtagaagccgaa 361

                                                                     
Query: 1092 gctgcacacggtacagtcacacgacattacagagtccaccaaaaaggaggcgaaact 1148
            || || || || ||||| ||| | ||||||||| | ||||||||||| || ||||||
Sbjct: 360  gcagctcatggaacagtaacaaggcattacagaattcaccaaaaaggcggtgaaact 304



to top

>gb|DQ196975.1| Collomia tinctoria clone 2 NADP-dependent isocitrate dehydrogenase
           1 (idhA) gene, exons C-I and partial cds
          Length = 1236

 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| |||||||||||| |||||||||| ||||||||||||
Sbjct: 596 tggaccaaaccaatatgcattggccgacatgctttcggtgatcaatac 643



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 981  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1040

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1041 aagaacactattcttaaaagatatgatggaaggt 1074



to top

>gb|DQ196962.1| Collomia wilkenii clone 11.4 NADP-dependent isocitrate
           dehydrogenase 1 (idhA) gene, exons C-I and partial cds
          Length = 1234

 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 44/48 (91%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| ||| |||||||| |||||||||||||||||||||||
Sbjct: 594 tggaccaaaccaatacgcattggccgacatgcttttggtgatcaatac 641



 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 979  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1038

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1039 aagaacactattcttaaaagatatgatggaaggt 1072



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 672 ttggatgtgttcaactttagtggtgctggtggagtagcattatctatgtataacactgat 731
           |||||||| || || |||| |||||| || |||||||| || || ||||| |||||||||
Sbjct: 815 ttggatgtctttaagtttactggtgcgggaggagtagctttgtccatgtacaacactgat 874

              
Query: 732 gag 734
           |||
Sbjct: 875 gag 877



to top

>ref|NM_001046669.1| Bombyx mori isocitrate dehydrogenase (LOC692823), mRNA
 gb|DQ311191.1| Bombyx mori isocitrate dehydrogenase mRNA, complete cds
          Length = 1593

 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 53/60 (88%)
 Strand = Plus / Plus

                                                                       
Query: 887 gtttgaggatgcaggaatatggtatgaacatagactgattgatgatatggtggcctatgc 946
           |||||||||||| || || ||||||||||| || || ||||||||||||||||| |||||
Sbjct: 892 gtttgaggatgctggtatctggtatgaacacaggctaattgatgatatggtggcttatgc 951



to top

>emb|AL163792.1|ATT15N1 Arabidopsis thaliana DNA chromosome 5, BAC clone T15N1 (ESSA project)
          Length = 86574

 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                         
Query: 922   tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
             |||||||||| |||||||| || ||  | || ||||||||||||||||| ||||||||||
Sbjct: 41558 tgattgatgacatggtggcttacgcagtcaaaagtgaaggtggctatgtctgggcttgca 41499

                                                         
Query: 982   agaattatgatggagatgtgcagagcgatctaattgctcaaggt 1025
             | || || || || ||||| || ||||||||  |||| ||||||
Sbjct: 41498 aaaactacgacggtgatgttcaaagcgatcttcttgcccaaggt 41455



 Score = 42.1 bits (21), Expect = 8.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 561   atatgcattggcagacatgcttttggtga 589
             ||||||||||| |||||||| ||||||||
Sbjct: 42266 atatgcattggtagacatgcctttggtga 42238



to top

>ref|XM_421965.2| PREDICTED: Gallus gallus similar to cytosolic NADP-dependent
            isocitrate dehydrogenase (LOC424112), mRNA
          Length = 2062

 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                        
Query: 906  tggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggc 965
            |||||||||||||| || |||||||| ||||| ||  | ||||| ||   |||||| |||
Sbjct: 753  tggtatgaacataggctcattgatgacatggttgctcaggccctgaaatctgaaggaggc 812

                                                   
Query: 966  tatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            | ||| ||||| |||||||| |||||||| |||||||||
Sbjct: 813  tttgtctgggcctgcaagaactatgatggggatgtgcag 851



to top

>ref|NM_001004799.1| Xenopus tropicalis MGC69505 protein (MGC69505), mRNA
 gb|BC074545.1| Xenopus tropicalis MGC69505 protein, mRNA (cDNA clone MGC:69505
            IMAGE:5336402), complete cds
          Length = 1801

 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 124/155 (80%)
 Strand = Plus / Plus

                                                                        
Query: 969  gtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggtttt 1028
            ||||||||||||||||| |||||||||||||| |||   ||| |  |||||||||| |||
Sbjct: 1057 gtttgggcttgcaagaactatgatggagatgttcagtcagatattcttgctcaaggcttt 1116

                                                                        
Query: 1029 ggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagct 1088
            || ||  | ||| | ||||| |||||  |||| ||||| ||||| |  ||  ||||||||
Sbjct: 1117 ggttcacttggtttaatgacctcggtcctggtttgcccagatggaaagactattgaagct 1176

                                               
Query: 1089 gaagctgcacacggtacagtcacacgacattacag 1123
            ||||| || || || |||||||| || ||||||||
Sbjct: 1177 gaagcagctcatggaacagtcactcgccattacag 1211



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| |||||| ||||| || || |||||||| ||   |||||| || ||||| || 
Sbjct: 535 atgtggaagagtcccaatggaacgatcaggaacattttgggtggaacagtgttccgtgat 594

                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggac 553
           ||||| || ||||||||| |||||||  | || |||||||||||
Sbjct: 595 ccaattatttgcaagaatattcctcgtttggtacctggatggac 638



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 213 gagatggacggtgatgagatgac 235
           |||||||||||||||||||||||
Sbjct: 298 gagatggacggtgatgagatgac 320



to top

>gb|AC132565.28| Medicago truncatula clone mth2-4a8, complete sequence
          Length = 134155

 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 82/99 (82%)
 Strand = Plus / Plus

