ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf69c18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_001218252.1| Aspergillus terreus NIH2624 conserved hypoth... 90 5e-14
2ref|XM_750030.1| Aspergillus fumigatus Af293 hypothetical protei... 74 3e-09
3ref|XM_389849.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 68 2e-07
4ref|XM_001223457.1| Chaetomium globosum CBS 148.51 hypothetical ... 58 2e-04
5dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 54 0.003
6emb|BX908808.1| Neurospora crassa DNA linkage group IV Cosmid co... 54 0.003
7ref|XM_951933.1| Neurospora crassa OR74A hypothetical protein (N... 54 0.003
8gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 48 0.17
9gb|AC188609.2| Taeniopygia guttata BAC clone TGMCBa-23H12 from c... 46 0.68
10gb|AC189221.1| Brassica rapa subsp. pekinensis clone KBrB010L05,... 46 0.68
11gb|AE017221.1| Thermus thermophilus HB27, complete genome 46 0.68
12gb|CP000463.1| Rhodopseudomonas palustris BisA53, complete genome 44 2.7
13ref|XM_001215822.1| Aspergillus terreus NIH2624 hypothetical pro... 44 2.7
14gb|AC149572.14| Medicago truncatula clone mth2-116e22, complete ... 44 2.7
15ref|XM_658811.1| Aspergillus nidulans FGSC A4 hypothetical prote... 44 2.7
16emb|CT009508.6| M.truncatula DNA sequence from clone MTH2-76H16 ... 44 2.7
17gb|AC027273.5| Homo sapiens BAC clone RP11-764F10 from 4, comple... 44 2.7
18emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genom... 44 2.7
19dbj|AB106877.1| Xenopus laevis ap-2rep mRNA for AP-2 repressor, ... 44 2.7

>ref|XM_001218252.1| Aspergillus terreus NIH2624 conserved hypothetical protein
            (ATEG_09631) mRNA, complete cds
          Length = 1947
 Score = 89.7 bits (45), Expect = 5e-14
 Identities = 102/121 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1229 tccagatcgtcactgtcatcatgggcttcctacaaatctgttccggcgtcgttctgctac 1288
            ||||||||| ||| ||||||||||||||||| || |||||  |||||||||| || || |
Sbjct: 845  tccagatcgccacggtcatcatgggcttcctgcagatctgcgccggcgtcgtcctcctgc 904

                                                                        
Query: 1289 aactctccaagtcggcaaaggacgtgccggactcagctgtcttcaagggcgatcttgacc 1348
            |||||||||| ||||| |||||||| || ||| | || |||||||| ||||| || ||||
Sbjct: 905  aactctccaaatcggccaaggacgtccccgacgccgccgtcttcaaaggcgacctggacc 964

             
Query: 1349 a 1349
            |
Sbjct: 965  a 965



to top

>ref|XM_750030.1| Aspergillus fumigatus Af293 hypothetical protein (Afu2g07880) partial
            mRNA
          Length = 2226

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 211/269 (78%)
 Strand = Plus / Plus

                                                                        
Query: 1036 cagtttaaggaatggttcctctacgtgctactagtctttgttgtggtcacgttactgacg 1095
            ||||||||||| ||||| ||||||||||| || || |||||  | |  || |||||||||
Sbjct: 697  cagtttaaggagtggtttctctacgtgctgcttgtgtttgtcattgcaaccttactgacg 756

                                                                        
Query: 1096 gagatcatctacctgaacaaagccttgaacttgttcaacgctgctttagtgacaccaaca 1155
            ||||| |||||||| || ||||| |||||| | |||||||| ||  | || || || || 
Sbjct: 757  gagattatctacctcaataaagcgttgaacctcttcaacgccgccctcgtcacccccacc 816

                                                                        
Query: 1156 tactacgtcttcttcacgtctgcgacaatcgtcacttcggctgtcttgttccaaggattc 1215
            ||||| |||||||| |||  | |||| |||||| | || || || |||||||  || |||
Sbjct: 817  tactatgtcttctttacgagttcgaccatcgtctcctccgcggtgttgttccggggtttc 876

