ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf61h05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ279927.1| Human herpesvirus 4 strain AG876, complete genome 46 0.35
2emb|V01555.2|EBV Epstein-Barr virus (EBV) genome, strain B95-8 46 0.35
3gb|AF446141.1| Aegilops tauschii LZ-NBS-LRR class RGA, NBS-LRR c... 46 0.35
4gb|AY961628.3| Human herpesvirus 4 strain GD1, complete genome 46 0.35
5emb|AJ507799.2|HHV507799 Human herpesvirus 4 complete wild type ... 46 0.35
6gb|M80517.1|HS4B958RAJ Epstein-Barr virus, artifactual joining o... 46 0.35
7gb|M10593.1|HS4ENVGP Epstein Barr virus major outer envelope gly... 46 0.35
8gb|L07923.1|HS4GP340B Epstein-Barr virus glycoprotein 340 (BLLF1... 46 0.35
9ref|XM_513768.2| PREDICTED: Pan troglodytes similar to Spx prote... 44 1.4
10gb|AC149594.2| Xenopus tropicalis chromosome CH216-62P2, complet... 44 1.4
11dbj|AK097315.1| Homo sapiens cDNA FLJ39996 fis, clone STOMA20021... 44 1.4
12emb|AL590487.20| Human DNA sequence from clone RP11-212K13 on ch... 44 1.4
13gb|AC146078.3| Pan troglodytes BAC clone RP43-45C11 from 7, comp... 42 5.5
14gb|AC108010.4| Homo sapiens BAC clone RP13-489A5 from 7, complet... 42 5.5
15gb|AC080038.5| Homo sapiens chromosome 17, clone CTD-3035K23, co... 42 5.5
16gb|AC093183.3| Homo sapiens chromosome 7 clone RP11-786I1, compl... 42 5.5
17gb|AC018636.4|AC018636 Homo sapiens chromosome 7 clone RP11-20F2... 42 5.5
18gb|AC008026.7| Homo sapiens chromosome 17, clone RP11-464D20, co... 42 5.5
19gb|AC152941.2| Ornithorhynchus anatinus chromosome UNK clone OAB... 42 5.5

>gb|DQ279927.1| Human herpesvirus 4 strain AG876, complete genome
          Length = 172764
 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 96    ctgctcttcctcgccgccacctg 118
             |||||||||||||||||||||||
Sbjct: 76435 ctgctcttcctcgccgccacctg 76457



to top

>emb|V01555.2|EBV Epstein-Barr virus (EBV) genome, strain B95-8
          Length = 172281

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 96    ctgctcttcctcgccgccacctg 118
             |||||||||||||||||||||||
Sbjct: 88589 ctgctcttcctcgccgccacctg 88611



to top

>gb|AF446141.1| Aegilops tauschii LZ-NBS-LRR class RGA, NBS-LRR class RGA, HCBT-like
             putative defense response protein, and putative alliin
             lyase genes, complete cds; and unknown genes
          Length = 106618

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 33/35 (94%), Gaps = 1/35 (2%)
 Strand = Plus / Plus

                                                
Query: 58    ggcgactagggtt-cccctcgcgccgccaccccct 91
             ||||||||||||| |||| ||||||||||||||||
Sbjct: 45305 ggcgactagggtttccccccgcgccgccaccccct 45339



to top

>gb|AY961628.3| Human herpesvirus 4 strain GD1, complete genome
          Length = 171657

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 96    ctgctcttcctcgccgccacctg 118
             |||||||||||||||||||||||
Sbjct: 76319 ctgctcttcctcgccgccacctg 76341



to top

>emb|AJ507799.2|HHV507799 Human herpesvirus 4 complete wild type genome
          Length = 171823

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 96    ctgctcttcctcgccgccacctg 118
             |||||||||||||||||||||||
Sbjct: 76301 ctgctcttcctcgccgccacctg 76323



to top

>gb|M80517.1|HS4B958RAJ Epstein-Barr virus, artifactual joining of B95-8 complete genome and
             the sequences from Raji of the large deletion found in
             B95-8
          Length = 184113

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 96    ctgctcttcctcgccgccacctg 118
             |||||||||||||||||||||||
Sbjct: 88589 ctgctcttcctcgccgccacctg 88611



to top

>gb|M10593.1|HS4ENVGP Epstein Barr virus major outer envelope glycoprotein genes gp350 and
            gp220, complete cds
          Length = 5931