                                                                         
Query: 927   gatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaagaat 986
             ||||| ||||| || ||||| || || ||||| || || ||||| ||||| ||||| |||
Sbjct: 29899 gatgacatggttgcgtatgctcttaaaagtgatgggggttatgtatgggcctgcaaaaat 29958

                                                    
Query: 987   tatgatggagatgtgcagagcgatctaattgctcaaggt 1025
             |||||||| ||||||||||| ||| | || |||||||||
Sbjct: 29959 tatgatggggatgtgcagagtgatttcatagctcaaggt 29997



 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                         
Query: 413   agatgaaggacgcgtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggac 472
             ||||||||| || || || ||||||||  |||||   ||||||| ||| |||||||||||
Sbjct: 28706 agatgaaggccgtgtcaaggagtttaacctaaaacaaatgtggaagagcccaaatgggac 28765

                                  
Query: 473   aataaggaacatcttaaatgg 493
             |||  ||||||||||||||||
Sbjct: 28766 aatccggaacatcttaaatgg 28786



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 88/108 (81%)
 Strand = Plus / Plus

                                                                         
Query: 733   agtctattcgagcatttgctgaagcttcgatgaacatggcttaccagaagagatggccac 792
             ||||||||||||| ||||| || ||||| |||||||| |||  | |||| | |||||| |
Sbjct: 29503 agtctattcgagcgtttgccgaggcttcaatgaacattgctctcgagaaaaaatggcctc 29562

                                                             
Query: 793   tttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
             | |||||||| || || ||||| || || || |||||||| |||||||
Sbjct: 29563 tctatcttagcactaaaaacaccattctaaagaaatatgatggaaggt 29610



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 561   atatgcattggcagacatgcttttggtgatcaataccgagcaac 604
             ||||||||||| |||||||||||||| || ||||| || |||||
Sbjct: 29057 atatgcattggaagacatgcttttggagaccaatatcgggcaac 29100



 Score = 42.1 bits (21), Expect = 8.2
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                      
Query: 1356  gagttcattgatgcggttgctgaggagttgaggacaagatt 1396
             |||||||||||||| || || |||||| |||| ||||||||
Sbjct: 32130 gagttcattgatgccgtagccgaggagctgagaacaagatt 32170



to top

>emb|CT025337.2| Xenopus tropicalis finished cDNA, clone TNeu118i04
          Length = 1685

 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 124/155 (80%)
 Strand = Plus / Plus

                                                                        
Query: 969  gtttgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggtttt 1028
            ||||||||||||||||| |||||||||||||| |||   ||| |  |||||||||| |||
Sbjct: 947  gtttgggcttgcaagaactatgatggagatgttcagtcagatattcttgctcaaggcttt 1006

                                                                        
Query: 1029 ggatcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagct 1088
            || ||  | ||| | ||||| |||||  |||| ||||| ||||| |  ||  ||||||||
Sbjct: 1007 ggttcacttggtttaatgacctcggtcctggtttgcccagatggaaagactattgaagct 1066

                                               
Query: 1089 gaagctgcacacggtacagtcacacgacattacag 1123
            ||||| || || || |||||||| || ||||||||
Sbjct: 1067 gaagcagctcatggaacagtcactcgccattacag 1101



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| |||||| ||||| || || |||||||| ||   |||||| || ||||| || 
Sbjct: 425 atgtggaagagtcccaatggaacgatcaggaacattttgggtggaacagtgttccgtgat 484

                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggac 553
           ||||| || ||||||||| |||||||  | || |||||||||||
Sbjct: 485 ccaattatttgcaagaatattcctcgtttggtacctggatggac 528



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 213 gagatggacggtgatgagatgac 235
           |||||||||||||||||||||||
Sbjct: 188 gagatggacggtgatgagatgac 210



to top

>gb|AY997883.1| Gilia cana voucher Johnson 93-016 WS isocitrate dehydrogenase gene,
            exons H-M and partial cds
          Length = 2001

 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 924  attgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgcaag 983
            |||||||||||||| || || || || |||||||| || || ||||| ||||| ||||||
Sbjct: 988  attgatgatatggttgcttacgctcttaagagtgatggaggttatgtatgggcatgcaag 1047

                                   
Query: 984  aattatgatggagatgtgcagag 1006
            || || ||||||||||| |||||
Sbjct: 1048 aactacgatggagatgttcagag 1070



 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 49/55 (89%)
 Strand = Plus / Plus

                                                                   
Query: 1129 accaaaaaggaggcgaaactagcacaaacagcattgcgtcaatctttgcatggtc 1183
            |||||||||| || ||||| |||||||||||||| || ||||||||||| |||||
Sbjct: 1405 accaaaaaggtggtgaaaccagcacaaacagcatagcctcaatctttgcctggtc 1459



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 77/94 (81%)
 Strand = Plus / Plus

                                                                       
Query: 747 tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
           |||||||| ||||| |||| ||  |||||| |||| |  ||||| ||||||||||| |||
Sbjct: 113 tttgctgaggcttcaatgaccacagcttacgagaaaaagtggcctctttatcttagcacg 172

                                             
Query: 807 aagaacacaatcctgaaaaaatatgacggaaggt 840
           || || || ||||| || |||||||| |||||||
Sbjct: 173 aaaaatactatcctcaagaaatatgatggaaggt 206



to top

>gb|AF457967.1| Zea mays clone bms1.pk0003.f5, mRNA sequence
          Length = 482

 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 34/35 (97%)
 Strand = Plus / Plus

                                              
Query: 201 aaccccatcgtcgagatggacggtgatgagatgac 235
           ||||||||||||||||||||||| |||||||||||
Sbjct: 4   aaccccatcgtcgagatggacggggatgagatgac 38



