ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf59g22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds 1235 0.0
2gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA... 1035 0.0
3gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, par... 567 e-158
4ref|NM_001055824.1| Oryza sativa (japonica cultivar-group) Os03g... 460 e-126
5dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds 460 e-126
6dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clon... 460 e-126
7dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clon... 460 e-126
8emb|CT830348.1| Oryza sativa (indica cultivar-group) cDNA clone:... 452 e-123
9ref|NM_001073163.1| Oryza sativa (japonica cultivar-group) Os12g... 446 e-122
10ref|NM_001053113.1| Oryza sativa (japonica cultivar-group) Os02g... 446 e-122
11dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clon... 438 e-119
12dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clon... 438 e-119
13dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 438 e-119
14gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal p... 408 e-110
15dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clon... 406 e-110
16emb|CT834479.1| Oryza sativa (indica cultivar-group) cDNA clone:... 394 e-106
17gb|BT016390.1| Zea mays clone Contig223 mRNA sequence 381 e-102
18gb|AY109383.1| Zea mays CL7224_1 mRNA sequence 280 1e-71
19gb|AF117889.1|AF117889 Avena fatua 40S ribosomal protein S3A mRN... 252 2e-63
20gb|EF065683.1| Cymbidium hybrid cultivar RPS3 mRNA, complete cds 206 1e-49
21emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal prot... 190 7e-45
22gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence 172 2e-39
23gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, part... 159 3e-35
24gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 149 2e-32
25ref|NM_119633.2| Arabidopsis thaliana structural constituent of ... 147 1e-31
26gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ri... 147 1e-31
27emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Co... 147 1e-31
28gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ri... 145 4e-31
29gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare... 141 6e-30
30gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare str... 141 6e-30
31dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 141 6e-30
32dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 141 6e-30
33emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa... 141 6e-30
34gb|DQ531623.1| Musa acuminata clone 3-169 ribosomal S3a mRNA, pa... 139 2e-29
35dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 139 2e-29
36dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic D... 139 2e-29
37dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic D... 139 2e-29
38emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-spe... 139 2e-29
39gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds 137 9e-29
40emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Co... 137 9e-29
41emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene 131 6e-27
42gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein... 131 6e-27
43gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, c... 131 6e-27
44gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA... 131 6e-27
45gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRN... 123 1e-24
46dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds 119 2e-23
47gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal prot... 117 9e-23
48gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BA... 113 1e-21
49gb|DQ159867.1| Cymbidium faberi clone CDD-470 40s ribosomal prot... 113 1e-21
50gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones B... 111 5e-21
51gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA,... 105 3e-19
52emb|CT985361.1| partial cDNA sequence from a Lambda ZAP II norma... 100 2e-17
53emb|CT982739.1| partial cDNA sequence from a Lambda ZAP II norma... 100 2e-17
54gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein... 94 1e-15
55gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein... 94 1e-15
56gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, c... 94 1e-15
57emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, ... 92 5e-15
58emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, ... 92 5e-15
59emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BA... 92 5e-15
60gb|AC189529.1| Brassica rapa subsp. pekinensis clone KBrB092P05,... 86 3e-13
61emb|Z18417.1|ATTS0792 Arabidopsis thaliana transcribed sequence;... 84 1e-12
62dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS... 84 1e-12
63gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete s... 82 5e-12
64gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete seq... 82 5e-12
65dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-p... 78 7e-11
66gb|L31645.1|HNNSPSP Helianthus annuus ribosomal protein S3a mRNA... 76 3e-10
67gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal prot... 76 3e-10
68ref|XM_001177407.1| PREDICTED: Strongylocentrotus purpuratus sim... 74 1e-09
69ref|XM_001177536.1| PREDICTED: Strongylocentrotus purpuratus sim... 74 1e-09
70ref|XM_001179472.1| PREDICTED: Strongylocentrotus purpuratus sim... 74 1e-09
71ref|XM_796644.2| PREDICTED: Strongylocentrotus purpuratus simila... 74 1e-09
72ref|XM_774945.2| PREDICTED: Strongylocentrotus purpuratus simila... 74 1e-09
73ref|XM_785062.2| PREDICTED: Strongylocentrotus purpuratus simila... 74 1e-09
74ref|NM_111356.3| Arabidopsis thaliana structural constituent of ... 72 5e-09
75gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal prote... 72 5e-09
76gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal prote... 72 5e-09
77gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete s... 72 5e-09
78emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Co... 72 5e-09
79dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds 72 5e-09
80gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence 68 7e-08
81ref|XM_568980.1| Cryptococcus neoformans var. neoformans JEC21 4... 64 1e-06
82emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Co... 62 4e-06
83ref|XM_001233016.1| PREDICTED: Gallus gallus ribosomal protein S... 60 2e-05
84ref|XM_420443.2| PREDICTED: Gallus gallus ribosomal protein S3A,... 60 2e-05
85ref|XM_001232989.1| PREDICTED: Gallus gallus ribosomal protein S... 60 2e-05
86emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical prot... 60 2e-05
87gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRN... 60 2e-05
88ref|XM_001218105.1| Aspergillus terreus NIH2624 40S ribosomal pr... 58 7e-05
89gb|AY373965.1| Hyaloperonospora parasitica clone 72T-2G4 mRNA se... 58 7e-05
90gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds 58 7e-05
91dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, ... 56 3e-04
92gb|AC189329.1| Brassica rapa subsp. pekinensis clone KBrB037C07,... 54 0.001
93ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 0.001
94ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 0.001
95ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 0.001
96ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 0.001
97ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosoma... 54 0.001
98emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chr... 54 0.001
99gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 0.001
100gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosom... 54 0.001
101gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosom... 54 0.001
102gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, compl... 54 0.001
103gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 0.001
104gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 0.001
105ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 0.001
106ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 0.001
107ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 0.001
108ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal prot... 54 0.001
109ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 0.001
110ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 0.001
111ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 0.001
112ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 0.001
113ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 54 0.001
114gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 0.001
115dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 54 0.001
116dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct i... 54 0.001
117dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 0.001
118dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 0.001
119dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 0.001
120dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RI... 54 0.001
121dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 0.001
122dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 0.001
123dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 54 0.001
124dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 54 0.001
125dbj|AK167562.1| Mus musculus 11 days pregnant adult female place... 54 0.001
126dbj|AK167512.1| Mus musculus 11 days pregnant adult female place... 54 0.001
127dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 54 0.001
128dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 54 0.001
129dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length en... 54 0.001
130ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRN... 54 0.001
131dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells ... 54 0.001
132dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells ... 54 0.001
133dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIK... 54 0.001
134emb|Z83368.1|MMRPS3A M.musculus RPS3a gene 54 0.001
135gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA cl... 54 0.001
136gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, com... 54 0.001
137dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minu... 54 0.001
138emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chro... 54 0.001
139ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
140ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
141ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
142ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
143ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
144ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
145ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
146ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
147ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
148ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
149ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
150ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S... 52 0.004
151ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
152ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
153ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
154ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
155ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
156ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
157ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
158ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
159ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
160ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
161ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
162ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
163ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
164ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
165ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
166ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
167ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
168ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
169ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosoma... 52 0.004
170gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J... 52 0.004
171emb|X68555.1|ACKRPA A.californica KRP-A gene 52 0.004
172gb|AY850276.1| Periplaneta americana Parcxpwex01 mRNA, complete cds 52 0.004
173ref|XM_370422.1| Magnaporthe grisea 70-15 chromosome II hypothet... 50 0.017
174gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cD... 50 0.017
175gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like pro... 50 0.017
176gb|AY849647.1| Magnaporthe grisea 40S ribosomal protein S1-like ... 50 0.017
177ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a)... 50 0.017
178gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal ... 48 0.067
179gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal ... 48 0.067
180gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal ... 48 0.067
181ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.067
182ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.067
183ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.067
184ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.067
185ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.067
186ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.067
187ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 48 0.067
188ref|XM_001135906.1| PREDICTED: Pan troglodytes hypothetical prot... 46 0.26
189ref|XM_526720.2| PREDICTED: Pan troglodytes similar to ribosomal... 46 0.26
190ref|XM_001152942.1| PREDICTED: Pan troglodytes similar to v-fos ... 46 0.26
191ref|XM_001152885.1| PREDICTED: Pan troglodytes similar to v-fos ... 46 0.26
192ref|XM_001153182.1| PREDICTED: Pan troglodytes similar to v-fos ... 46 0.26
193ref|XM_001153073.1| PREDICTED: Pan troglodytes similar to v-fos ... 46 0.26
194ref|XM_001153128.1| PREDICTED: Pan troglodytes similar to v-fos ... 46 0.26
195ref|XM_940167.2| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.26
196ref|XM_927103.2| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.26
197ref|XR_001449.2| PREDICTED: Homo sapiens similar to 40S ribosoma... 46 0.26
198gb|BC036712.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
199gb|BC007607.1| Homo sapiens cDNA clone IMAGE:3351222, **** WARNI... 46 0.26
200ref|XR_013969.1| PREDICTED: Macaca mulatta similar to ribosomal ... 46 0.26
201ref|XR_011647.1| PREDICTED: Macaca mulatta similar to ribosomal ... 46 0.26
202ref|XR_013290.1| PREDICTED: Macaca mulatta similar to 40S riboso... 46 0.26
203ref|XM_001093267.1| PREDICTED: Macaca mulatta similar to 40S rib... 46 0.26
204ref|XR_013279.1| PREDICTED: Macaca mulatta similar to 40S riboso... 46 0.26
205ref|XM_001099771.1| PREDICTED: Macaca mulatta similar to ribosom... 46 0.26
206ref|XR_003814.1| PREDICTED: Mus musculus similar to 40S ribosoma... 46 0.26
207gb|BC094829.1| Homo sapiens cDNA clone IMAGE:4647813, **** WARNI... 46 0.26
208gb|BC099924.1| Homo sapiens cDNA clone IMAGE:6371780, **** WARNI... 46 0.26
209gb|BC045105.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
210gb|BC023666.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
211gb|BC011660.1| Homo sapiens cDNA clone IMAGE:4120690, **** WARNI... 46 0.26
212gb|BC021075.1| Homo sapiens cDNA clone IMAGE:3530401, **** WARNI... 46 0.26
213ref|XM_844705.1| PREDICTED: Canis familiaris similar to 40S ribo... 46 0.26
214gb|AC093799.2| Homo sapiens BAC clone RP11-307C18 from 7, comple... 46 0.26
215gb|BC102789.1| Bos taurus ribosomal protein S3A, mRNA (cDNA clon... 46 0.26
216gb|BC004981.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
217dbj|AB169748.1| Macaca fascicularis brain cDNA, clone: QnpA-1570... 46 0.26
218gb|AC095055.3| Homo sapiens BAC clone RP11-372K14 from 4, comple... 46 0.26
219gb|AC090771.4| Homo sapiens chromosome 18, clone RP11-795H16, co... 46 0.26
220emb|BX039677.1|CNS092S1 Single read from an extremity of a full-... 46 0.26
221gb|AC090621.10| Homo sapiens chromosome 18, clone RP11-396N11, c... 46 0.26
222gb|AC146532.3| Otolemur garnettii clone CH256-151F13, complete s... 46 0.26
223emb|CR860858.1| Pongo pygmaeus mRNA; cDNA DKFZp469E172 (from clo... 46 0.26
224dbj|AK129825.1| Homo sapiens cDNA FLJ26315 fis, clone DMC09112, ... 46 0.26
225ref|NM_001034038.1| Bos taurus ribosomal protein S3A (RPS3A), mR... 46 0.26
226ref|NM_001006.3| Homo sapiens ribosomal protein S3A (RPS3A), mRNA 46 0.26
227gb|BC001708.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
228gb|BC071916.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
229gb|BC017123.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
230gb|BC030161.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
231gb|BC019072.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
232gb|BC000204.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
233gb|BC009219.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
234gb|BC009404.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
235gb|AC004841.2|AC004841 Homo sapiens PAC clone RP4-607J23 from 7q... 46 0.26
236dbj|AB099017.1| Bos taurus mRNA for similar to ribosomal protein... 46 0.26
237emb|Z83334.1|HSZ83334 H.sapiens RPS3a gene 46 0.26
238gb|BC070211.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
239gb|BC018954.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
240gb|BC006298.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA cl... 46 0.26
241gb|AC129329.3| Mus musculus BAC clone RP23-43M12 from 10, comple... 46 0.26
242emb|AL845262.3| Mouse DNA sequence from clone RP23-14N22 on chro... 46 0.26
243emb|X87373.1|HSRPS3AGE Homo sapiens RPS3a gene for ribosomal pro... 46 0.26
244gb|M84711.1|HUMFTE1A Human v-fos transformation effector protein... 46 0.26
245gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation... 46 0.26
246gb|L13802.1|HUMCH13C3A Homo sapiens (clone 03) liver expessed ri... 46 0.26
247emb|CT029277.1| Poplar cDNA sequences 44 1.0
248ref|XM_868916.1| PREDICTED: Bos taurus similar to 40S ribosomal ... 44 1.0
249ref|XM_855573.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
250ref|XM_844989.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
251ref|XM_855510.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
252ref|XM_855476.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
253ref|XM_851147.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
254ref|XM_851102.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
255ref|XM_851056.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
256ref|XM_843347.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
257ref|XM_843648.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
258ref|XM_535614.2| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
259ref|XM_534831.2| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
260ref|XM_859165.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
261ref|XM_859142.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
262ref|XM_534259.2| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
263ref|XM_846199.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
264ref|XM_855284.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
265ref|XM_855250.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
266ref|XM_855221.1| PREDICTED: Canis familiaris similar to ribosoma... 44 1.0
267emb|BX546465.7| Mouse DNA sequence from clone RP23-167N13 on chr... 44 1.0
268ref|XM_001217685.1| Aspergillus terreus NIH2624 predicted protei... 42 4.1
269ref|XR_023176.1| PREDICTED: Pan troglodytes similar to v-fos tra... 42 4.1
270ref|XR_018891.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 42 4.1
271ref|XR_017289.1| PREDICTED: Homo sapiens similar to 40S ribosoma... 42 4.1
272gb|AE014297.2| Drosophila melanogaster chromosome 3R, complete s... 42 4.1
273ref|XM_392119.3| PREDICTED: Apis mellifera similar to Phosphatid... 42 4.1
274gb|AC114663.8| Mus musculus chromosome 1, clone RP24-172O22, com... 42 4.1
275gb|AC158967.5| Mus musculus chromosome 1, clone RP23-39N17, comp... 42 4.1
276gb|AY596294.1| Haloarcula marismortui ATCC 43049 plasmid pNG500,... 42 4.1
277gb|AC163338.5| Mus musculus BAC clone RP24-574A13 from chromosom... 42 4.1
278ref|XM_677047.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 4.1
279ref|NM_206456.1| Drosophila melanogaster rotund CG32466-RB, tran... 42 4.1
280gb|BC047260.1| Xenopus laevis ribosomal protein S3a, mRNA (cDNA ... 42 4.1
281ref|NM_141458.2| Drosophila melanogaster rotund CG32466-RA, tran... 42 4.1
282gb|BT022161.1| Drosophila melanogaster IP01358 full insert cDNA 42 4.1
283gb|AC164426.5| Mus musculus BAC clone RP24-320I19 from chromosom... 42 4.1
284ref|XM_458876.1| Debaryomyces hansenii CBS767 hypothetical prote... 42 4.1
285dbj|AK220818.1| Arabidopsis thaliana mRNA for 40S ribosomal prot... 42 4.1
286ref|NM_065509.3| Caenorhabditis elegans Ribosomal Protein, Small... 42 4.1
287ref|XM_748992.1| Aspergillus fumigatus Af293 ribosomal protein S... 42 4.1
288emb|Z32681.1|CEF56F3 Caenorhabditis elegans Cosmid F56F3, comple... 42 4.1
289gb|AF395905.1|AF395905 Drosophila melanogaster rotund mRNA, comp... 42 4.1
290gb|AF395904.1|AF395904 Drosophila melanogaster roughened eye mRN... 42 4.1
291emb|BX067685.1|CNS09OE1 Single read from an extremity of a full-... 42 4.1
292gb|AE016816.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 42 4.1
293gb|AC160763.3| Mus musculus BAC clone RP23-238A4 from chromosome... 42 4.1
294gb|AC020898.6| Homo sapiens chromosome 5 clone CTC-451P13, compl... 42 4.1
295gb|DQ066297.1| Ixodes scapularis isolate is-all-378 40S ribosoma... 42 4.1
296gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 4.1
297emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 42 4.1
298emb|CR380953.1| Candida glabrata strain CBS138 chromosome G comp... 42 4.1
299gb|AF379639.1|AF379639 Heliothis virescens ribosomal protein S3a... 42 4.1
300gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, r... 42 4.1
301gb|AC154561.2| Mus musculus BAC clone RP23-400M17 from chromosom... 42 4.1
302gb|AF429977.1| Spodoptera frugiperda ribosomal protein S3A mRNA,... 42 4.1
303gb|AF056328.1|AF056328 Oryzias latipes V-Fos transformation effe... 42 4.1
304ref|XM_446571.1| Candida glabrata CBS138, CAGL0G04851g partial mRNA 42 4.1
305ref|NM_209036.1| Eremothecium gossypii ACR281Cp (ACR281C), mRNA 42 4.1
306ref|NM_001008074.1| Xenopus tropicalis rps3a protein (rps3a), mR... 42 4.1
307emb|CR760859.2| Xenopus tropicalis finished cDNA, clone TTpA010n05 42 4.1
308gb|AC113456.9| Mus musculus chromosome 1, clone RP23-257E16, com... 42 4.1
309gb|M77234.1|HUMRPSA3A Human ribosomal protein S3a mRNA, complete... 42 4.1