                                                                        
Query: 1216 aaaggcaccccactccagatcgtcactgtcatcatgggcttcctacaaatctgttccggc 1275
            |||||||||    | ||||||| ||| |||||| | || ||||| ||||||||  | |||
Sbjct: 877  aaaggcaccggcatgcagatcgccacggtcatccttggattcctgcaaatctgcgcgggc 936

                                         
Query: 1276 gtcgttctgctacaactctccaagtcggc 1304
            ||||| ||| | || || |||||||||||
Sbjct: 937  gtcgtgctgttgcagctgtccaagtcggc 965



 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 474 tacaatgaagaggcgggagaaggctatggatacctcaagaacgcttggtggtggctcggt 533
           ||||||||||| ||||| || || || ||||||||||||||||  |||||||||  ||| 
Sbjct: 190 tacaatgaagaagcgggcgaggggtacggatacctcaagaacgtctggtggtggtccggg 249

                                  
Query: 534 atgacactcatgattgttggaga 556
           ||||  ||||||||||| |||||
Sbjct: 250 atgatcctcatgattgtcggaga 272



to top

>ref|XM_389849.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09673.1)
           partial mRNA
          Length = 1872

 Score = 67.9 bits (34), Expect = 2e-07
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                       
Query: 619 gtcgcatacgccttcaccgacgccatcctcgtaacccccatgggcgccctctccgtcgtc 678
           |||||||||||||| ||||| || |||||||| || ||| |||||||||| |||||||||
Sbjct: 262 gtcgcatacgcctttaccgatgcaatcctcgtcactcccctgggcgccctatccgtcgtc 321

             
Query: 679 at 680
           ||
Sbjct: 322 at 323



 Score = 54.0 bits (27), Expect = 0.003
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                      
Query: 469 agaagtacaatgaagaggcgggagaaggctatggatacctcaagaacgcttggtggtgg 527
           |||| ||||||||||  || || |||||||| |||||||||||||||  ||||||||||
Sbjct: 161 agaaatacaatgaagtcgctggtgaaggctacggatacctcaagaacttttggtggtgg 219



to top

>ref|XM_001223457.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_04244)
           mRNA, complete cds
          Length = 2400

 Score = 58.0 bits (29), Expect = 2e-04
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                
Query: 628 gccttcaccgacgccatcctcgtaacccccatgggcgccctctccgtcgtcat 680
           |||||||||||||||||||| || |||||  ||||||| ||||| ||||||||
Sbjct: 298 gccttcaccgacgccatccttgtcaccccgctgggcgctctctctgtcgtcat 350



 Score = 44.1 bits (22), Expect = 2.7
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 904 ggccccaagtacggaaagaagactatgatggtctacatcactatctgcag 953
           ||||| ||||||||||| |||| |||| |||| |||||| | ||||||||
Sbjct: 574 ggcccgaagtacggaaacaagaatatgttggtttacatctccatctgcag 623



to top

>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                          
Query: 1291    ctctccaagtcggcaaaggacgtgccggactcagctgtcttcaagggcgatcttgacca 1349
               ||||||||||| || |||||||| || ||||| ||||||||||| ||||| || |||||
Sbjct: 2380426 ctctccaagtccgccaaggacgtccccgactccgctgtcttcaaaggcgacctcgacca 2380368



to top

>emb|BX908808.1| Neurospora crassa DNA linkage group IV Cosmid contig G21B4
          Length = 177225

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                       
Query: 501  ggatacctcaagaacgcttggtggtgg 527
            |||||||||||||||||||||||||||
Sbjct: 8390 ggatacctcaagaacgcttggtggtgg 8416



to top

>ref|XM_951933.1| Neurospora crassa OR74A hypothetical protein (NCU04457.1) partial
           mRNA
          Length = 2397

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 501 ggatacctcaagaacgcttggtggtgg 527
           |||||||||||||||||||||||||||
Sbjct: 220 ggatacctcaagaacgcttggtggtgg 246



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 48.1 bits (24), Expect = 0.17
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 993     cggtgctgccgtcgtagcgcaggc 1016
               ||||||||||||||||||||||||
Sbjct: 1833557 cggtgctgccgtcgtagcgcaggc 1833580



to top

>gb|AC188609.2| Taeniopygia guttata BAC clone TGMCBa-23H12 from chromosome unknown,
              complete sequence
          Length = 155715