 Score = 48.1 bits (24), Expect = 0.13
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 448 ctatgtggaggagtccaaatgggacaataagg 479
           |||||||| ||||||||||||| |||||||||
Sbjct: 251 ctatgtggcggagtccaaatggcacaataagg 282



to top

>dbj|AK112679.1| Ciona intestinalis cDNA, clone:cieg029b05, full insert sequence
          Length = 1498

 Score = 61.9 bits (31), Expect = 9e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                        
Query: 922  tgattgatgatatggtggcctatgccctaaagagtgaaggtggctatgtttgggcttgca 981
            ||||||||||||||||||| |||||| | |||   || || || |  |||||||| ||||
Sbjct: 758  tgattgatgatatggtggcatatgccatgaagtccgagggagggttcgtttgggcgtgca 817

                               
Query: 982  agaattatgatggagatgt 1000
            |||||||||||||||||||
Sbjct: 818  agaattatgatggagatgt 836



to top

>gb|DQ196986.1| Collomia cavanillesii clone 1344J putative cytosolic NADP isocitrate
            dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1341

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| |||||||| |||| || ||| ||| |||| |  ||||| ||||||||||| || 
Sbjct: 1044 tttgcggaagcttcaatgaccacggcctacgagaaaaagtggcctctttatcttagcaca 1103

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| || ||||| ||||||||||| |||||||
Sbjct: 1104 aagaatactatccttaaaaaatatgatggaaggt 1137



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 646 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 698



to top

>gb|DQ196985.1| Collomia grandiflora putative cytosolic NADP isocitrate dehydrogenase
            (idhB) gene, exons C-J and partial cds
          Length = 1338

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| |||||||| |||| || ||| ||| |||| |  ||||| ||||||||||| || 
Sbjct: 1041 tttgcggaagcttcaatgaccacggcctacgagaaaaagtggcctctttatcttagcaca 1100

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| || ||||| ||||||||||| |||||||
Sbjct: 1101 aagaatactatccttaaaaaatatgatggaaggt 1134



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 643 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 695



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 389 atgtggaggagtcctaatggaacaattaggaacat 423



to top

>gb|DQ196976.1| Collomia tinctoria clone 33 NADP-dependent isocitrate dehydrogenase 1
            (idhA) gene, exons C-I and partial cds
          Length = 1243

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| || ||||| |||||||  ||||| |||||||  ||||| |||||||| || |||
Sbjct: 988  tttgccgaggcttcaatgaacactgcttatcagaagaagtggccgctttatctcagcacg 1047

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            |||||||| || || |||| |||||| |||||||
Sbjct: 1048 aagaacactattcttaaaagatatgatggaaggt 1081



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaatac 596
           ||||| ||||| ||||| |||||  |||||||||||||||||||||||
Sbjct: 603 tggaccaaaccaatatgtattggtcgacatgcttttggtgatcaatac 650



to top

>gb|BC054241.1| Xenopus laevis hypothetical protein MGC64442, mRNA (cDNA clone
            MGC:64442 IMAGE:6880463), complete cds
          Length = 1808

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                  
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgt 1000
            |||| |||||||||||||||||| ||||||||||||||
Sbjct: 1057 ggctttgtttgggcttgcaagaactatgatggagatgt 1094



 Score = 54.0 bits (27), Expect = 0.002
 Identities = 105/131 (80%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| |||||| ||||| ||| | |||||||| ||    ||||| || ||||| || 
Sbjct: 541 atgtggaagagtcccaatggtacagtcaggaacatattgggcggaacagtattccgtgag 600

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           ||||| || ||||||||| ||||||| || || ||||| |||||| || ||||   ||||
Sbjct: 601 ccaattatttgcaagaatattcctcgtctggtacctggctggacacaagccattaccatt 660

                      
Query: 570 ggcagacatgc 580
           |||||||||||
Sbjct: 661 ggcagacatgc 671



to top

>emb|BX897700.1| Bartonella quintana str. Toulouse, complete genome
          Length = 1581384

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                        
Query: 1080   gttgaagctgaagctgcacacggtacagtcacacgacattac 1121
              |||||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 923230 gttgaagcagaagctgcacacggtacagtgacacgccattac 923271



to top

>gb|AY997886.1| Ipomopsis polycladon voucher Johnson 93-068 BRY isocitrate
            dehydrogenase gene, exons H-M and partial cds
          Length = 1083

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                        
Query: 907  ggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggct 966
            ||||||| ||| | || |||||||||||||| || ||||| || |||||||| || || |
Sbjct: 598  ggtatgagcatcgtctcattgatgatatggttgcttatgctcttaagagtgatggaggtt 657

                                              
Query: 967  atgtttgggcttgcaagaattatgatggagatgt 1000
            | || ||||| |||||||| |||||||| |||||
Sbjct: 658  acgtatgggcatgcaagaactatgatggggatgt 691



to top

>ref|XM_674495.1| Plasmodium berghei strain ANKA isocitrate dehydrogenase (NADP),
           mitochondrial precursor (PB000917.03.0) partial mRNA
          Length = 1407

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 426 gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaat 475
           ||||||||||||||||||||||  |||||||  ||||||||||| |||||
Sbjct: 337 gtaaaagagtttaatttaaaagaaatgtggaaaagtccaaatggtacaat 386



to top

>ref|XM_725295.1| Plasmodium yoelii yoelii str. 17XNL NADP-dependent isocitrate
           dehydrogenase (PY02505) partial mRNA
          Length = 1116

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 426 gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataaggaacatc 485
           |||||||| |||||||||||||  |||||||  ||||||||||| ||||| || || || 
Sbjct: 502 gtaaaagaatttaatttaaaagaaatgtggaaaagtccaaatggtacaattagaaatata 561