>gb|AF542188.1| Triticum aestivum cyc07 mRNA, complete cds
          Length = 820
 Score = 1235 bits (623), Expect = 0.0
 Identities = 744/780 (95%), Gaps = 5/780 (0%)
 Strand = Plus / Plus

                                                                       
Query: 46  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 31  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 90

                                                                       
Query: 106 atctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaagaagcag 165
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 91  atctccaaggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagcag 150

                                                                       
Query: 166 tggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgtg 225
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 151 tggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgtg 210

                                                                       
Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285
           |||||||| |||||||||||||||||||||||||| ||||||||| ||||||| ||||||
Sbjct: 211 tccaggacgcagggtaccaagattgcctcagagggtctgaagcacagggtgttcgaagta 270

                                                                       
Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 271 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 330

                                                                       
Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 331 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactgac 390

                                                                       
Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
           |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||
Sbjct: 391 aagctcaggtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaag 450

                                                                       
Query: 466 accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525
           ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 451 accactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaac 510

                                                                       
Query: 526 caggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatg 585
           ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 511 caggtgaagcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatg 570

                                                                       
Query: 586 gttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaacaagttc 645
           |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 571 gttgagatcatggtcaaccaagctgcaagctgtgacttaaangagcttgtgaacaagttc 630

                                                                       
Query: 646 atccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttcccgctccag 705
           |||||||||||||||||||||||||||||||| ||||||||| ||||||| || || |||
Sbjct: 631 atccctgaggtgattggaaaggagattgagaangccacctcaggcatcttncccctncag 690

                                                                       
Query: 706 aacgtgtacgtccgcaaggtgaaga-tcctgaaggccccgaagttt-gacctgggaaagc 763
           ||||||||||| ||||||||||||| ||||||||||||| ||||||  ||||||| ||||
Sbjct: 691 aacgtgtacgtncgcaaggtgaagattcctgaaggcccccaagtttcnacctggggaagc 750

                                                                       
Query: 764 -tcatggaggtgcacggtgactacaa-ggaggatgttggtg-tgaagcttgacaggcctg 820
            |||| ||||| ||||| |||||||| |||||||||||||| | || |||||||||||||
Sbjct: 751 ttcatngaggttcacggggactacaanggaggatgttggtgttaaaccttgacaggcctg 810



to top

>gb|AY290725.1| Triticum aestivum ribosomal protein S3a-like mRNA, partial sequence
          Length = 885

