| Clone Name | FLbaf51d03 |
|---|---|
| Clone Library Name | barley_pub |
>emb|CT835041.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA121F24, full insert sequence Length = 965 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 634 gatagagaaagatgcagaggaagccgaggccctaatccacaaggtt 679 ||||||| | ||||| ||| ||||||||||||||||||| |||||| Sbjct: 570 gatagaggatgatgccgagaaagccgaggccctaatccagaaggtt 615
>emb|CT837754.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA120A23, full insert sequence Length = 2014 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 634 gatagagaaagatgcagaggaagccgaggccctaatccacaaggtt 679 ||||||| | ||||| ||| ||||||||||||||||||| |||||| Sbjct: 555 gatagaggatgatgccgagaaagccgaggccctaatccagaaggtt 600
>emb|CR855170.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0818E04, complete sequence Length = 146307 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 634 gatagagaaagatgcagaggaagccgaggccctaatccacaaggtt 679 ||||||| | ||||| ||| ||||||||||||||||||| |||||| Sbjct: 101282 gatagaggatgatgccgagaaagccgaggccctaatccagaaggtt 101327
>dbj|AK242262.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J075184M03, full insert sequence Length = 3272 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Minus Query: 634 gatagagaaagatgcagaggaagccgaggccctaatccacaaggtt 679 ||||||| | ||||| ||| ||||||||||||||||||| |||||| Sbjct: 2819 gatagaggatgatgccgagaaagccgaggccctaatccagaaggtt 2774
>ref|NM_001059476.1| Oryza sativa (japonica cultivar-group) Os04g0450600 (Os04g0450600) mRNA, complete cds Length = 654 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 634 gatagagaaagatgcagaggaagccgaggccctaatccacaaggtt 679 ||||||| | ||||| ||| ||||||||||||||||||| |||||| Sbjct: 537 gatagaggatgatgccgagaaagccgaggccctaatccagaaggtt 582
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4 Length = 35498469 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 634 gatagagaaagatgcagaggaagccgaggccctaatccacaaggtt 679 ||||||| | ||||| ||| ||||||||||||||||||| |||||| Sbjct: 22423655 gatagaggatgatgccgagaaagccgaggccctaatccagaaggtt 22423700
>emb|AL606615.4|OSJN00048 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0086B14, complete sequence Length = 175698 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 634 gatagagaaagatgcagaggaagccgaggccctaatccacaaggtt 679 ||||||| | ||||| ||| ||||||||||||||||||| |||||| Sbjct: 27410 gatagaggatgatgccgagaaagccgaggccctaatccagaaggtt 27455
>gb|AC123829.2| Mus musculus BAC clone RP24-117E16 from 2, complete sequence Length = 172335 Score = 48.1 bits (24), Expect = 0.054 Identities = 24/24 (100%) Strand = Plus / Minus Query: 775 agaaaaagtgaaacaaaaggtaca 798 |||||||||||||||||||||||| Sbjct: 86846 agaaaaagtgaaacaaaaggtaca 86823
>emb|CT028522.1| Poplar cDNA sequences Length = 597 Score = 46.1 bits (23), Expect = 0.21 Identities = 23/23 (100%) Strand = Plus / Plus Query: 631 agagatagagaaagatgcagagg 653 ||||||||||||||||||||||| Sbjct: 172 agagatagagaaagatgcagagg 194
>emb|CT028521.1| Poplar cDNA sequences Length = 595 Score = 46.1 bits (23), Expect = 0.21 Identities = 23/23 (100%) Strand = Plus / Minus Query: 631 agagatagagaaagatgcagagg 653 ||||||||||||||||||||||| Sbjct: 426 agagatagagaaagatgcagagg 404
>emb|BX682558.6| Zebrafish DNA sequence from clone DKEY-225F5 in linkage group 3, complete sequence Length = 146807 Score = 46.1 bits (23), Expect = 0.21 Identities = 26/27 (96%) Strand = Plus / Minus Query: 440 gtctttggagcagtatctttttatgga 466 |||||||| |||||||||||||||||| Sbjct: 119318 gtctttggggcagtatctttttatgga 119292