                         
Query: 486 ttaaatggaactgt 499
           ||| ||||||||||
Sbjct: 562 ttagatggaactgt 575



to top

>ref|XM_720412.1| Plasmodium yoelii yoelii str. 17XNL isocitrate dehydrogenase,
           NADP-dependent (PY00592) partial mRNA
          Length = 1410

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                       
Query: 426 gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaataaggaacatc 485
           |||||||| |||||||||||||  |||||||  ||||||||||| ||||| || || || 
Sbjct: 337 gtaaaagaatttaatttaaaagaaatgtggaaaagtccaaatggtacaattagaaatata 396

                         
Query: 486 ttaaatggaactgt 499
           ||| ||||||||||
Sbjct: 397 ttagatggaactgt 410



to top

>gb|DQ196987.1| Collomia tinctoria clone 7.2 putative cytosolic NADP isocitrate
           dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1349

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||||||||| ||||| ||| ||||
Sbjct: 650 tggacaaaacctatatgcattggaaggcatgcttttggagatcagtacagagc 702



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 392 atgtggaggagtcctaatggaacaattaggaacat 426



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 76/94 (80%)
 Strand = Plus / Plus

                                                                        
Query: 747  tttgctgaagcttcgatgaacatggcttaccagaagagatggccactttatcttagtacg 806
            ||||| |||||||| |||| ||  |||||| |||| |  ||||| ||||||||||| || 
Sbjct: 1050 tttgcggaagcttcaatgaccacagcttacgagaaaaagtggcctctttatcttagcacc 1109

                                              
Query: 807  aagaacacaatcctgaaaaaatatgacggaaggt 840
            || || || ||||| || |||||||| |||||||
Sbjct: 1110 aaaaataccatccttaagaaatatgatggaaggt 1143



to top

>gb|CP000394.1| Granulibacter bethesdensis CGDNIH1, complete genome
          Length = 2708355

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                            
Query: 966     tatgtttgggcttgcaagaattatgatggagatgtgcagagcgat 1010
               ||||| ||||| |||||||| |||||||||||||| |||||||||
Sbjct: 1518592 tatgtctgggcctgcaagaactatgatggagatgtacagagcgat 1518636



to top

>gb|CP000362.1| Roseobacter denitrificans OCh 114, complete genome
          Length = 4133097

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 41/45 (91%)
 Strand = Plus / Plus

                                                            
Query: 960     ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
               ||||| ||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 2574134 ggtggatatgtctgggcctgcaagaattatgatggcgatgtgcag 2574178



to top

>gb|AE013012.1| Thermoanaerobacter tengcongensis MB4, section 39 of 244 of the
            complete genome
          Length = 10432

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                     
Query: 216  atggacggtgatgagatgacacgaattatatggaaatggatcaaagataagcttata 272
            |||||||| ||||| |||||| ||||||||||||||| ||| ||||| | |||||||
Sbjct: 2051 atggacggagatgaaatgacaagaattatatggaaattgataaaagaaatgcttata 1995



to top

>ref|NM_077474.2| Caenorhabditis elegans C34F6.8 (C34F6.8) mRNA, complete cds
          Length = 1669

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 119/149 (79%)
 Strand = Plus / Plus

                                                                        
Query: 972  tgggcttgcaagaattatgatggagatgtgcagagcgatctaattgctcaaggttttgga 1031
            |||||||||||||| || || ||||||||||| || ||  |  |||||||||| |  |||
Sbjct: 1112 tgggcttgcaagaactacgacggagatgtgcaaagtgacattgttgctcaaggatacgga 1171

                                                                        
Query: 1032 tcgttaggtctcatgacatcggttttggtgtgccctgatggtagaacagttgaagctgaa 1091
            ||| | ||||||||| | || |||||| |||| || || || |  ||| ||||||| |||
Sbjct: 1172 tcgctcggtctcatgtcttcagttttgatgtgtcccgacggaaagacaattgaagcagaa 1231

                                         
Query: 1092 gctgcacacggtacagtcacacgacatta 1120
            ||||| || || |||||||| ||||||||
Sbjct: 1232 gctgcgcatggaacagtcactcgacatta 1260



to top

>gb|DQ086200.1| Ictalurus punctatus isocitrate dehydrogenase 2 mRNA, partial cds
          Length = 727

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                             
Query: 968  tgtttgggcttgcaagaattatgatggagatgt 1000
            |||||||||||||||||| ||||||||||||||
Sbjct: 246  tgtttgggcttgcaagaactatgatggagatgt 278



to top

>gb|AY112639.1| Zea mays CL62576_1 mRNA sequence
          Length = 435

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 120/152 (78%)
 Strand = Plus / Plus

                                                                       
Query: 450 atgtggaggagtccaaatgggacaataaggaacatcttaaatggaactgttttccgagaa 509
           ||||||| ||| |||||||| ||||| ||||||||  ||||||| ||||| ||| |||| 
Sbjct: 29  atgtggaagagcccaaatggcacaattaggaacattataaatggcactgtgttcagagag 88

                                                                       
Query: 510 ccaatcatctgcaagaatgttcctcggcttgtgcctggatggacaaaacccatatgcatt 569
           || || || |||      |||||  | ||||  || |||||||| || ||||| ||||||
Sbjct: 89  cctattatatgcnnnnncgttccaagacttggtccaggatggactaagcccatctgcatt 148

                                           
Query: 570 ggcagacatgcttttggtgatcaataccgagc 601
           || || ||||| || |||||||||||||||||
Sbjct: 149 ggaaggcatgccttcggtgatcaataccgagc 180



to top

>gb|DQ403074.1| Tamandua tetradactyla isocitrate dehydrogenase 1 (IDH1) mRNA,
           partial cds
          Length = 1113

 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                               
Query: 906 tggtatgaacatagactgattgatgatatggtggcc 941
           ||||||||||||||||| || |||||||||||||||
Sbjct: 652 tggtatgaacatagactcatcgatgatatggtggcc 687



to top

>gb|AY617794.1| Sterkiella histriomuscorum clone UGC1O0005_K08_R genomic sequence
          Length = 643