 Score = 1035 bits (522), Expect = 0.0
 Identities = 622/655 (94%), Gaps = 3/655 (0%)
 Strand = Plus / Plus

                                                                       
Query: 46  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 32  cgccgcagcgccgccactccacccgcagcggcaaccatggcggtcggcaagaacaagcgc 91

                                                                       
Query: 106 atctccaagggg-aggaagggtagcaagaagaaggccgtggatccgttcaccaagaagca 164
           |||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||
Sbjct: 92  atctccaagggggaggaagggaagcaagaagaaggccgtcgatccgttcaccaagaagca 151

                                                                       
Query: 165 gtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccctcgt 224
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 152 gtggtatgacatcaaggcgccgctgctgttcaccagccgcaacgtcggcaagaccctcgt 211

                                                                       
Query: 225 gtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagt 284
           ||||||||| |||||||||||||||| ||||||||| |||||||||  |||||| |||||
Sbjct: 212 gtccaggacgcagggtaccaagattgnctcagagggtctgaagcacanggtgttcgaagt 271

                                                                       
Query: 285 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 344
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 272 atctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgc 331

                                                                       
Query: 345 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactga 404
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 332 tgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggacttcaccactga 391

                                                                       
Query: 405 caagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaa 464
           |||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 392 caagctcaagtctcttgtgaggaagtggcagacactcattgaggctcatgtggatgtgaa 451

                                                                       
Query: 465 gaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaa 524
           |||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 452 gaccactgacaactacatgctccgcatgttcgccattggcttcaccaagagacgcccaaa 511

                                                                       
Query: 525 ccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagat 584
           |||||| ||||||||||||||||| ||||| ||||||||||||||||||||||| |||||
Sbjct: 512 ccaggtgaagcgcacttgctatgcccaagcnagtcagatcagacagatccgccgcaagat 571

                                                                       
Query: 585 ggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaacaagtt 644
           || ||||||  |||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 572 ggntgagatattggtcaaccaagctgcaagctgtgacttaaaggagcttgtgaacaagtt 631

                                                                  
Query: 645 cat-ccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttccc 698
           ||| ||||||||||||| ||||||| ||||| | || ||||| | |||| |||||
Sbjct: 632 catcccctgaggtgattngaaagganattganangg-cacctnangcatnttccc 685



to top

>gb|AF479043.1| Triticum aestivum 40S ribosomal protein mRNA, partial cds
          Length = 342

 Score =  567 bits (286), Expect = e-158
 Identities = 327/340 (96%), Gaps = 3/340 (0%)
 Strand = Plus / Plus

                                                                       
Query: 534 gcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagat 593
           ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 3   gcgcacttgctatgcccaagcaagtcagatcagacagatccgccgcaagatggttgagat 62

                                                                       
Query: 594 catggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaacaagttcatccctga 653
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 63  catggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaacaagttcatccctga 122

                                                                       
Query: 654 ggtgattggaaaggagattgagaaggccacctcaagcatcttcccgctccagaacgtgta 713
           |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 123 ggtgatcggaaaggagattgagaaggccacctcaagcatcttccccctccagaacgtgta 182

                                                                       
Query: 714 cgtccgcaaggtgaagatcctgaaggccccgaagtttgacctgggaaagctcatggaggt 773
           |||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||
Sbjct: 183 cgtccgcaaggtgaagatcctgaaggcccccaagttcgacctggggaagctcatggaggt 242

                                                                       
Query: 774 gcacggtgactacaaggaggatgttggtgtgaagcttgacaggc---ctgatggagatga 830
            |||||||||||||||||||||||||||||||||||||||||||   ||||||| || ||
Sbjct: 243 tcacggtgactacaaggaggatgttggtgtgaagcttgacaggcctgctgatggggacga 302

                                                   
Query: 831 ggtcattcctggtgcggaggaggttgctgctgctgagtag 870
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 303 ggtcattcctggtgcggaggaggttgctgctgctgagtag 342



to top

>ref|NM_001055824.1| Oryza sativa (japonica cultivar-group) Os03g0200500 (Os03g0200500)
           mRNA, complete cds
          Length = 1093

 Score =  460 bits (232), Expect = e-126
 Identities = 595/716 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 57  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 116

                                                                       
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 117 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 176

                                                                       
Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 177 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 236

                                                                       
Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 237 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 296

                                                                       
Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 297 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 356

                                                                       
Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 357 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 416

                                                                       
Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 417 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 476

                                                                       
Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 477 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 536

                                                                       
Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagct 609
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| |||||| |||
Sbjct: 537 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaaccaggct 596

                                                                       
Query: 610 gcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggag 669
            |||||||||| ||||| ||||| ||    |||||||| ||||| || ||||| ||||| 
Sbjct: 597 tcaagctgtgatttgaaagagctagtttcaaagttcattcctgaagttattgggaaggaa 656

                                                                       
Query: 670 attgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaag 729
           ||||||||||| || || || || ||||| || ||||| ||||  |||||||| ||||||
Sbjct: 657 attgagaaggcgacatccagtattttcccccttcagaatgtgtttgtccgcaaagtgaag 716

                                                                   
Query: 730 atcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgacta 785
           || || ||||||||||| ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 717 attctaaaggccccgaaatttgacctggggaagctcatggaggtgcatggtgacta 772



to top

>dbj|D26060.1|RICT151 Oryza sativa mRNA for cyc07, complete cds
          Length = 1065

 Score =  460 bits (232), Expect = e-126
 Identities = 595/716 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 84  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 143

                                                                       
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 144 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 203

                                                                       
Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 204 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 263

                                                                       
Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 264 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 323

                                                                       
Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 324 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 383

                                                                       
Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 384 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 443

                                                                       
Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 444 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 503

                                                                       
Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 504 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 563

                                                                       
Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagct 609
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| |||||| |||
Sbjct: 564 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaaccaggct 623

                                                                       
Query: 610 gcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggag 669
            |||||||||| ||||| ||||| ||    |||||||| ||||| || ||||| ||||| 
Sbjct: 624 tcaagctgtgatttgaaagagctagtttcaaagttcattcctgaagttattgggaaggaa 683

                                                                       
Query: 670 attgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaag 729
           ||||||||||| || || || || ||||| || ||||| ||||  |||||||| ||||||
Sbjct: 684 attgagaaggcgacatccagtattttcccccttcagaatgtgtttgtccgcaaagtgaag 743

                                                                   
Query: 730 atcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgacta 785
           || || ||||||||||| ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 744 attctaaaggccccgaaatttgacctggggaagctcatggaggtgcatggtgacta 799



to top

>dbj|AK104243.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-D02, full
           insert sequence
          Length = 1032

 Score =  460 bits (232), Expect = e-126
 Identities = 595/716 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 60  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 119

                                                                       
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 120 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 179

                                                                       
Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 180 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 239

                                                                       
Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 240 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 299

                                                                       
Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 300 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 359

                                                                       
Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 360 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 419

                                                                       
Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 420 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 479

                                                                       
Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 480 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 539

                                                                       
Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagct 609
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| |||||| |||
Sbjct: 540 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaaccaggct 599

                                                                       
Query: 610 gcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggag 669
            |||||||||| ||||| ||||| ||    |||||||| ||||| || ||||| ||||| 
Sbjct: 600 tcaagctgtgatttgaaagagctagtttcaaagttcattcctgaagttattgggaaggaa 659

                                                                       
Query: 670 attgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaag 729
           ||||||||||| || || || || ||||| || ||||| ||||  |||||||| ||||||
Sbjct: 660 attgagaaggcgacatccagtattttcccccttcagaatgtgtttgtccgcaaagtgaag 719

                                                                   
Query: 730 atcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgacta 785
           || || ||||||||||| ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 720 attctaaaggccccgaaatttgacctggggaagctcatggaggtgcatggtgacta 775



to top

>dbj|AK069251.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023013H23, full
           insert sequence
          Length = 1097

 Score =  460 bits (232), Expect = e-126
 Identities = 595/716 (83%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 61  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 120

                                                                       
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 121 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 180

                                                                       
Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 181 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 240

                                                                       
Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 241 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 300

                                                                       
Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 301 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 360

                                                                       
Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 361 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 420

                                                                       
Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 421 tggcagacactgattgaggctcatgtggatgtcaaaaccacagacggctacatgctgcgt 480

                                                                       
Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 481 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 540

                                                                       
Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagct 609
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| |||||| |||
Sbjct: 541 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaaccaggct 600

                                                                       
Query: 610 gcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggag 669
            |||||||||| ||||| ||||| ||    |||||||| ||||| || ||||| ||||| 
Sbjct: 601 tcaagctgtgatttgaaagagctagtttcaaagttcattcctgaagttattgggaaggaa 660

                                                                       
Query: 670 attgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaag 729
           ||||||||||| || || || || ||||| || ||||| ||||  |||||||| ||||||
Sbjct: 661 attgagaaggcgacatccagtattttcccccttcagaatgtgtttgtccgcaaagtgaag 720

                                                                   
Query: 730 atcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgacta 785
           || || ||||||||||| ||||||||||| ||||||||||||||||| ||||||||
Sbjct: 721 attctaaaggccccgaaatttgacctggggaagctcatggaggtgcatggtgacta 776



to top

>emb|CT830348.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA120K23, full
           insert sequence
          Length = 1032

 Score =  452 bits (228), Expect = e-123
 Identities = 594/716 (82%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 60  gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 119

                                                                       
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 120 aagaagaagaccgtcgatccctttgctaagaaggactggtatgatatcaaggccccgtcg 179

                                                                       
Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249
            | ||||     || ||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 180 gtgttcaatgtgcggaacatcggcaagaccctcgtgtccaggacacagggtacaaagatt 239

                                                                       
Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309
           || || |||||||| |||||  | |||||||| || ||  |||||||||| |||||||||
Sbjct: 240 gcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccagaacgat 299

                                                                       
Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369
           ||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||| || 
Sbjct: 300 gaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaagaacgtg 359