 Score = 46.1 bits (23), Expect = 0.68
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 51     tggtgccctggaccctgtccaaa 73
              |||||||||||||||||||||||
Sbjct: 149177 tggtgccctggaccctgtccaaa 149155



to top

>gb|AC189221.1| Brassica rapa subsp. pekinensis clone KBrB010L05, complete sequence
          Length = 156080

 Score = 46.1 bits (23), Expect = 0.68
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 1674 ccctggtttcttccaaagattac 1696
            |||||||||||||||||||||||
Sbjct: 409  ccctggtttcttccaaagattac 387



to top

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 46.1 bits (23), Expect = 0.68
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1950   cgctcccccaagaccacctcccc 1972
              |||||||||||||||||||||||
Sbjct: 291055 cgctcccccaagaccacctcccc 291033



to top

>gb|CP000463.1| Rhodopseudomonas palustris BisA53, complete genome
          Length = 5505494

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 995     gtgctgccgtcgtagcgcaggc 1016
               ||||||||||||||||||||||
Sbjct: 1645539 gtgctgccgtcgtagcgcaggc 1645560



to top

>ref|XM_001215822.1| Aspergillus terreus NIH2624 hypothetical protein (ATEG_06644) mRNA,
           complete cds
          Length = 825

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 628 gccttcaccgacgccatcctcg 649
           ||||||||||||||||||||||
Sbjct: 346 gccttcaccgacgccatcctcg 367



to top

>gb|AC149572.14| Medicago truncatula clone mth2-116e22, complete sequence
          Length = 120017

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 2406  tcttctcttctgttctcagtta 2427
             ||||||||||||||||||||||
Sbjct: 81182 tcttctcttctgttctcagtta 81161



to top

>ref|XM_658811.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6299.2), mRNA
          Length = 2076

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 67/82 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1091 tgacggagatcatctacctgaacaaagccttgaacttgttcaacgctgctttagtgacac 1150
            |||| |||||||| || || ||||||||| ||||| | || ||||| ||| | || || |
Sbjct: 716  tgaccgagatcatatatctcaacaaagccctgaacatctttaacgccgctctggttacgc 775

                                  
Query: 1151 caacatactacgtcttcttcac 1172
            | || |||||||||||||||||
Sbjct: 776  ccacttactacgtcttcttcac 797



to top

>emb|CT009508.6| M.truncatula DNA sequence from clone MTH2-76H16 on chromosome 3, complete
              sequence
          Length = 133910

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 2406   tcttctcttctgttctcagtta 2427
              ||||||||||||||||||||||
Sbjct: 117160 tcttctcttctgttctcagtta 117139



to top

>gb|AC027273.5| Homo sapiens BAC clone RP11-764F10 from 4, complete sequence
          Length = 201621

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 2710   tgtagatttatatcatgatgat 2731
              ||||||||||||||||||||||
Sbjct: 124993 tgtagatttatatcatgatgat 124972



to top

>emb|BX572605.1| Rhodopseudomonas palustris CGA009 complete genome; segment 13/16
          Length = 349746

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 995    gtgctgccgtcgtagcgcaggc 1016
              ||||||||||||||||||||||
Sbjct: 295074 gtgctgccgtcgtagcgcaggc 295053



to top

>dbj|AB106877.1| Xenopus laevis ap-2rep mRNA for AP-2 repressor, complete cds
          Length = 2282

 Score = 44.1 bits (22), Expect = 2.7
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 117 tccacgtgcagcccagcctcgtgcac 142
           |||||||||||||||||| |||||||
Sbjct: 968 tccacgtgcagcccagccacgtgcac 943


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 397,419,578
Number of extensions: 19708866
Number of successful extensions: 97954
Number of sequences better than 10.0: 19
Number of HSP's gapped: 97952
Number of HSP's successfully gapped: 22
Length of query: 2753
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 2730
Effective length of database: 18,503,978,556
Effective search space: 50515861457880
Effective search space used: 50515861457880
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)
to top