 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 216 atggacggtgatgagatgacacgaattatatggaaatggatcaa 259
           |||||||||||||| |||||  ||||||| ||||||||||||||
Sbjct: 265 atggacggtgatgaaatgaccagaattatctggaaatggatcaa 308



to top

>dbj|AK220845.1| Arabidopsis thaliana mRNA for NADP specific isocitrate dehydrogenase
            like protein, partial cds, clone: RAFL22-38-I02
          Length = 517

 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 103/128 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1149 agcacaaacagcattgcgtcaatctttgcatggtctactggattagcacatagggcaaag 1208
            |||||||||||||| || || || ||||| ||| ||  |||| | ||||| ||||| |||
Sbjct: 16   agcacaaacagcatagcctctatttttgcttggactcgtggacttgcacacagggctaag 75

                                                                        
Query: 1209 ctggatgacaacaaaagactgttggatttcacacaaaaacttgaagctgcttgtgtgggg 1268
             | |||||||||  || ||| |||||||||||  | || || ||||| |||||||| |||
Sbjct: 76   ttagatgacaacgcaaaactcttggatttcactgagaagctggaagccgcttgtgttggg 135

                    
Query: 1269 acagtgga 1276
            ||||||||
Sbjct: 136  acagtgga 143



to top

>gb|DQ196984.1| Collomia wilkenii clone 1534M putative cytosolic NADP isocitrate
            dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1338

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| |||||||
Sbjct: 1080 tggcctctttatcttagcaccaagaatactatccttaaaaaatatgatggaaggt 1134



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 642 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 694



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 385 atgtggaggagtcctaatggaacaattaggaacat 419



to top

>gb|DQ196983.1| Collomia tenella putative cytosolic NADP isocitrate dehydrogenase
            (idhB) gene, exons C-J and partial cds
          Length = 1339

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| |||||||
Sbjct: 1081 tggcctctttatcttagcaccaagaatactatccttaaaaaatatgatggaaggt 1135



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 643 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 695



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 386 atgtggaggagtcctaatggaacaattaggaacat 420



to top

>gb|DQ196982.1| Collomia tenella clone 1530A putative cytosolic NADP isocitrate
            dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1340

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| |||||||
Sbjct: 1082 tggcctctttatcttagcaccaagaatactatccttaaaaaatatgatggaaggt 1136



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 644 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 696



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 387 atgtggaggagtcctaatggaacaattaggaacat 421



to top

>gb|DQ196981.1| Collomia wilkenii clone 1534K putative cytosolic NADP isocitrate
            dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1373

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| |||||||
Sbjct: 1090 tggcctctttatcttagcaccaagaatactatccttaaaaaatatgatggaaggt 1144



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 650 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 702



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 393 atgtggaggagtcctaatggaacaattaggaacat 427



to top

>gb|DQ196980.1| Collomia cavanillesii clone 1344L putative cytosolic NADP isocitrate
            dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1368

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| |||||||
Sbjct: 1086 tggcctctttatcttagcaccaagaatactatccttaaaaaatatgatggaaggt 1140



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 646 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 698



to top

>gb|DQ196979.1| Collomia renacta clone 1531L putative cytosolic NADP isocitrate
            dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1368

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| |||||||
Sbjct: 1085 tggcctctttatcttagcaccaagaatactatccttaaaaaatatgatggaaggt 1139



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 645 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 697



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 388 atgtggaggagtcctaatggaacaattaggaacat 422



to top

>gb|DQ196978.1| Collomia linearis clone 1536B putative cytosolic NADP isocitrate
            dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1372

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                   
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatgacggaaggt 840
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| |||||||
Sbjct: 1089 tggcctctttatcttagcaccaagaatactatccttaaaaaatatgatggaaggt 1143



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 649 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 701



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 392 atgtggaggagtcctaatggaacaattaggaacat 426



to top

>ref|XM_640191.1| Dictyostelium discoideum AX4 isocitrate dehydrogenase (NADP+) (idhC)
            mRNA, complete cds
          Length = 1239

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                        
Query: 906  tggtatgaacatagactgattgatgatatggtggcctatgccctaaagagtgaaggtggc 965
            |||||||| |||||||| || || || ||||| ||||||||  | |||||||| ||||||
Sbjct: 736  tggtatgagcatagactcatcgacgacatggtcgcctatgctatgaagagtgagggtggc 795

                                               
Query: 966  tatgtttgggcttgcaagaattatgatggagatgt 1000
            |  ||||||||||| || || ||||| || |||||
Sbjct: 796  ttcgtttgggcttgtaaaaactatgacggtgatgt 830



to top

>gb|BC063967.1| Danio rerio isocitrate dehydrogenase 2 (NADP+), mitochondrial, mRNA
           (cDNA clone MGC:77679 IMAGE:6997405), complete cds
          Length = 1748

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 906 tggtatgaacatagactgattgatgatatggtggc 940
           ||||||||||| |||||||||||||| ||||||||
Sbjct: 904 tggtatgaacacagactgattgatgacatggtggc 938



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 972  tgggcttgcaagaattatgatggagatgtgcag 1004
            ||||| |||||||| ||||||||||||||||||
Sbjct: 970  tgggcctgcaagaactatgatggagatgtgcag 1002



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                       
Query: 495 actgttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggaca 554
           ||||| ||||| || |||||||||||||||||  ||||  | ||||| ||||| ||||||
Sbjct: 490 actgtcttccgtgagccaatcatctgcaagaacattcccagacttgttcctggttggaca 549