                                                                       
Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429
           ||||| ||||| |||||||||   || || || || |||||||| || ||||| | ||||
Sbjct: 360 ctcaccaacttttggggcatgtcgtttactaccgataagctcagatcacttgttaagaag 419

                                                                       
Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489
           |||||||| || |||||||||||||| ||||| || ||||| |||   |||||||| || 
Sbjct: 420 tggcagacactgattgaggctcatgtggatgtcaaaaccacggacggctacatgctgcgt 479

                                                                       
Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549
            ||||    || |||||||||||| | || || |||||||| ||| | ||||||||||||
Sbjct: 480 ctgttctgtatcggcttcaccaagcggcggcctaaccaggtgaagaggacttgctatgct 539

                                                                       
Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagct 609
           ||||| ||||||||||||||||| || || ||||||||||| ||||||| |||||| |||
Sbjct: 540 caagcgagtcagatcagacagattcgtcgcaagatggttgaaatcatggccaaccaggct 599

                                                                       
Query: 610 gcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggag 669
            |||||||||| ||||| ||||| ||    |||||||| ||||| || ||||| ||||| 
Sbjct: 600 tcaagctgtgatttgaaagagctagtttcaaagttcattcctgaagttattgggaaggaa 659

                                                                       
Query: 670 attgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaag 729
           ||||||||||| || || || || ||||| || ||||| ||||  |||||||| ||||||
Sbjct: 660 attgagaaggcgacatccagtattttcccccttcagaatgtgtttgtccgcaaagtgaag 719

                                                                   
Query: 730 atcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgacta 785
           || || ||||||||||| || |||||||| ||||||||||||||||| ||||||||
Sbjct: 720 attctaaaggccccgaaattcgacctggggaagctcatggaggtgcatggtgacta 775



to top

>ref|NM_001073163.1| Oryza sativa (japonica cultivar-group) Os12g0406200 (Os12g0406200)
           mRNA, complete cds
          Length = 1118

 Score =  446 bits (225), Expect = e-122
 Identities = 630/765 (82%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 91  gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 150

                                                                       
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 151 aagaagaagaccgtcgatccttttgcgaagaaggattggtatgatatcaaggccccgtcg 210

                                                                       
Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249
            | |||| |    | |||||||| ||||| |||||||||||||||||||| || ||||||
Sbjct: 211 gtgttcaacgtgagaaacgtcgggaagacgctcgtgtccaggacacagggcacaaagatt 270

                                                                       
Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309
           || ||||||||||| |||||||| |||||||| || ||  | ||||||||||||||||||
Sbjct: 271 gcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcagaacgat 330

                                                                       
Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369
           ||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  ||||| 
Sbjct: 331 gaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaaatgtt 390

                                                                       
Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429
           || ||||||||||||||||||  |||||| || ||||||||||| ||  | || | ||| 
Sbjct: 391 cttacaaacttctggggcatgagtttcacgaccgacaagctcagatcattggtcaagaaa 450

                                                                       
Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489
           |||||||| || || ||||||||||| ||||| ||||||||||| || |||||||| || 
Sbjct: 451 tggcagacgctaatagaggctcatgtggatgtaaagaccactgataactacatgctgcgt 510

                                                                       
Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549
            | ||   ||||||||||||||||||  | ||||| || ||||| || || |||||||||
Sbjct: 511 ctcttctgcattggcttcaccaagaggaggccaaatcaagtcaaacggacatgctatgct 570

                                                                       
Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagct 609
           |||||||| |||||  |||||||||| || |||||||| ||||||||||| ||||| || 
Sbjct: 571 caagcaagccagattcgacagatccgtcgcaagatggtggagatcatggtgaaccaggca 630

                                                                       
Query: 610 gcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggag 669
            ||  ||||||  | |||||||| |||   || ||||| |||||||||||||| ||||| 
Sbjct: 631 tcatcctgtgatctcaaggagctggtgtcaaaattcattcctgaggtgattgggaaggaa 690

                                                                       
Query: 670 attgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaag 729
           || ||||||||||| ||||||||||||||||| ||||| ||||  || ||||| || |||
Sbjct: 691 atcgagaaggccacatcaagcatcttcccgcttcagaatgtgtttgtgcgcaaagtcaag 750

                                                                       
Query: 730 atcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaag 789
           ||||| |||||||| || ||||||||||| ||||| |||||||| || || || ||||||
Sbjct: 751 atcctcaaggccccaaaatttgacctgggcaagcttatggaggttcatggagattacaag 810

                                                        
Query: 790 gaggatgttggtgtgaagcttgacaggcctgatggagatgaggtc 834
           ||||| |||||   |||||| || |||||||  | ||||||||||
Sbjct: 811 gaggacgttgggacgaagctcgagaggcctgcagaagatgaggtc 855



to top

>ref|NM_001053113.1| Oryza sativa (japonica cultivar-group) Os02g0287000 (Os02g0287000)
           mRNA, complete cds
          Length = 1171

 Score =  446 bits (225), Expect = e-122
 Identities = 612/741 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 70  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129

                                                                       
Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189

                                                                       
Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249

                                                                       
Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309

                                                                       
Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369

                                                                       
Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429

                                                                       
Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489

                                                                       
Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549

                                                                       
Query: 560 agatcagacagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtg 619
           ||||| | ||||||||||||||||||||||||||||||| |||||| ||  |||  ||||
Sbjct: 550 agatccggcagatccgccggaagatggttgagatcatggccaaccaggcatcaacatgtg 609

                                                                       
Query: 620 acttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaagg 679
           ||||||| || || ||    || ||||||||||| || |||||||||||||| |||||| 
Sbjct: 610 acttgaaagaactggtttcaaaattcatccctgaagtcattggaaaggagatcgagaagt 669

                                                                       
Query: 680 ccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaagg 739
           | || ||||| || ||||| ||||| || |||| | ||||||||||||||||| ||||||
Sbjct: 670 caacttcaagtatattccctctccaaaatgtgttcatccgcaaggtgaagatcttgaagg 729

                                                                       
Query: 740 ccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgttg 799
           | ||||||||||| || || ||| | |||||||| ||||||||||||||||| ||||| |
Sbjct: 730 caccgaagtttgatcttgggaagttgatggaggtacacggtgactacaaggaagatgtcg 789

                                
Query: 800 gtgtgaagcttgacaggcctg 820
           || ||||||| ||||||||||
Sbjct: 790 gtatgaagctggacaggcctg 810



to top

>dbj|AK104699.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-C03, full
           insert sequence
          Length = 942

 Score =  438 bits (221), Expect = e-119
 Identities = 569/685 (83%)
 Strand = Plus / Plus

                                                                       
Query: 101 agcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcaccaaga 160
           |||||||||||||||||| ||||||   |||||||||| |||| ||||| ||  | ||||
Sbjct: 1   agcgcatctccaaggggaagaagggatccaagaagaagaccgtcgatccctttgctaaga 60

                                                                       
Query: 161 agcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggcaagaccc 220
           || | |||||||| |||||||| |||  | | ||||     || ||| ||||||||||||
Sbjct: 61  aggactggtatgatatcaaggccccgtcggtgttcaatgtgcggaacatcggcaagaccc 120

                                                                       
Query: 221 tcgtgtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttg 280
           |||||||||||||||||||||| |||||||| || |||||||| |||||  | |||||||
Sbjct: 121 tcgtgtccaggacacagggtacaaagattgcttctgagggcctaaagcatagagtgtttg 180

                                                                       
Query: 281 aagtatctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactcc 340
           | || ||  |||||||||| |||||||||||||| ||||| ||||||||||||||||| |
Sbjct: 181 aggtctccttagctgatctccagaacgatgaggatcaggcgtacaggaagatcagacttc 240

                                                                       
Query: 341 gtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcacca 400
           ||||||||||||||||||||| ||| || ||||| ||||| |||||||||   || || |
Sbjct: 241 gtgctgaggatgtgcaagggaagaacgtgctcaccaacttttggggcatgtcgtttacta 300

                                                                       
Query: 401 ctgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatg 460
           | || |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||
Sbjct: 301 ccgataagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatg 360

                                                                       
Query: 461 tgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcc 520
           | || ||||| |||   |||||||| ||  ||||    || |||||||||||| | || |
Sbjct: 361 tcaaaaccacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggc 420

                                                                       
Query: 521 caaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccgga 580
           | |||||||| ||| | ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 421 ctaaccaggtgaagaggacttgctatgctcaagcgagtcagatcagacagattcgtcgca 480

                                                                       
Query: 581 agatggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaaca 640
           |||||||||| ||||||| |||||| ||| |||||||||| ||||| ||||| ||    |
Sbjct: 481 agatggttgaaatcatggccaaccaggcttcaagctgtgatttgaaagagctagtttcaa 540

                                                                       
Query: 641 agttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttcccgc 700
           ||||||| ||||| || ||||| ||||| ||||||||||| || || || || ||||| |
Sbjct: 541 agttcattcctgaagttattgggaaggaaattgagaaggcgacatccagtattttccccc 600

                                                                       
Query: 701 tccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgacctgggaa 760
           | ||||| ||||  |||||||| |||||||| || ||||||||||| ||||||||||| |
Sbjct: 601 ttcagaatgtgtttgtccgcaaagtgaagattctaaaggccccgaaatttgacctgggga 660

                                    
Query: 761 agctcatggaggtgcacggtgacta 785
           |||||||||||||||| ||||||||
Sbjct: 661 agctcatggaggtgcatggtgacta 685



to top

>dbj|AK099131.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023048M05, full
           insert sequence
          Length = 1063

 Score =  438 bits (221), Expect = e-119
 Identities = 611/741 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| || ||||||||| || | ||||||||||| |||||||| |||||||||||| 
Sbjct: 34  ccatggccgtgggcaagaacgagaggatctccaagggcaggaagggcagcaagaagaaga 93

                                                                       
Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 94  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 153

                                                                       
Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 154 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 213

                                                                       
Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 214 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 273

                                                                       
Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 274 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 333

                                                                       
Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 334 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 393

                                                                       
Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 394 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 453