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 96   ctgctcttcctcgccgccacctg 118
            |||||||||||||||||||||||
Sbjct: 4578 ctgctcttcctcgccgccacctg 4556



to top

>gb|L07923.1|HS4GP340B Epstein-Barr virus glycoprotein 340 (BLLF1) gene and BLLF2 gene,
           complete cds's; dUTPase (BLLF3) gene, 5' end
          Length = 4988

 Score = 46.1 bits (23), Expect = 0.35
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 96  ctgctcttcctcgccgccacctg 118
           |||||||||||||||||||||||
Sbjct: 938 ctgctcttcctcgccgccacctg 960



to top

>ref|XM_513768.2| PREDICTED: Pan troglodytes similar to Spx protein, transcript variant
            4 (LOC457265), mRNA
          Length = 2114

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1156 aggcgagagggaagggtccctctgcg 1181
            ||||||||||||||| ||||||||||
Sbjct: 160  aggcgagagggaaggctccctctgcg 185



to top

>gb|AC149594.2| Xenopus tropicalis chromosome CH216-62P2, complete sequence
          Length = 167602

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 404   ctgctagtgtctcgcagacggcggat 429
             ||||||||||||||||||||| ||||
Sbjct: 45134 ctgctagtgtctcgcagacggaggat 45159



to top

>dbj|AK097315.1| Homo sapiens cDNA FLJ39996 fis, clone STOMA2002166, highly similar to
            SPLICEOSOME ASSOCIATED PROTEIN 49
          Length = 2084

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 1156 aggcgagagggaagggtccctctgcg 1181
            ||||||||||||||| ||||||||||
Sbjct: 131  aggcgagagggaaggctccctctgcg 156



to top

>emb|AL590487.20| Human DNA sequence from clone RP11-212K13 on chromosome 1 Contains
            the 5' end of the SF3B4 gene for splicing factor 3b,
            subunit 4, 49kDa, the gene for cisplatin resistance
            associated (CRA) and the 3' end of the ZA20D1 gene for
            zinc finger, A20 domain containing 1, complete sequence
          Length = 93586

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 1156 aggcgagagggaagggtccctctgcg 1181
            ||||||||||||||| ||||||||||
Sbjct: 3310 aggcgagagggaaggctccctctgcg 3285



to top

>gb|AC146078.3| Pan troglodytes BAC clone RP43-45C11 from 7, complete sequence
          Length = 53091

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1337 atgtttcttttcttttgtgct 1357
            |||||||||||||||||||||
Sbjct: 6966 atgtttcttttcttttgtgct 6946



to top

>gb|AC108010.4| Homo sapiens BAC clone RP13-489A5 from 7, complete sequence
          Length = 30190

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1337  atgtttcttttcttttgtgct 1357
             |||||||||||||||||||||
Sbjct: 19129 atgtttcttttcttttgtgct 19149



to top

>gb|AC080038.5| Homo sapiens chromosome 17, clone CTD-3035K23, complete sequence
          Length = 219122

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1337   atgtttcttttcttttgtgct 1357
              |||||||||||||||||||||
Sbjct: 170707 atgtttcttttcttttgtgct 170687



to top

>gb|AC093183.3| Homo sapiens chromosome 7 clone RP11-786I1, complete sequence
          Length = 174133

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1337  atgtttcttttcttttgtgct 1357
             |||||||||||||||||||||
Sbjct: 49921 atgtttcttttcttttgtgct 49941



to top

>gb|AC018636.4|AC018636 Homo sapiens chromosome 7 clone RP11-20F2, complete sequence
          Length = 167592

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1337   atgtttcttttcttttgtgct 1357
              |||||||||||||||||||||
Sbjct: 150786 atgtttcttttcttttgtgct 150806



to top

>gb|AC008026.7| Homo sapiens chromosome 17, clone RP11-464D20, complete sequence
          Length = 220184

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1337 atgtttcttttcttttgtgct 1357
            |||||||||||||||||||||
Sbjct: 7230 atgtttcttttcttttgtgct 7210



to top

>gb|AC152941.2| Ornithorhynchus anatinus chromosome UNK clone OABb-24M14, complete
              sequence
          Length = 145914

 Score = 42.1 bits (21), Expect = 5.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1340   tttcttttcttttgtgcttgt 1360
              |||||||||||||||||||||
Sbjct: 119131 tttcttttcttttgtgcttgt 119111


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 226,645,629
Number of extensions: 12334006
Number of successful extensions: 230074
Number of sequences better than 10.0: 19
Number of HSP's gapped: 230074
Number of HSP's successfully gapped: 19
Length of query: 1456
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1433
Effective length of database: 18,503,978,556
Effective search space: 26516201270748
Effective search space used: 26516201270748
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top