                                              
Query: 555 aaacccatatgcattggcagacatgcttttggtga 589
            |  ||||   ||||||||||||||| || |||||
Sbjct: 550 caggccatcaccattggcagacatgccttcggtga 584



to top

>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                                 
Query: 887    gtttgaggatgcaggaatatggtatgaacatagactgattgatgatatggt 937
              |||||||| ||| || || ||||||||||| ||||||||||| ||||||||
Sbjct: 303665 gtttgaggctgctggcatctggtatgaacacagactgattgacgatatggt 303715



to top

>gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete genome
          Length = 1308759

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                             
Query: 970    tttgggcttgcaagaattatgatggagatgt 1000
              |||||||||| ||||||||||||||||||||
Sbjct: 631623 tttgggcttgtaagaattatgatggagatgt 631593



 Score = 52.0 bits (26), Expect = 0.009
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                        
Query: 567    attggcagacatgcttttggtgatcaataccgagcaacagat 608
              ||||| |||||||||||||| ||||||||  |||||||||||
Sbjct: 632029 attggaagacatgcttttggcgatcaatatagagcaacagat 631988



to top

>emb|BX818521.1|CNS0AE6Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL83ZG01 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 679

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 60/71 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1245 aaacttgaagctgcttgtgtggggacagtggaatctggaaagatgacaaaggacctagct 1304
            ||||| ||||| |||||  ||||||| ||||| ||||| || ||||| ||||| ||||||
Sbjct: 224  aaactagaagcagcttgcatggggacggtggagtctggcaaaatgaccaaggatctagct 283

                       
Query: 1305 cttctcatcca 1315
            ||||| |||||
Sbjct: 284  cttctgatcca 294



to top

>ref|NM_207873.1| Eremothecium gossypii AAL022Wp (AAL022W), mRNA
          Length = 1248

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 45/51 (88%)
 Strand = Plus / Plus

                                                              
Query: 887 gtttgaggatgcaggaatatggtatgaacatagactgattgatgatatggt 937
           |||||||| ||| || || ||||||||||| ||||||||||| ||||||||
Sbjct: 720 gtttgaggctgctggcatctggtatgaacacagactgattgacgatatggt 770



to top

>ref|NM_199564.1| Danio rerio isocitrate dehydrogenase 2 (NADP+), mitochondrial
           (idh2), mRNA
 gb|BC048041.1| Danio rerio isocitrate dehydrogenase 2 (NADP+), mitochondrial, mRNA
           (cDNA clone MGC:55485 IMAGE:2640465), complete cds
          Length = 1740

 Score = 54.0 bits (27), Expect = 0.002
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 906 tggtatgaacatagactgattgatgatatggtggc 940
           ||||||||||| |||||||||||||| ||||||||
Sbjct: 923 tggtatgaacacagactgattgatgacatggtggc 957



 Score = 50.1 bits (25), Expect = 0.034
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 972  tgggcttgcaagaattatgatggagatgtgcag 1004
            ||||| |||||||| ||||||||||||||||||
Sbjct: 989  tgggcctgcaagaactatgatggagatgtgcag 1021



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                       
Query: 495 actgttttccgagaaccaatcatctgcaagaatgttcctcggcttgtgcctggatggaca 554
           ||||| ||||| || |||||||||||||||||  ||||  | ||||| ||||| ||||||
Sbjct: 509 actgtcttccgtgagccaatcatctgcaagaacattcccagacttgttcctggttggaca 568

                                              
Query: 555 aaacccatatgcattggcagacatgcttttggtga 589
            |  ||||   ||||||||||||||| || |||||
Sbjct: 569 caggccatcaccattggcagacatgccttcggtga 603



to top

>ref|XM_963757.1| PREDICTED: Tribolium castaneum similar to CG7176-PC, isoform C
            (LOC657289), mRNA
          Length = 1589

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 957  gaaggtggctatgtttgggcttgcaagaattatgatgg 994
            ||||| |||| ||| |||||||||||||||||||||||
Sbjct: 1019 gaagggggctttgtgtgggcttgcaagaattatgatgg 1056



to top

>gb|AY758242.1| Toxoplasma gondii isocitrate dehydrogenase (ICDH1) mRNA, complete cds
          Length = 1785

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 963  ggctatgtttgggcttgcaagaattatgatggagatgt 1000
            |||| ||||||||| |||||||||||||| ||||||||
Sbjct: 1321 ggctttgtttgggcgtgcaagaattatgacggagatgt 1358



to top

>gb|AY617793.1| Sterkiella histriomuscorum clone UGC1O0005_K08_F genomic sequence
          Length = 685

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacaga 1124
            |||||||||||||| |||||||| |||||  |||||||||||
Sbjct: 471  gaagctgaagctgctcacggtaccgtcaccagacattacaga 430



to top

>gb|AY432993.1| Aedes aegypti ASAP ID: 36387 isocitrate dehydrogenase mRNA sequence
          Length = 763

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 208 tcgtcgagatggacggtgatgagatgacacgaat 241
           |||| ||||||||||||||||||||||| |||||
Sbjct: 373 tcgtggagatggacggtgatgagatgacccgaat 406



to top

>ref|XM_708364.1| Candida albicans SC5314 cytosolic NADP-specific isocitrate
            dehydrogenase (CaO19.11217), mRNA
          Length = 429

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1015 ttgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggta 1074
            ||||||||||||||||||| || ||| | ||||| || || |||||    || |||||||
Sbjct: 38   ttgctcaaggttttggatctttgggtttgatgacctcagtgttggttactccagatggta 97

                                                          
Query: 1075 gaacagttgaagctgaagctgcacacggtacagtcacacgacatta 1120
             | || ||||| |||||||||| |||||||| |||||  |||||||
Sbjct: 98   aagcatttgaatctgaagctgctcacggtactgtcactagacatta 143



to top

>ref|XM_708328.1| Candida albicans SC5314 cytosolic NADP-specific isocitrate
            dehydrogenase (CaO19.3733), mRNA
          Length = 1239