                                                                       
Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 454 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 513

                                                                       
Query: 560 agatcagacagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtg 619
           ||||| | ||||||||||||||||||||||||||||||| |||||| ||  |||  ||||
Sbjct: 514 agatccggcagatccgccggaagatggttgagatcatggccaaccaggcatcaacatgtg 573

                                                                       
Query: 620 acttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaagg 679
           ||||||| || || ||    || ||||||||||| || |||||||||||||| |||||| 
Sbjct: 574 acttgaaagaactggtttcaaaattcatccctgaagtcattggaaaggagatcgagaagt 633

                                                                       
Query: 680 ccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaagg 739
           | || ||||| || ||||| ||||| || |||| | ||||||||||||||||| ||||||
Sbjct: 634 caacttcaagtatattccctctccaaaatgtgttcatccgcaaggtgaagatcttgaagg 693

                                                                       
Query: 740 ccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgttg 799
           | ||||||||||| || || ||| | |||||||| ||||||||||||||||| ||||| |
Sbjct: 694 caccgaagtttgatcttgggaagttgatggaggtacacggtgactacaaggaagatgtcg 753

                                
Query: 800 gtgtgaagcttgacaggcctg 820
           || ||||||| ||||||||||
Sbjct: 754 gtatgaagctggacaggcctg 774



to top

>dbj|AK059647.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-031-C03, full
           insert sequence
          Length = 1171

 Score =  438 bits (221), Expect = e-119
 Identities = 611/741 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 70  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 129

                                                                       
Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 130 ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 189

                                                                       
Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 190 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 249

                                                                       
Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319
           | || ||||| || || |||||||| ||  | || ||||||||||| || ||||| ||||
Sbjct: 250 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcagaatgacgaggatcagg 309

                                                                       
Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 310 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 369

                                                                       
Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 370 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 429

                                                                       
Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 430 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 489

                                                                       
Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559
           |||| ||||||||| | |||||||| ||||| ||||| || || || ||||| || || |
Sbjct: 490 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctcaggctagcc 549

                                                                       
Query: 560 agatcagacagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtg 619
           ||||| | ||||||| ||||||||||||||||||||||| |||||| ||  |||  ||||
Sbjct: 550 agatccggcagatcctccggaagatggttgagatcatggccaaccaggcatcaacatgtg 609

                                                                       
Query: 620 acttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaagg 679
           ||||||| || || ||    || ||||||||||| || |||||||||||||| |||||| 
Sbjct: 610 acttgaaagaactggtttcaaaattcatccctgaagtcattggaaaggagatcgagaagt 669

                                                                       
Query: 680 ccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaagg 739
           | || ||||| || ||||| ||||| || |||| | ||||||||||||||||| ||||||
Sbjct: 670 caacttcaagtatattccctctccaaaatgtgttcatccgcaaggtgaagatcttgaagg 729

                                                                       
Query: 740 ccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgttg 799
           | ||||||||||| || || ||| | |||||||| ||||||||||||||||| ||||| |
Sbjct: 730 caccgaagtttgatcttgggaagttgatggaggtacacggtgactacaaggaagatgtcg 789

                                
Query: 800 gtgtgaagcttgacaggcctg 820
           || ||||||| ||||||||||
Sbjct: 790 gtatgaagctggacaggcctg 810



to top

>gb|AF052503.1|AF052503 Oryza sativa S-phase-specific ribosomal protein (RSPSP94) mRNA,
           complete cds
          Length = 1027

 Score =  408 bits (206), Expect = e-110
 Identities = 610/742 (82%), Gaps = 2/742 (0%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| || |||||||||||| | ||||||||||| |||||||| |||||||||||| 
Sbjct: 31  ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaaga 90

                                                                       
Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctcttcacca 199
           |||| ||||| ||  |||||||| | ||||| |||||||||||||||    | ||| || 
Sbjct: 91  ccgtcgatcccttttccaagaaggattggtacgacatcaaggcgccgaccgtgttctccg 150

                                                                       
Query: 200 gccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagg 259
            ||||||| |||||||||||||||| |||||||| ||||| ||||||||||| || ||||
Sbjct: 151 tccgcaacatcggcaagaccctcgtctccaggacccaggggaccaagattgcatctgagg 210

                                                                       
Query: 260 gcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccagg 319
           | || ||||| || || |||||||| ||  | || ||||||| ||| || ||||| ||||
Sbjct: 211 gtctcaagcatcgtgtctttgaagtctccttggcggatcttcggaatgacgaggatcagg 270

                                                                       
Query: 320 cctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaact 379
           | ||||||||| | ||||| |||||||||||||| || |||| |||||||||||| || |
Sbjct: 271 cttacaggaaggttagacttcgtgctgaggatgttcaggggaggaatgtcctcacgaatt 330

                                                                       
Query: 380 tctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccc 439
           |||||||||||  ||| ||||| ||||| || |||||  | || | ||| ||||| ||  
Sbjct: 331 tctggggcatgagttttaccacggacaaacttaggtccttggtcaagaaatggcaaacat 390

                                                                       
Query: 440 tcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgcca 499
           | ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||
Sbjct: 391 tgattgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgca 450

                                                                       
Query: 500 ttggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtc 559
           |||| ||||||||| | |||||||| ||||| ||||| || || || |||| ||  || |
Sbjct: 451 ttggtttcaccaagcgccgcccaaatcaggtgaagcgtacctgttacgctc-aggtagcc 509

                                                                       
Query: 560 agatcagacagat-ccgccggaagatggttgagatcatggtcaaccaagctgcaagctgt 618
           ||||| | ||||| |||||||||||||||||||||||||| |||||| ||  |||  |||
Sbjct: 510 agatccggcagatcccgccggaagatggttgagatcatggccaaccaggcatcaacatgt 569

                                                                       
Query: 619 gacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaag 678
           |||||||| || || ||    || ||||||||||| || |||||||||||||| ||||||
Sbjct: 570 gacttgaaagaactggtttcaaaattcatccctgaagtcattggaaaggagatcgagaag 629

                                                                       
Query: 679 gccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaag 738
            | || ||||| || ||||| ||||| || |||| | ||||||||||||||||| |||||
Sbjct: 630 tcaacttcaagtatattccctctccaaaatgtgttcatccgcaaggtgaagatcttgaag 689

                                                                       
Query: 739 gccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgtt 798
           || ||||||||||| || || ||| | |||||||| ||||||||||||||||| ||||| 
Sbjct: 690 gcaccgaagtttgatcttgggaagttgatggaggtacacggtgactacaaggaagatgtc 749

                                 
Query: 799 ggtgtgaagcttgacaggcctg 820
           ||| ||||||| ||||||||||
Sbjct: 750 ggtatgaagctggacaggcctg 771



to top

>dbj|AK071037.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079A13, full
           insert sequence
          Length = 1118

 Score =  406 bits (205), Expect = e-110
 Identities = 626/765 (81%), Gaps = 1/765 (0%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 92  gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 151

                                                                       
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctg 189
           ||||||||| |||| ||||| ||  | |||||| | |||||||| |||||||| |||  |
Sbjct: 152 aagaagaagaccgtcgatccttttgcgaagaaggattggtatgatatcaaggccccgtcg 211

                                                                       
Query: 190 ctcttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagatt 249
            | |||| |    | |||||||| ||||| |||||||||||||||||||| || ||||||
Sbjct: 212 gtgttcaacgtgagaaacgtcgggaagacgctcgtgtccaggacacagggcacaaagatt 271

                                                                       
Query: 250 gcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgat 309
           || ||||||||||| |||||||| |||||||| || ||  | ||||||||||||||||||
Sbjct: 272 gcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcagaacgat 331

                                                                       
Query: 310 gaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtc 369
           ||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  ||||| 
Sbjct: 332 gaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaaatgtt 391

                                                                       
Query: 370 ctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaag 429
           || ||||||||||||||||||  |||||| || ||||||||||| ||  | || | ||| 
Sbjct: 392 cttacaaacttctggggcatgagtttcacgaccgacaagctcagatcattggtcaagaaa 451

                                                                       
Query: 430 tggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgc 489
           |||||||| || || ||||||||||| |||||  |||||||||| || |||||||| || 
Sbjct: 452 tggcagacgctaatagaggctcatgtggatgtagagaccactgataactacatgctgcgt 511

                                                                       
Query: 490 atgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgct 549
            | ||   | ||||||||||||||||  | ||||| || ||||| || || |||||||||
Sbjct: 512 ctcttctgcgttggcttcaccaagaggaggccaaatcaagtcaaacggacatgctatgct 571

                                                                       
Query: 550 caagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagct 609
           |||||||| |||||  |||||||||| || |||||||| |||| |||||| ||||| || 
Sbjct: 572 caagcaagccagattcgacagatccgtcgcaagatggtggagaccatggtgaaccaggca 631

                                                                       
Query: 610 gcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggag 669
            ||  ||||||  | |||||||| |||   || ||||| |||||||||||||| ||||| 
Sbjct: 632 tcatcctgtgatctcaaggagctggtgtcaaaattcattcctgaggtgattgggaaggaa 691

                                                                       
Query: 670 attgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaag 729
           || ||||||||||| ||||||||||||||||| ||||| ||||  || ||||| || |||
Sbjct: 692 atcgagaaggccacatcaagcatcttcccgcttcagaatgtgtttgtgcgcaaagtcaag 751

                                                                       
Query: 730 atcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaag 789
           ||||| |||||||| || ||||||||||| ||||| |||||||| || || || || |||
Sbjct: 752 atcctcaaggccccaaaatttgacctgggcaagcttatggaggttcatggagatta-aag 810

                                                        
Query: 790 gaggatgttggtgtgaagcttgacaggcctgatggagatgaggtc 834
           ||||| |||||   |||||| || |||||||  | ||||||||||
Sbjct: 811 gaggacgttgggacgaagctcgagaggcctgcagaagatgaggtc 855



to top

>emb|CT834479.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA106G03, full
           insert sequence
          Length = 1131

 Score =  394 bits (199), Expect = e-106
 Identities = 490/587 (83%)
 Strand = Plus / Plus

