ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf64c02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC156023.2| Mus musculus BAC clone RP23-210I15 from chromosom... 48 0.11
2ref|XM_460730.1| Debaryomyces hansenii CBS767 hypothetical prote... 46 0.44
3gb|AC053544.5| Homo sapiens BAC clone RP11-793B9 from 4, complet... 46 0.44
4emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS... 46 0.44
5gb|AC187526.3| Pan troglodytes BAC clone CH251-162D7 from chromo... 44 1.8
6gb|AC188058.1| Callithrix jacchus chromosome UNK clone CH259-52H... 44 1.8
7gb|AC114689.4| Homo sapiens chromosome 18, clone RP11-638L3, com... 44 1.8
8emb|CR388409.5| Zebrafish DNA sequence from clone DKEY-60P1 in l... 44 1.8
9emb|BX908752.8| Zebrafish DNA sequence from clone DKEYP-12C7 in ... 44 1.8
10gb|AC005058.1|AC005058 Homo sapiens BAC clone CTB-54D4 from 7q31... 44 1.8
11gb|BC122821.1| Bos taurus cDNA clone IMAGE:8056039, containing f... 42 6.9
12ref|NM_001077822.1| Apis mellifera cys-loop ligand-gated ion cha... 42 6.9
13ref|XM_631946.1| Dictyostelium discoideum AX4 hypothetical prote... 42 6.9
14gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence 42 6.9
15gb|AC158586.8| Mus musculus chromosome 5, clone RP24-372A2, comp... 42 6.9
16gb|AC118249.11| Mus musculus chromosome 19, clone RP23-397G23, c... 42 6.9
17gb|AC115046.7| Mus musculus chromosome 5, clone RP24-321O4, comp... 42 6.9
18gb|AC116953.5| Mus musculus BAC clone RP23-119H17 from chromosom... 42 6.9
19gb|AC125402.3| Mus musculus BAC clone RP24-539G2 from chromosome... 42 6.9
20gb|AC122812.4| Mus musculus BAC clone RP23-285M9 from 1, complet... 42 6.9
21gb|AC098737.3| Mus musculus BAC clone RP23-122D16 from 1, comple... 42 6.9
22emb|CR536615.10| Zebrafish DNA sequence from clone CH211-247C17 ... 42 6.9
23gb|AC104237.2| Homo sapiens chromosome 11, clone RP11-35J10, com... 42 6.9
24gb|AC022021.10| Homo sapiens chromosome 10 clone RP11-351M16, co... 42 6.9
25emb|BX546468.1| Human DNA sequence from clone RP5-1111N9 on chro... 42 6.9
26emb|AL355501.26| Human DNA sequence from clone RP11-360P7 on chr... 42 6.9
27emb|AL354682.22| Human DNA sequence from clone RP11-282L14 on ch... 42 6.9
28emb|AL121757.7|HSDJ828H9 Human DNA sequence from clone RP5-828H9... 42 6.9
29emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome 42 6.9
30emb|CR385021.12| Zebrafish DNA sequence from clone CH211-200N15 ... 42 6.9
31emb|CR854930.5| Zebrafish DNA sequence from clone CH211-268F11 i... 42 6.9
32gb|AC021713.7|AC021713 Homo sapiens chromosome , clone RP11-63D1... 42 6.9
33gb|AE009597.1| Brucella melitensis 16M chromosome I, section 154... 42 6.9
34gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I... 42 6.9
35gb|AC118750.13| Mus musculus chromosome 10, clone RP24-198J23, c... 42 6.9
36gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta... 42 6.9
37gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. F... 42 6.9
38emb|AL935173.9| Zebrafish DNA sequence from clone CH211-196D9, c... 42 6.9
39emb|AL022574.7|HS1111N9 Human DNA sequence from clone RP5-1111N9... 42 6.9
40emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,... 42 6.9
41emb|AL691500.7| Mouse DNA sequence from clone RP23-182H15 on chr... 42 6.9