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1015 ttgctcaaggttttggatcgttaggtctcatgacatcggttttggtgtgccctgatggta 1074
            ||||||||||||||||||| || ||| | ||||| || || |||||    || |||||||
Sbjct: 848  ttgctcaaggttttggatctttgggtttgatgacctcagtgttggttactccagatggta 907

                                                          
Query: 1075 gaacagttgaagctgaagctgcacacggtacagtcacacgacatta 1120
             | || ||||| |||||||||| |||||||| |||||  |||||||
Sbjct: 908  aagcatttgaatctgaagctgctcacggtactgtcactagacatta 953



 Score = 42.1 bits (21), Expect = 8.2
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 567 attggcagacatgcttttggtgatcaata 595
           ||||| ||||| |||||||||||||||||
Sbjct: 397 attggtagacacgcttttggtgatcaata 425



to top

>ref|XM_655511.1| Aspergillus nidulans FGSC A4 isocitrate dehydrogenase (AN2999.2),
           mRNA
          Length = 1476

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 201 aaccccatcgtcgagatggacggtgatgagatgacacgaattatatggaa 250
           |||||| |||| ||| ||||||||||||||||||| || ||||| |||||
Sbjct: 274 aaccccgtcgtggagttggacggtgatgagatgacccgcattatctggaa 323



to top

>dbj|AK107792.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-133-D06, full
           insert sequence
          Length = 703

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 200 caaccccatcgtcgagatggacggtg 225
           ||||||||||||||||||||||||||
Sbjct: 109 caaccccatcgtcgagatggacggtg 84



to top

>dbj|AK107325.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-E10, full
           insert sequence
          Length = 1434

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 186 aagatccaggttgccaaccccatcgtcgagatggacggtgatgagatgac 235
           |||||| |||| ||||||||| |||||||| | ||||| |||||||||||
Sbjct: 110 aagatcaaggtcgccaaccccgtcgtcgagctcgacggcgatgagatgac 159



to top

>ref|XM_735713.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000375.04.0)
           partial mRNA
          Length = 444

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 426 gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaat 475
           ||||||||||||||||||||||  |||||||  || |||||||| |||||
Sbjct: 337 gtaaaagagtttaatttaaaagaaatgtggaaaagcccaaatggtacaat 386



to top

>ref|XM_729441.1| Plasmodium chabaudi chabaudi hypothetical protein (PC302184.00.0)
           partial mRNA
          Length = 654

 Score = 52.0 bits (26), Expect = 0.009
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 426 gtaaaagagtttaatttaaaagctatgtggaggagtccaaatgggacaat 475
           ||||||||||||||||||||||  |||||||  || |||||||| |||||
Sbjct: 223 gtaaaagagtttaatttaaaagaaatgtggaaaagcccaaatggtacaat 272



to top

>dbj|AK233706.1| Sus scrofa mRNA, clone:LVRM10208G10, expressed in liver
          Length = 1444

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 213 gagatggacggtgatgagatgacacgaat 241
           ||||||||||||||||||||||| |||||
Sbjct: 278 gagatggacggtgatgagatgacccgaat 306



to top

>dbj|AK233241.1| Sus scrofa mRNA, clone:LVRM10108F06, expressed in liver
          Length = 1830

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 213 gagatggacggtgatgagatgacacgaat 241
           ||||||||||||||||||||||| |||||
Sbjct: 305 gagatggacggtgatgagatgacccgaat 333



to top

>dbj|AK231773.1| Sus scrofa mRNA, clone:LNG010021H05, expressed in lung
          Length = 1428

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 213 gagatggacggtgatgagatgacacgaat 241
           ||||||||||||||||||||||| |||||
Sbjct: 267 gagatggacggtgatgagatgacccgaat 295



to top

>gb|DQ196977.1| Collomia linearis clone 1510i putative cytosolic NADP isocitrate
           dehydrogenase (idhB) gene, exons C-J and partial cds
          Length = 1372

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                
Query: 549 tggacaaaacccatatgcattggcagacatgcttttggtgatcaataccgagc 601
           ||||||||||| ||||||||||| || ||||| ||||| ||||| ||| ||||
Sbjct: 649 tggacaaaacctatatgcattggaaggcatgcgtttggagatcagtacagagc 701



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 450 atgtggaggagtccaaatgggacaataaggaacat 484
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 392 atgtggaggagtcctaatggaacaattaggaacat 426



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 786  tggccactttatcttagtacgaagaacacaatcctgaaaaaatatga 832
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 1089 tggcctctttatcttagcaccaagaatactatccttaaaaaatatga 1135



to top

>ref|XM_001168316.1| PREDICTED: Pan troglodytes isocitrate dehydrogenase 2 (NADP+),
            mitochondrial, transcript variant 3 (IDH2), mRNA
          Length = 2785

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||| |||||||| ||||| ||||||||||||
Sbjct: 1097 ggtggctttgtgtgggcctgcaagaactatgacggagatgtgcag 1141



to top

>ref|XM_510589.2| PREDICTED: Pan troglodytes isocitrate dehydrogenase 2 (NADP+),
            mitochondrial, transcript variant 4 (IDH2), mRNA
          Length = 2706

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||| |||||||| ||||| ||||||||||||
Sbjct: 1018 ggtggctttgtgtgggcctgcaagaactatgacggagatgtgcag 1062



to top

>ref|XM_001168291.1| PREDICTED: Pan troglodytes isocitrate dehydrogenase 2 (NADP+),
            mitochondrial, transcript variant 2 (IDH2), mRNA
          Length = 2757

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||| |||||||| ||||| ||||||||||||
Sbjct: 1069 ggtggctttgtgtgggcctgcaagaactatgacggagatgtgcag 1113



to top

>ref|XM_001168261.1| PREDICTED: Pan troglodytes isocitrate dehydrogenase 2 (NADP+),
            mitochondrial, transcript variant 1 (IDH2), mRNA
          Length = 2769