                                                                       
Query: 214 aagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaagcaccgg 273
           ||||| |||||||||||||||||||| || |||||||| ||||||||||| |||||||| 
Sbjct: 238 aagacgctcgtgtccaggacacagggcacaaagattgcttcagagggcctcaagcaccgt 297

                                                                       
Query: 274 gtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacaggaagatc 333
           |||||||| || ||  | ||||||||||||||||||||||| ||||| ||| | ||||||
Sbjct: 298 gtgtttgaggtctccttggctgatcttcagaacgatgaggatcaggcgtaccgtaagatc 357

                                                                       
Query: 334 agactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggat 393
           ||||| ||||| ||||||||||| ||||  ||||| || ||||||||||||||||||  |
Sbjct: 358 agactacgtgccgaggatgtgcaggggaaaaatgttcttacaaacttctggggcatgagt 417

                                                                       
Query: 394 ttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcat 453
           ||||| || ||||||||||| ||  | || | ||| |||||||| || || |||||||||
Sbjct: 418 ttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaatagaggctcat 477

                                                                       
Query: 454 gtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaag 513
           || ||||| ||||||||||| || |||||||| ||  | ||   ||||||||||||||||
Sbjct: 478 gtggatgtaaagaccactgataactacatgctgcgtctcttctgcattggcttcaccaag 537

                                                                       
Query: 514 agacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatc 573
           ||  | ||||| || ||||| || || ||||||||||||||||| |||||  ||||||||
Sbjct: 538 aggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagattcgacagatc 597

                                                                       
Query: 574 cgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagctt 633
           || || |||||||| ||||||||||| ||||| ||  ||  ||||||  | |||||||| 
Sbjct: 598 cgtcgcaagatggtggagatcatggtgaaccaggcatcatcctgtgatctcaaggagctg 657

                                                                       
Query: 634 gtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatc 693
           |||   || ||||| |||||||||||||| ||||| || ||||||||||| |||||||||
Sbjct: 658 gtgtcaaaattcattcctgaggtgattgggaaggaaatcgagaaggccacatcaagcatc 717

                                                                       
Query: 694 ttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgac 753
           |||||||| ||||| ||||  || ||||| || |||||||| |||||||| || ||||||
Sbjct: 718 ttcccgcttcagaatgtgtttgtgcgcaaagtcaagatcctcaaggccccaaaatttgac 777

                                                          
Query: 754 ctgggaaagctcatggaggtgcacggtgactacaaggaggatgttgg 800
           ||||| ||||| |||||||| || || || ||||||||||| |||||
Sbjct: 778 ctgggcaagcttatggaggttcatggagattacaaggaggacgttgg 824



 Score = 81.8 bits (41), Expect = 5e-12
 Identities = 95/113 (84%)
 Strand = Plus / Plus

                                                                       
Query: 70  gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
           |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 94  gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 153

                                                                
Query: 130 aagaagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           ||||||||| |||| ||||| ||  | |||||| | |||||||| ||||||||
Sbjct: 154 aagaagaagaccgtcgatccttttgcgaagaaggattggtatgatatcaaggc 206



to top

>gb|BT016390.1| Zea mays clone Contig223 mRNA sequence
          Length = 1104

 Score =  381 bits (192), Expect = e-102
 Identities = 609/748 (81%)
 Strand = Plus / Plus

                                                                       
Query: 73  gcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaag 132
           ||||| |||||||| ||||| ||||||||| | ||||||||||| | ||||||| |||||
Sbjct: 65  gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 124

                                                                       
Query: 133 aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 192
           || ||| |||| || || ||| | |||||| | ||||||||||||||||| |||  | | 
Sbjct: 125 aaaaagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 184

                                                                       
Query: 193 ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 252
           ||||     |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| 
Sbjct: 185 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 244

                                                                       
Query: 253 tcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgag 312
           || ||||| ||||||||| | || ||||| || |  |||||||||||||||  ||| |||
Sbjct: 245 tctgagggtctgaagcacagagtctttgaggtttgcctagctgatcttcagggcgacgag 304

                                                                       
Query: 313 gaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctc 372
           || || || |||||||| ||||| ||||||||||| |||||||| || | |||||| |||
Sbjct: 305 gatcaagcttacaggaaaatcaggctccgtgctgaagatgtgcagggcaggaatgtgctc 364

                                                                       
Query: 373 acaaacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtgg 432
           |||||||| ||||| ||| |||| |||||||| || || || || || |||| |||||||
Sbjct: 365 acaaacttttggggtatgaattttaccactgataaactgagatccctagtgaagaagtgg 424

                                                                       
Query: 433 cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 492
           |||||  | || || || ||||| ||||| ||||| || ||||| |||||| | ||  ||
Sbjct: 425 cagacattaatcgaagcccatgttgatgtcaagacaaccgacaactacatgttgcgtttg 484

                                                                       
Query: 493 tttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 552
           ||   ||| |||||||||||||| ||||||||||| |||||| | || ||||||||||| 
Sbjct: 485 ttctgcatcggcttcaccaagaggcgcccaaaccaagtcaagagaacctgctatgctcag 544

                                                                       
Query: 553 gcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagctgca 612
           |||   |||||| | ||||||||||| |||||||||||||| ||| ||||||| ||| | 
Sbjct: 545 gcatcccagatccgtcagatccgccgaaagatggttgagattatgatcaaccaggcttct 604

                                                                       
Query: 613 agctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagatt 672
           |  |||||| |||| || |||||    |||||||| || || || ||||| || ||||||
Sbjct: 605 acatgtgacctgaaagaacttgtttcgaagttcattccagaagttattggtaaagagatt 664

                                                                       
Query: 673 gagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatc 732
           |||||| | ||||| ||||||||||| || || ||||| | | |||||||||||||||| 
Sbjct: 665 gagaagtctacctccagcatcttcccacttcaaaacgtcttcatccgcaaggtgaagata 724

                                                                       
Query: 733 ctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaaggag 792
           || |||||||| ||||| || || || || ||||||||||| || || |||||||| |||
Sbjct: 725 ctcaaggcccccaagttcgatcttgggaaactcatggaggttcatggcgactacaaagag 784

                                       
Query: 793 gatgttggtgtgaagcttgacaggcctg 820
           |||||||||||||||||||| |||||||
Sbjct: 785 gatgttggtgtgaagcttgagaggcctg 812



to top

>gb|AY109383.1| Zea mays CL7224_1 mRNA sequence
          Length = 1236

 Score =  280 bits (141), Expect = 1e-71
 Identities = 398/484 (82%)
 Strand = Plus / Minus

                                                                       
Query: 337 ctccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttc 396
           ||||||||||| ||||||||||| | |||||| ||||||||||| ||||| ||| |||| 
Sbjct: 866 ctccgtgctgaagatgtgcaaggcaggaatgtgctcacaaacttttggggtatgaatttt 807

                                                                       
Query: 397 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 456
           |||||||| || || || || || |||| ||||||||||||  | || || || ||||| 
Sbjct: 806 accactgataaactgagatccctagtgaagaagtggcagacattaatcgaagcccatgtt 747

                                                                       
Query: 457 gatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttcaccaagaga 516
           ||||| ||||| || ||||| |||||| | ||  ||||   ||| |||||||||||||| 
Sbjct: 746 gatgtcaagacaaccgacaactacatgttgcgtttgttctgcatcggcttcaccaagagg 687

                                                                       
Query: 517 cgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgc 576
           |||||||||||||||||| | || ||||||||||| |||   |||||| | |||||||||
Sbjct: 686 cgcccaaaccaggtcaagagaacctgctatgctcaggcatcccagatccgtcagatccgc 627

                                                                       
Query: 577 cggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtg 636
           || |||||||||||||| ||| ||||||| ||| | |  |||||| |||| || ||||| 
Sbjct: 626 cgtaagatggttgagattatgatcaaccaggcttctacatgtgacctgaaagaacttgtt 567

                                                                       
Query: 637 aacaagttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttc 696
              |||||||| || || || ||||| ||||||||||||||| | ||||| |||||||||
Sbjct: 566 tcgaagttcattccagaagttattggtaaggagattgagaagtctacctccagcatcttc 507

                                                                       
Query: 697 ccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgacctg 756
           || || || ||||| | | |||||||||||||||| || |||| ||| ||||| || || 
Sbjct: 506 ccacttcaaaacgtcttcatccgcaaggtgaagatactcaaggnccccaagttcgatctt 447

                                                                       
Query: 757 ggaaagctcatggaggtgcacggtgactacaaggaggatgttggtgtgaagcttgacagg 816
           || |||||||||||||| || || |||||||| ||||||||||||||||||||||| |||
Sbjct: 446 gggaagctcatggaggttcatggcgactacaaagaggatgttggtgtgaagcttgagagg 387

               
Query: 817 cctg 820
           ||||
Sbjct: 386 cctg 383



 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 160/198 (80%)
 Strand = Plus / Minus

                                                                        
Query: 73   gcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaag 132
            ||||| |||||||| ||||| ||||||||| | ||||||||||| | ||||||| |||||
Sbjct: 1130 gcggcgaccatggctgtcggaaagaacaagaggatctccaagggaaagaagggtggcaag 1071

                                                                        
Query: 133  aagaaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccgctgctc 192
                || |||| || || ||| | |||||| | ||||||||||||||||| |||  | | 
Sbjct: 1070 nnncagaccgtcgaccctttctctaagaaggattggtatgacatcaaggcaccgtcggtg 1011

                                                                        
Query: 193  ttcaccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcc 252
            ||||     |||||| |||| ||||| ||||| ||||||||||||||||||| |||||| 
Sbjct: 1010 ttcagtgtgcgcaacatcgggaagactctcgtatccaggacacagggtaccaggattgct 951

                              
Query: 253  tcagagggcctgaagcac 270
            || ||||| |||||||||
Sbjct: 950  tctgagggtctgaagcac 933



to top

>gb|AF117889.1|AF117889 Avena fatua 40S ribosomal protein S3A mRNA, partial cds
          Length = 382