>gb|AC156023.2| Mus musculus BAC clone RP23-210I15 from chromosome 16, complete
             sequence
          Length = 196765
 Score = 48.1 bits (24), Expect = 0.11
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 19    cacacacacaaactaaaaatttca 42
             ||||||||||||||||||||||||
Sbjct: 92335 cacacacacaaactaaaaatttca 92358



to top

>ref|XM_460730.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F09361g)
            partial mRNA
          Length = 4035

 Score = 46.1 bits (23), Expect = 0.44
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1472 tattgatccatttggatgatcaa 1494
            |||||||||||||||||||||||
Sbjct: 1220 tattgatccatttggatgatcaa 1242



to top

>gb|AC053544.5| Homo sapiens BAC clone RP11-793B9 from 4, complete sequence
          Length = 187332

 Score = 46.1 bits (23), Expect = 0.44
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1287  tttcaagcatttaagagaaactt 1309
             |||||||||||||||||||||||
Sbjct: 97607 tttcaagcatttaagagaaactt 97585



to top

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
              hansenii
          Length = 2336804

 Score = 46.1 bits (23), Expect = 0.44
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1472   tattgatccatttggatgatcaa 1494
              |||||||||||||||||||||||
Sbjct: 745868 tattgatccatttggatgatcaa 745846



to top

>gb|AC187526.3| Pan troglodytes BAC clone CH251-162D7 from chromosome 7, complete
              sequence
          Length = 183826

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 1750   aaacaacttcagtagtatgcaaaatt 1775
              |||||| |||||||||||||||||||
Sbjct: 103187 aaacaaattcagtagtatgcaaaatt 103212



to top

>gb|AC188058.1| Callithrix jacchus chromosome UNK clone CH259-52H12, complete sequence
          Length = 200527

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 1658  acaatgatgatgaagtggatta 1679
             ||||||||||||||||||||||
Sbjct: 42657 acaatgatgatgaagtggatta 42636



to top

>gb|AC114689.4| Homo sapiens chromosome 18, clone RP11-638L3, complete sequence
          Length = 177781

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1333  atgtacccacacttgcttgaaa 1354
             ||||||||||||||||||||||
Sbjct: 20609 atgtacccacacttgcttgaaa 20630



to top

>emb|CR388409.5| Zebrafish DNA sequence from clone DKEY-60P1 in linkage group 18,
            complete sequence
          Length = 40942

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1705 atagttaataacaaagtatata 1726
            ||||||||||||||||||||||
Sbjct: 6680 atagttaataacaaagtatata 6659



to top

>emb|BX908752.8| Zebrafish DNA sequence from clone DKEYP-12C7 in linkage group 18,
            complete sequence
          Length = 49348

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1705 atagttaataacaaagtatata 1726
            ||||||||||||||||||||||
Sbjct: 6903 atagttaataacaaagtatata 6882



to top

>gb|AC005058.1|AC005058 Homo sapiens BAC clone CTB-54D4 from 7q31, complete sequence
          Length = 182256

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 1750   aaacaacttcagtagtatgcaaaatt 1775
              |||||| |||||||||||||||||||
Sbjct: 136117 aaacaaattcagtagtatgcaaaatt 136142



to top

>gb|BC122821.1| Bos taurus cDNA clone IMAGE:8056039, containing frame-shift errors
          Length = 1721

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 1441 cctggtacctttgaatatgttgttc 1465
            ||||||||||||| |||||||||||
Sbjct: 272  cctggtacctttgcatatgttgttc 248



to top

>ref|NM_001077822.1| Apis mellifera cys-loop ligand-gated ion channel (LOC726970), mRNA
 gb|DQ667193.1| Apis mellifera cys-loop ligand-gated ion channel subunit mRNA,
            complete cds
          Length = 1533

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 136  atcaagaagaatttaaatggc 156
            |||||||||||||||||||||
Sbjct: 1481 atcaagaagaatttaaatggc 1501



to top

>ref|XM_631946.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0219273)
            mRNA, complete cds
          Length = 783

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1747 taaaaacaacttcagtagtat 1767
            |||||||||||||||||||||
Sbjct: 412  taaaaacaacttcagtagtat 392



to top

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 157    cttgtcgaaaatgcctgcaaa 177
              |||||||||||||||||||||
Sbjct: 311195 cttgtcgaaaatgcctgcaaa 311215



to top

>gb|AC158586.8| Mus musculus chromosome 5, clone RP24-372A2, complete sequence
          Length = 196167