>gb|AC161225.14| Mus musculus chromosome 5, clone RP23-37G13, complete sequence Length = 165525 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 377 gaattaccaggaaaatcctca 397 ||||||||||||||||||||| Sbjct: 58175 gaattaccaggaaaatcctca 58195
>gb|AC140291.2| Mus musculus BAC clone RP24-326N12 from chromosome 5, complete sequence Length = 167269 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 377 gaattaccaggaaaatcctca 397 ||||||||||||||||||||| Sbjct: 150593 gaattaccaggaaaatcctca 150613
>gb|AC147678.5| Canis Familiaris, clone XX-25C7, complete sequence Length = 171041 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 481 ggaagagaatgtggagaagac 501 ||||||||||||||||||||| Sbjct: 50834 ggaagagaatgtggagaagac 50854
>gb|AC108409.8| Mus musculus chromosome 19, clone RP23-84G7, complete sequence Length = 270854 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 477 caatggaagagaatgtggaga 497 ||||||||||||||||||||| Sbjct: 81139 caatggaagagaatgtggaga 81159
>gb|AC158361.3| Mus musculus BAC clone RP23-227A12 from chromosome 3, complete sequence Length = 211804 Score = 42.1 bits (21), Expect = 3.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 778 aaaagtgaaacaaaaggtacaggaa 802 ||||||||||||||||| ||||||| Sbjct: 52383 aaaagtgaaacaaaagggacaggaa 52407
>gb|AC093432.2| Homo sapiens chromosome 1 clone RP11-136D19, complete sequence Length = 174520 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 719 ttttcattaagtgcatctttt 739 ||||||||||||||||||||| Sbjct: 86673 ttttcattaagtgcatctttt 86653
>dbj|AK049498.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430017K04 product:unclassifiable, full insert sequence Length = 4142 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 477 caatggaagagaatgtggaga 497 ||||||||||||||||||||| Sbjct: 2983 caatggaagagaatgtggaga 2963
>gb|AC104059.5| Homo sapiens BAC clone RP13-514E23 from 4, complete sequence Length = 165223 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 769 gtttctagaaaaagtgaaaca 789 ||||||||||||||||||||| Sbjct: 135455 gtttctagaaaaagtgaaaca 135435
>emb|X61240.1|HIVTRENGE Huma Immunodeficiency Virus Isolate D205, complete genome Length = 10269 Score = 42.1 bits (21), Expect = 3.3 Identities = 30/33 (90%) Strand = Plus / Plus Query: 625 cgcagaagagatagagaaagatgcagaggaagc 657 ||||||||||| || ||||||| |||||||||| Sbjct: 1345 cgcagaagagaaagtgaaagatacagaggaagc 1377
>gb|AC173113.4| Mus musculus BAC clone RP23-120D6 from chromosome 3, complete sequence Length = 172004 Score = 42.1 bits (21), Expect = 3.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 778 aaaagtgaaacaaaaggtacaggaa 802 ||||||||||||||||| ||||||| Sbjct: 150711 aaaagtgaaacaaaagggacaggaa 150735
>emb|AL953893.17| Zebrafish DNA sequence from clone DKEY-60B12, complete sequence Length = 216749 Score = 42.1 bits (21), Expect = 3.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 770 tttctagaaaaagtgaaacaa 790 ||||||||||||||||||||| Sbjct: 25492 tttctagaaaaagtgaaacaa 25472 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 168,484,370 Number of extensions: 8705510 Number of successful extensions: 173247 Number of sequences better than 10.0: 22 Number of HSP's gapped: 173247 Number of HSP's successfully gapped: 22 Length of query: 884 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 862 Effective length of database: 18,508,616,841 Effective search space: 15954427716942 Effective search space used: 15954427716942 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)