 Score =  252 bits (127), Expect = 2e-63
 Identities = 225/257 (87%), Gaps = 3/257 (1%)
 Strand = Plus / Plus

                                                                       
Query: 618 tgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaa 677
           |||| |||||||||| ||| | ||||||||||||||| |||| ||||||||||| |||||
Sbjct: 1   tgacctgaaggagctggtgcagaagttcatccctgagctgatcggaaaggagatcgagaa 60

                                                                       
Query: 678 ggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaa 737
           ||| ||  | |||||||||||||||||||||||||| |||||||||||||||||| ||||
Sbjct: 61  ggcgacaccgagcatcttcccgctccagaacgtgtatgtccgcaaggtgaagatcttgaa 120

                                                                       
Query: 738 ggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgt 797
           ||| || ||||| || ||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 121 ggcacccaagttcgatctggggaagctcatggaggtgcatggtgactacaaggaagatgt 180

                                                                       
Query: 798 tggtgtgaagcttgacaggc---ctgatggagatgaggtcattcctggtgcggaggaggt 854
           ||||   ||| | |||||||   ||||||||||||||||||| || ||||| ||||||||
Sbjct: 181 tggtaccaagttggacaggcctgctgatggagatgaggtcatccccggtgctgaggaggt 240

                            
Query: 855 tgctgctgctgagtaga 871
           ||||||||| |||||||
Sbjct: 241 tgctgctgccgagtaga 257



 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 35/36 (97%), Gaps = 1/36 (2%)
 Strand = Plus / Plus

                                               
Query: 932 tgtcgtgaactt-tgtagtcagttttgatggctgat 966
           |||||||||||| |||||||||||||||||||||||
Sbjct: 330 tgtcgtgaacttctgtagtcagttttgatggctgat 365



to top

>gb|EF065683.1| Cymbidium hybrid cultivar RPS3 mRNA, complete cds
          Length = 1003

 Score =  206 bits (104), Expect = 1e-49
 Identities = 299/364 (82%)
 Strand = Plus / Plus

                                                                       
Query: 209 tcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaagc 268
           |||| ||||| || ||||| ||||| ||||| || |||||||| || || || || ||||
Sbjct: 140 tcgggaagactcttgtgtcgaggacgcagggaactaagattgcttccgaaggtctcaagc 199

                                                                       
Query: 269 accgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagga 328
           |  | ||||||||  | || || ||||||||||||||||||||||| ||  | ||||| |
Sbjct: 200 atagagtgtttgagatctcccttgctgatcttcagaacgatgaggatcaatcatacagaa 259

                                                                       
Query: 329 agatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggca 388
           ||||||| || ||||| |||||||| ||||| | |||||||||||||||||| |||||||
Sbjct: 260 agatcaggcttcgtgcagaggatgtccaaggcaagaatgtcctcacaaacttttggggca 319

                                                                       
Query: 389 tggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgagg 448
           ||||||||||||| ||||||||||||||||| ||  | || ||||||||  | || || |
Sbjct: 320 tggatttcaccaccgacaagctcaggtctctggttcgcaaatggcagacattaatcgaag 379

                                                                       
Query: 449 ctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttca 508
           | ||| | ||||||||||||||||| |||||||  || ||  ||||   |||||||||||
Sbjct: 380 cgcatattgatgtgaagaccactgataattacaccctgcgtttgttctgcattggcttca 439

                                                                       
Query: 509 ccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagatcagac 568
           |||||||| | ||||| || || |||||||||||||| || ||  | |||||||||||||
Sbjct: 440 ccaagagaaggccaaatcaagtgaagcgcacttgctacgcgcagactagtcagatcagac 499

               
Query: 569 agat 572
           ||||
Sbjct: 500 agat 503



 Score =  113 bits (57), Expect = 1e-21
 Identities = 132/157 (84%)
 Strand = Plus / Plus

                                                                       
Query: 664 aaggagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaag 723
           |||||||| |||||||| ||  | ||||||| ||| || ||||| || | | ||||||||
Sbjct: 595 aaggagatcgagaaggcgacaacgagcatctaccccctgcagaatgtattcatccgcaag 654

                                                                       
Query: 724 gtgaagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgac 783
           || |||||||| ||||| || |||||||| || ||||| ||||||||||| || || || 
Sbjct: 655 gttaagatcctcaaggctccaaagtttgatcttggaaaactcatggaggttcatggagat 714

                                                
Query: 784 tacaaggaggatgttggtgtgaagcttgacaggcctg 820
           |||||||| ||| ||||||||||||||||||||||||
Sbjct: 715 tacaaggaagattttggtgtgaagcttgacaggcctg 751



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                       
Query: 76  gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaag 135
           ||||||||||| || |||||||||||| | || |||||||| | ||||||  | ||||||
Sbjct: 7   gcaaccatggccgtgggcaagaacaagagaatttccaagggaaagaagggaggaaagaag 66

                                                          
Query: 136 aaggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           ||| | || ||||| ||| | |||||| | |||||||||||||||||
Sbjct: 67  aagacagtcgatcccttctcgaagaaggattggtatgacatcaaggc 113



to top

>emb|AJ515028.1|CAR515028 Cicer arietinum mRNA for ribosomal protein S3a (rs3a gene)
          Length = 1026

 Score =  190 bits (96), Expect = 7e-45
 Identities = 342/424 (80%)
 Strand = Plus / Plus

                                                                       
Query: 363 gaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgt 422
           |||||||||||| ||||| |  || |||||||||||||||||||||||||||||| | ||
Sbjct: 332 gaatgtcctcaccaacttttatggtatggatttcaccactgacaagctcaggtctttggt 391

                                                                       
Query: 423 gaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacat 482
             | || ||||| || |||||||| |||||||| ||||| ||||||||||| ||||| | 
Sbjct: 392 ccgtaaatggcaaactctcattgaagctcatgtggatgttaagaccactgataattatac 451

                                                                       
Query: 483 gctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcacttg 542
             |  | |||||   ||||||||| ||||||||||||   ||||| || ||| | || ||
Sbjct: 452 cttgagaatgttctgcattggctttaccaagagacgcagtaaccaagtgaagagaacctg 511

                                                                       
Query: 543 ctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaa 602
            ||||||||| | || |||||||||||||||||| ||||||||   ||||||||||| ||
Sbjct: 512 ttatgctcaatccagccagatcagacagatccgcaggaagatgagggagatcatggttaa 571

                                                                       
Query: 603 ccaagctgcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattgg 662
           ||||||  ||   ||||| ||||| ||||||||   |||||| ||||||||| |||||||
Sbjct: 572 ccaagcaacatcgtgtgatttgaaagagcttgttcgcaagtttatccctgagatgattgg 631

                                                                       
Query: 663 aaaggagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaa 722
           |||||||||||||||||| || || ||||| | ||| || |||||||| |   | |||||
Sbjct: 632 aaaggagattgagaaggctacatctagcatttaccctctgcagaacgtttttattcgcaa 691

                                                                       
Query: 723 ggtgaagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtga 782
            || |||||| ||||  | || |||||||| || ||||| || |||||||| || |||||
Sbjct: 692 agttaagatcttgaaatctcccaagtttgatcttggaaaactgatggaggttcatggtga 751

               
Query: 783 ctac 786
           ||||
Sbjct: 752 ctac 755



 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 90/106 (84%)
 Strand = Plus / Plus

                                                                       
Query: 77  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136
           |||||||||||||||||||||||||| | || |||||||| | ||||||  |||||||||
Sbjct: 46  caaccatggcggtcggcaagaacaagagaatttccaagggaaagaagggaggcaagaaga 105

                                                         
Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           | ||||  ||||| ||  |||||||| | |||||||| ||||||||
Sbjct: 106 aagccgccgatcccttttccaagaaggattggtatgatatcaaggc 151



to top

>gb|BT019079.1| Zea mays clone Contig661.F mRNA sequence
          Length = 1229

 Score =  172 bits (87), Expect = 2e-39
 Identities = 264/323 (81%)
 Strand = Plus / Minus

                                                                       
Query: 498 cattggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaag 557
           |||||| || |||||||| |||||||||||||||||| | || ||||||||||| |||  
Sbjct: 603 cattggttttaccaagaggcgcccaaaccaggtcaagagaacctgctatgctcaggcatc 544

                                                                       
Query: 558 tcagatcagacagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctg 617
            |||||  | ||||| ||||| |||||||||||||| ||| ||||||| ||| | |  ||
Sbjct: 543 ccagattcggcagattcgccgcaagatggttgagattatgatcaaccaggcttctacatg 484

                                                                       
Query: 618 tgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaa 677
           |||| | || || |||||    |||||||| || || || ||||| || |||||||||||
Sbjct: 483 tgaccttaaagaacttgtttctaagttcattccggaagttattggcaaagagattgagaa 424

                                                                       
Query: 678 ggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaa 737
           | | ||||| ||||||||||| || || ||||| | | |||||||||||||||| || ||
Sbjct: 423 gtctacctccagcatcttcccacttcaaaacgtcttcatccgcaaggtgaagatactcaa 364

                                                                       
Query: 738 ggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgt 797
           |||||| |||||||| || || ||| | |||||||| || || |||||||| ||||| ||
Sbjct: 363 ggcccccaagtttgatctcgggaagttgatggaggttcatggcgactacaaagaggacgt 304

                                  
Query: 798 tggtgtgaagcttgacaggcctg 820
           ||||||||||||||| |||||||
Sbjct: 303 tggtgtgaagcttgagaggcctg 281



to top

>gb|AY849388.1| Vitis vinifera cultivar Riesling cyc07 mRNA, partial cds
          Length = 879

 Score =  159 bits (80), Expect = 3e-35
 Identities = 152/176 (86%)
 Strand = Plus / Plus

                                                                       
Query: 292 gctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggat 351
           ||||||||||||||||||||||| |  ||||||||||||||| ||||  | |||||||||
Sbjct: 145 gctgatcttcagaacgatgaggatcgtgcctacaggaagatccgactgagagctgaggat 204