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 545   aagacgtagaaaacctctacaatga 569
             |||||||| ||||||||||||||||
Sbjct: 36124 aagacgtaaaaaacctctacaatga 36100



to top

>gb|AC118249.11| Mus musculus chromosome 19, clone RP23-397G23, complete sequence
          Length = 224129

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 429   aatcaaaacttcaccaagatt 449
             |||||||||||||||||||||
Sbjct: 52180 aatcaaaacttcaccaagatt 52200



to top

>gb|AC115046.7| Mus musculus chromosome 5, clone RP24-321O4, complete sequence
          Length = 157064

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 19    cacacacacaaactaaaaatttcaa 43
             ||||||||||| |||||||||||||
Sbjct: 97051 cacacacacaatctaaaaatttcaa 97027



to top

>gb|AC116953.5| Mus musculus BAC clone RP23-119H17 from chromosome 7, complete sequence
          Length = 193506

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 463    cttgaattaagcagttacctt 483
              |||||||||||||||||||||
Sbjct: 131537 cttgaattaagcagttacctt 131557



to top

>gb|AC125402.3| Mus musculus BAC clone RP24-539G2 from chromosome 5, complete sequence
          Length = 163773

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 545   aagacgtagaaaacctctacaatga 569
             |||||||| ||||||||||||||||
Sbjct: 70538 aagacgtaaaaaacctctacaatga 70562



to top

>gb|AC122812.4| Mus musculus BAC clone RP23-285M9 from 1, complete sequence
          Length = 208430

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 19     cacacacacaaactaaaaatt 39
              |||||||||||||||||||||
Sbjct: 196692 cacacacacaaactaaaaatt 196672



to top

>gb|AC098737.3| Mus musculus BAC clone RP23-122D16 from 1, complete sequence
          Length = 212615

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 19     cacacacacaaactaaaaatt 39
              |||||||||||||||||||||
Sbjct: 129538 cacacacacaaactaaaaatt 129558



to top

>emb|CR536615.10| Zebrafish DNA sequence from clone CH211-247C17 in linkage group 1,
              complete sequence
          Length = 153688

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1443   tggtacctttgaatatgttgt 1463
              |||||||||||||||||||||
Sbjct: 105915 tggtacctttgaatatgttgt 105935



to top

>gb|AC104237.2| Homo sapiens chromosome 11, clone RP11-35J10, complete sequence
          Length = 164732

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 650   gaagccagcttttctcctatt 670
             |||||||||||||||||||||
Sbjct: 70271 gaagccagcttttctcctatt 70291



to top

>gb|AC022021.10| Homo sapiens chromosome 10 clone RP11-351M16, complete sequence
          Length = 190202

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1723   tataagcataggaaaatatct 1743
              |||||||||||||||||||||
Sbjct: 124767 tataagcataggaaaatatct 124747



to top

>emb|BX546468.1| Human DNA sequence from clone RP5-1111N9 on chromosome Xq21.1-21.3,
             complete sequence
          Length = 61422

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    gcacacacacaaactaaaaat 38
             |||||||||||||||||||||
Sbjct: 12403 gcacacacacaaactaaaaat 12423



to top

>emb|AL355501.26| Human DNA sequence from clone RP11-360P7 on chromosome 10 Contains the 5'
              end of the gene for a novel protein (FLJ32798), a zinc
              finger protein pseudogene and a CpG island, complete
              sequence
          Length = 179380

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1723   tataagcataggaaaatatct 1743
              |||||||||||||||||||||
Sbjct: 161714 tataagcataggaaaatatct 161734



to top

>emb|AL354682.22| Human DNA sequence from clone RP11-282L14 on chromosome 9, complete
             sequence
          Length = 108785

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1726  aagcataggaaaatatctttgtaaa 1750
             |||||||||||||||||||| ||||
Sbjct: 66896 aagcataggaaaatatctttttaaa 66920



to top

>emb|AL121757.7|HSDJ828H9 Human DNA sequence from clone RP5-828H9 on chromosome 20 Contains two
             novel genes and two CpG islands, complete sequence
          Length = 167013

