ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf69h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY302061.1| Populus tomentosa auxin transporter protein 1 mRN... 42 1.3
2gb|AC140191.2| Mus musculus BAC clone RP24-375E1 from chromosome... 42 1.3
3dbj|AP006075.1| Lotus japonicus genomic DNA, chromosome 3, clone... 42 1.3
4ref|XM_314864.2| Anopheles gambiae str. PEST ENSANGP00000005170 ... 42 1.3
5gb|AY864733.1| Populus tomentosa auxin influx protein (AUX1) mRN... 42 1.3
6emb|AM286409.1| Halobacillus halophilus glnA2 gene for glutamine... 40 5.1
7gb|CP000110.1| Synechococcus sp. CC9605, complete genome 40 5.1
8gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosom... 40 5.1
9emb|AL365509.8| Human DNA sequence from clone RP11-653O20 on chr... 40 5.1
10gb|AY620818.1| Elaeagnus umbellata glutamine synthetase mRNA, co... 40 5.1

>gb|AY302061.1| Populus tomentosa auxin transporter protein 1 mRNA, partial cds
          Length = 942
 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 272 cacacaaagtacaatgaggtgcatg 296
           |||||||||||||||| ||||||||
Sbjct: 250 cacacaaagtacaatggggtgcatg 226



to top

>gb|AC140191.2| Mus musculus BAC clone RP24-375E1 from chromosome 7, complete sequence
          Length = 164310

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 30    gcatttgaatctgtttgtttg 50
             |||||||||||||||||||||
Sbjct: 48651 gcatttgaatctgtttgtttg 48671



to top

>dbj|AP006075.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT46K10, TM0112,
             complete sequence
          Length = 103522

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 272   cacacaaagtacaatgaggtgcatg 296
             |||||||||||||||| ||||||||
Sbjct: 92061 cacacaaagtacaatggggtgcatg 92037



to top

>ref|XM_314864.2| Anopheles gambiae str. PEST ENSANGP00000005170
           (ENSANGG00000003986), partial mRNA
          Length = 1404

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 181 ttgcctcttcgaccagtgcca 201
           |||||||||||||||||||||
Sbjct: 812 ttgcctcttcgaccagtgcca 832



to top

>gb|AY864733.1| Populus tomentosa auxin influx protein (AUX1) mRNA, complete cds
          Length = 1760

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 272  cacacaaagtacaatgaggtgcatg 296
            |||||||||||||||| ||||||||
Sbjct: 1068 cacacaaagtacaatggggtgcatg 1044



to top

>emb|AM286409.1| Halobacillus halophilus glnA2 gene for glutamine synthetase, type
           strain DSM 2266T
          Length = 1311

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 263 aagtacaagcacacaaagta 282
           ||||||||||||||||||||
Sbjct: 32  aagtacaagcacacaaagta 51



to top

>gb|CP000110.1| Synechococcus sp. CC9605, complete genome
          Length = 2510659

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 117     gttccatccccagcagctgg 136
               ||||||||||||||||||||
Sbjct: 1014475 gttccatccccagcagctgg 1014456



to top

>gb|AC166097.5| Mus musculus BAC clone RP24-447P10 from chromosome 9, complete sequence
          Length = 196951

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   gtgccatggcccagaggttc 215
             ||||||||||||||||||||
Sbjct: 87524 gtgccatggcccagaggttc 87505



to top

>emb|AL365509.8| Human DNA sequence from clone RP11-653O20 on chromosome 6 Contains part
             of a novel gene and the 3' end of the FOXO3A gene for
             forkhead box O3A, complete sequence
          Length = 61900

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   gggatgcaaatcaggctgga 155
             ||||||||||||||||||||
Sbjct: 15006 gggatgcaaatcaggctgga 14987



to top

>gb|AY620818.1| Elaeagnus umbellata glutamine synthetase mRNA, complete cds
          Length = 1359

 Score = 40.1 bits (20), Expect = 5.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 258  agacaaagtacaagcacaca 277
            ||||||||||||||||||||
Sbjct: 1236 agacaaagtacaagcacaca 1217


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 58,621,534
Number of extensions: 2987214
Number of successful extensions: 215748
Number of sequences better than 10.0: 10
Number of HSP's gapped: 215748
Number of HSP's successfully gapped: 10
Length of query: 356
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 334
Effective length of database: 18,508,616,841
Effective search space: 6181878024894
Effective search space used: 6181878024894
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
to top