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||| |||||||| ||||| ||||||||||||
Sbjct: 1081 ggtggctttgtgtgggcctgcaagaactatgacggagatgtgcag 1125



to top

>gb|DQ896063.1| Homo sapiens clone FLH189993.01L; RZPDo839D0565D IDH2 mRNA, partial
            sequence
          Length = 1359

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||| |||||||| ||||| ||||||||||||
Sbjct: 904  ggtggctttgtgtgggcctgcaagaactatgacggagatgtgcag 948



to top

>gb|DQ892817.1| Synthetic construct Homo sapiens clone FLH189997.01X; RZPDo839D0575D
            IDH2 mRNA, complete sequence
          Length = 1359

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||| |||||||| ||||| ||||||||||||
Sbjct: 904  ggtggctttgtgtgggcctgcaagaactatgacggagatgtgcag 948



to top

>gb|AC187707.1| Gasterosteus aculeatus clone VMRC28-60C14, complete sequence
          Length = 136383

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 968   tgtttgggcttgcaagaattatgatggagatgtgcag 1004
             ||||||||| ||||||||||| || ||||||||||||
Sbjct: 52173 tgtttgggcctgcaagaattacgacggagatgtgcag 52137



to top

>gb|DQ443205.1| Bombyx mori NADPH-specific isocitrate dehydrogenase mRNA, complete
           cds
          Length = 2085

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 210 gtcgagatggacggtgatgagatgacacg 238
           ||||||||||| |||||||||||||||||
Sbjct: 265 gtcgagatggatggtgatgagatgacacg 293



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                          
Query: 959  aggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            |||||||| ||||||||| ||||| || || || ||||||||||||
Sbjct: 1014 aggtggctttgtttgggcctgcaaaaactacgacggagatgtgcag 1059



to top

>gb|AC122587.5| Rattus norvegicus  BAC CH230-173H6 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 202972

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                       
Query: 1721   tgtaccaaagaaataagctggagta 1745
              |||||||||||||||||||||||||
Sbjct: 121895 tgtaccaaagaaataagctggagta 121919



to top

>gb|AC164075.4| Mus musculus chromosome 7, clone RP24-259P13, complete sequence
          Length = 159578

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                          
Query: 960   ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
             ||||||| ||| ||||||||||| || ||||||||||| ||||||
Sbjct: 92713 ggtggctttgtgtgggcttgcaaaaactatgatggagacgtgcag 92669



to top

>ref|NM_002168.2| Homo sapiens isocitrate dehydrogenase 2 (NADP+), mitochondrial
            (IDH2), mRNA
          Length = 1740

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||| |||||||| ||||| ||||||||||||
Sbjct: 990  ggtggctttgtgtgggcctgcaagaactatgacggagatgtgcag 1034



to top

>gb|AC109232.17| Mus musculus chromosome 7, clone RP23-423P21, complete sequence
          Length = 201262

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||||||||| || ||||||||||| ||||||
Sbjct: 99   ggtggctttgtgtgggcttgcaaaaactatgatggagacgtgcag 55



to top

>gb|BC060030.1| Mus musculus isocitrate dehydrogenase 2 (NADP+), mitochondrial, mRNA
            (cDNA clone MGC:68036 IMAGE:6515657), complete cds
          Length = 1708

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                         
Query: 960  ggtggctatgtttgggcttgcaagaattatgatggagatgtgcag 1004
            ||||||| ||| ||||||||||| || ||||||||||| ||||||
Sbjct: 966  ggtggctttgtgtgggcttgcaaaaactatgatggagacgtgcag 1010



to top

>ref|XM_705827.1| Candida albicans SC5314 NADP-specific isocitrate dehydrogenase
            (CaO19.5211), mRNA
          Length = 1302

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 1015 ttgctcaaggttttggatcgttaggtctcatgacatc 1051
            ||||||||||||||||||| |||||| | ||||||||
Sbjct: 926  ttgctcaaggttttggatcattaggtttaatgacatc 962



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 820 tgaaaaaatatgacggaaggtttaaagacatattccaa 857
           |||||||||| || ||||| ||||||||||| ||||||
Sbjct: 731 tgaaaaaatacgatggaagatttaaagacatcttccaa 768



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacaga 1124
            |||||||||||||| |||||||| |||||  |||| ||||||
Sbjct: 994  gaagctgaagctgcccacggtaccgtcaccagacactacaga 1035



to top

>ref|XM_705812.1| Candida albicans SC5314 NADP-specific isocitrate dehydrogenase
            (CaO19.12678), mRNA
          Length = 1302

 Score = 50.1 bits (25), Expect = 0.034
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 1015 ttgctcaaggttttggatcgttaggtctcatgacatc 1051
            ||||||||||||||||||| |||||| | ||||||||
Sbjct: 926  ttgctcaaggttttggatcattaggtttaatgacatc 962



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 820 tgaaaaaatatgacggaaggtttaaagacatattccaa 857
           |||||||||| || ||||| ||||||||||| ||||||
Sbjct: 731 tgaaaaaatacgatggaagatttaaagacatcttccaa 768



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 1083 gaagctgaagctgcacacggtacagtcacacgacattacaga 1124
            |||||||||||||| |||||||| |||||  |||| ||||||
Sbjct: 994  gaagctgaagctgcccacggtaccgtcaccagacactacaga 1035


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 389,210,024
Number of extensions: 20541313
Number of successful extensions: 110491
Number of sequences better than 10.0: 425
Number of HSP's gapped: 110414
Number of HSP's successfully gapped: 879
Length of query: 2146
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 2123
Effective length of database: 18,503,978,556
Effective search space: 39283946474388
Effective search space used: 39283946474388
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)
to top