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 327   gcaaattgatgcccaaattgttatc 351
             ||||||||||||||| |||||||||
Sbjct: 68909 gcaaattgatgcccagattgttatc 68933



to top

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 30      actaaaaatttcaatgattga 50
               |||||||||||||||||||||
Sbjct: 1651696 actaaaaatttcaatgattga 1651716



to top

>emb|CR385021.12| Zebrafish DNA sequence from clone CH211-200N15 in linkage group 16,
             complete sequence
          Length = 148046

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1706  tagttaataacaaagtatata 1726
             |||||||||||||||||||||
Sbjct: 46981 tagttaataacaaagtatata 46961



to top

>emb|CR854930.5| Zebrafish DNA sequence from clone CH211-268F11 in linkage group 13,
             complete sequence
          Length = 92936

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 425   aagaaatcaaaacttcaccaa 445
             |||||||||||||||||||||
Sbjct: 84401 aagaaatcaaaacttcaccaa 84421



to top

>gb|AC021713.7|AC021713 Homo sapiens chromosome , clone RP11-63D14, complete sequence
          Length = 148648

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1734  gaaaatatctttgtaaaaaca 1754
             |||||||||||||||||||||
Sbjct: 31676 gaaaatatctttgtaaaaaca 31696



to top

>gb|AE009597.1| Brucella melitensis 16M chromosome I, section 154 of 195 of the
            complete sequence
          Length = 10526

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 157  cttgtcgaaaatgcctgcaaa 177
            |||||||||||||||||||||
Sbjct: 9495 cttgtcgaaaatgcctgcaaa 9475



to top

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 157    cttgtcgaaaatgcctgcaaa 177
              |||||||||||||||||||||
Sbjct: 333087 cttgtcgaaaatgcctgcaaa 333107



to top

>gb|AC118750.13| Mus musculus chromosome 10, clone RP24-198J23, complete sequence
          Length = 174226

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 707   aacttaacaataaagttgaaaacta 731
             |||||||||||||| ||||||||||
Sbjct: 60369 aacttaacaataaaattgaaaacta 60345



to top

>gb|AE000666.1| Methanothermobacter thermautotrophicus str. Delta H, complete genome
          Length = 1751377

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 851    cttccaaggacagattcaagt 871
              |||||||||||||||||||||
Sbjct: 758428 cttccaaggacagattcaagt 758448



to top

>gb|AE016823.1| Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130, chromosome
               I, complete sequence
          Length = 4277185

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 884     ttagaaactgcggtagaggcc 904
               |||||||||||||||||||||
Sbjct: 2358616 ttagaaactgcggtagaggcc 2358596



to top

>emb|AL935173.9| Zebrafish DNA sequence from clone CH211-196D9, complete sequence
          Length = 205213

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1443  tggtacctttgaatatgttgt 1463
             |||||||||||||||||||||
Sbjct: 45856 tggtacctttgaatatgttgt 45836



to top

>emb|AL022574.7|HS1111N9 Human DNA sequence from clone RP5-1111N9 on chromosome Xq21.1-21.3,
             complete sequence
          Length = 148521

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 18    gcacacacacaaactaaaaat 38
             |||||||||||||||||||||
Sbjct: 12403 gcacacacacaaactaaaaat 12423



to top

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 157    cttgtcgaaaatgcctgcaaa 177
              |||||||||||||||||||||
Sbjct: 329455 cttgtcgaaaatgcctgcaaa 329475



to top

>emb|AL691500.7| Mouse DNA sequence from clone RP23-182H15 on chromosome X, complete
             sequence
          Length = 196828

 Score = 42.1 bits (21), Expect = 6.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 426   agaaatcaaaacttcaccaag 446
             |||||||||||||||||||||
Sbjct: 78113 agaaatcaaaacttcaccaag 78093


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 380,488,102
Number of extensions: 20314407
Number of successful extensions: 414807
Number of sequences better than 10.0: 41
Number of HSP's gapped: 414807
Number of HSP's successfully gapped: 41
Length of query: 1818
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1795
Effective length of database: 18,503,978,556
Effective search space: 33214641508020
Effective search space used: 33214641508020
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top