                                                                       
Query: 352 gtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctc 411
           |||||||| | |||||||||||||||||||||||| ||||| || || || |||||||| 
Sbjct: 205 gtgcaaggaaagaatgtcctcacaaacttctggggaatggactttacaacagacaagctg 264

                                                                   
Query: 412 aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 467
           |||||| | ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 265 aggtctttggtgcgcaagtggcagacattgattgaggctcatgtggatgttaagac 320



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 135/168 (80%)
 Strand = Plus / Plus

                                                                       
Query: 640 aagttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttcccg 699
           ||||||||||||||| ||||||| |  |||||||||||||| || ||||||||||  || 
Sbjct: 487 aagttcatccctgagatgattggcagagagattgagaaggcaacttcaagcatctatcct 546

                                                                       
Query: 700 ctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgacctggga 759
           || ||||| || | | | || || || |||||| |||| || || || ||||| || |||
Sbjct: 547 ctacagaatgtcttcattcgaaaagtcaagatcttgaaagctcccaaatttgatcttgga 606

                                                           
Query: 760 aagctcatggaggtgcacggtgactacaaggaggatgttggtgtgaag 807
           ||| | |||||||| || |||||||||   || |||||||||||||||
Sbjct: 607 aagttgatggaggttcatggtgactactctgaagatgttggtgtgaag 654



to top

>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score =  149 bits (75), Expect = 2e-32
 Identities = 84/87 (96%)
 Strand = Plus / Minus

                                                                         
Query: 434   agaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgt 493
             |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 46711 agaccctcattgaggctcatgtggatgtgaagacaactgacaattacatgctccgcatgt 46652

                                        
Query: 494   ttgccattggcttcaccaagagacgcc 520
             ||||||||||||||||||||| |||||
Sbjct: 46651 ttgccattggcttcaccaagaaacgcc 46625



 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 49/52 (94%)
 Strand = Plus / Minus

                                                                 
Query: 432   gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483
             |||||||||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 46885 gcagaccctcattgaggctcatgtggatgtgaagacaactgacaactacatg 46834



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 436   accctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483
             |||||||||||||||||||| ||||||||||| |||||||| ||||||
Sbjct: 47052 accctcattgaggctcatgtggatgtgaagacaactgacaactacatg 47005



to top

>ref|NM_119633.2| Arabidopsis thaliana structural constituent of ribosome (AT4G34670)
           mRNA, complete cds
          Length = 1093

 Score =  147 bits (74), Expect = 1e-31
 Identities = 316/394 (80%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 78  aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137
           ||||||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 75  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134

                                                                       
Query: 138 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 196
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193

                                                                       
Query: 197 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 256
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253

                                                                       
Query: 257 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 316
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313

                                                                       
Query: 317 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 376
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373

                                                                       
Query: 377 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 436
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433

                                             
Query: 437 ccctcattgaggctcatgtcgatgtgaagaccac 470
           |  | ||||| || |||||||||||||| |||||
Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467



 Score =  109 bits (55), Expect = 2e-20
 Identities = 170/206 (82%), Gaps = 3/206 (1%)
 Strand = Plus / Plus

                                                                       
Query: 616 tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
           |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 613 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 672

                                                                       
Query: 676 aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
           ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 673 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 732

                                                                       
Query: 736 aaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactaca-ag--gag 792
           ||||| || ||||||||||| |||||||||||||||||||| || || |||| ||  |||
Sbjct: 733 aaggctcccaagtttgaccttggaaagctcatggaggtgcatggagattacacagcagag 792

                                     
Query: 793 gatgttggtgtgaagcttgacaggcc 818
           ||||||||||||||| | ||||||||
Sbjct: 793 gatgttggtgtgaaggtagacaggcc 818



to top

>gb|AY062500.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670; T4L20.250) mRNA, complete cds
          Length = 1094

 Score =  147 bits (74), Expect = 1e-31
 Identities = 316/394 (80%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 78  aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137
           ||||||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 75  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 134

                                                                       
Query: 138 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 196
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 135 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 193

                                                                       
Query: 197 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 256
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 194 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 253

                                                                       
Query: 257 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 316
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 254 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 313

                                                                       
Query: 317 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 376
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 314 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 373

                                                                       
Query: 377 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 436
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 374 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 433

                                             
Query: 437 ccctcattgaggctcatgtcgatgtgaagaccac 470
           |  | ||||| || |||||||||||||| |||||
Sbjct: 434 ctttgattgaagcccatgtcgatgtgaaaaccac 467



 Score =  109 bits (55), Expect = 2e-20
 Identities = 170/206 (82%), Gaps = 3/206 (1%)
 Strand = Plus / Plus

                                                                       
Query: 616 tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
           |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 613 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 672

                                                                       
Query: 676 aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
           ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 673 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 732

                                                                       
Query: 736 aaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactaca-ag--gag 792
           ||||| || ||||||||||| |||||||||||||||||||| || || |||| ||  |||
Sbjct: 733 aaggctcccaagtttgaccttggaaagctcatggaggtgcatggagattacacagcagag 792

                                     
Query: 793 gatgttggtgtgaagcttgacaggcc 818
           ||||||||||||||| | ||||||||
Sbjct: 793 gatgttggtgtgaaggtagacaggcc 818



to top

>emb|BX828268.1|CNS0A2YE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH6ZD12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score =  147 bits (74), Expect = 1e-31
 Identities = 316/394 (80%), Gaps = 2/394 (0%)
 Strand = Plus / Plus

                                                                       
Query: 78  aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137
           ||||||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||
Sbjct: 60  aaccatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaa 119

                                                                       
Query: 138 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttca 196
           ||| || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||
Sbjct: 120 ggctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttca 178

                                                                       
Query: 197 ccagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcag 256
           | | | | || || || ||||| || || |||||||| |||||||||||||||||||| |
Sbjct: 179 cgaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctg 238

                                                                       
Query: 257 agggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacc 316
           |||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  
Sbjct: 239 agggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggata 298

                                                                       
Query: 317 aggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaa 376
           | ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  
Sbjct: 299 atgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccc 358

                                                                       
Query: 377 acttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcaga 436
           | |||||||| ||||||||||| || |||||||| |||||  | |||| |||||||||||
Sbjct: 359 agttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcaga 418

                                             
Query: 437 ccctcattgaggctcatgtcgatgtgaagaccac 470
           |  | ||||| || |||||||||||||| |||||
Sbjct: 419 ctttgattgaagcccatgtcgatgtgaaaaccac 452



 Score =  101 bits (51), Expect = 5e-18
 Identities = 169/206 (82%), Gaps = 3/206 (1%)
 Strand = Plus / Plus

                                                                       
Query: 616 tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
           |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 598 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 657

                                                                       
Query: 676 aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
           ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 658 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 717

                                                                       
Query: 736 aaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactaca-ag--gag 792
           ||||| || ||||||||||| |||||||||||||||||||| || || || | ||  |||
Sbjct: 718 aaggctcccaagtttgaccttggaaagctcatggaggtgcatggagattagacagcagag 777

                                     
Query: 793 gatgttggtgtgaagcttgacaggcc 818
           ||||||||||||||| | ||||||||
Sbjct: 778 gatgttggtgtgaaggtagacaggcc 803



to top

>gb|BT000122.1| Arabidopsis thaliana Putative S-phase-specific ribosomal protein
           (At4g34670) mRNA, complete cds
          Length = 581

 Score =  145 bits (73), Expect = 4e-31
 Identities = 315/393 (80%), Gaps = 2/393 (0%)
 Strand = Plus / Minus

                                                                       
Query: 79  accatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138
           |||||||| ||||| ||||||||| | || || ||||| ||||| ||  | |||||||||
Sbjct: 581 accatggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaag 522

                                                                       
Query: 139 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttcac 197
           || || ||||| ||| |||||||| | ||||||||| | ||||| || | | || |||||
Sbjct: 521 gctgttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttcac 463

                                                                       
Query: 198 cagccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcaga 257
            | | | || || || ||||| || || |||||||| |||||||||||||||||||| ||
Sbjct: 462 gaacaggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctga 403

                                                                       
Query: 258 gggcctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggacca 317
           ||| ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  |
Sbjct: 402 gggactgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggataa 343

                                                                       
Query: 318 ggcctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaa 377
            ||||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  |
Sbjct: 342 tgcctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgaccca 283

                                                                       
Query: 378 cttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagac 437
            |||||||| ||||||||||| || |||||||| |||||  | |||| ||||||||||||
Sbjct: 282 gttctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagac 223

                                            
Query: 438 cctcattgaggctcatgtcgatgtgaagaccac 470
             | ||||| || |||||||||||||| |||||
Sbjct: 222 tttgattgaagcccatgtcgatgtgaaaaccac 190



to top

>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3
             clone OSJNBa0021H20, complete sequence
          Length = 133079

 Score =  141 bits (71), Expect = 6e-30
 Identities = 164/195 (84%)
 Strand = Plus / Plus

                                                                         
Query: 580   aagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaac 639
             ||||||||||| ||||||| |||||| ||| |||||||||| ||||| ||||| ||    
Sbjct: 68271 aagatggttgaaatcatggccaaccaggcttcaagctgtgatttgaaagagctagtttca 68330

                                                                         
Query: 640   aagttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttcccg 699
             |||||||| ||||| || ||||| ||||| ||||||||||| || || || || ||||| 
Sbjct: 68331 aagttcattcctgaagttattgggaaggaaattgagaaggcgacatccagtattttcccc 68390

                                                                         
Query: 700   ctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgacctggga 759
             || ||||| ||||  |||||||| |||||||| || ||||||||||| ||||||||||| 
Sbjct: 68391 cttcagaatgtgtttgtccgcaaagtgaagattctaaaggccccgaaatttgacctgggg 68450

                            
Query: 760   aagctcatggaggtg 774
             |||||||||||||||
Sbjct: 68451 aagctcatggaggtg 68465



 Score =  129 bits (65), Expect = 2e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                         
Query: 245   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
             ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 67771 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 67830

                                                                         
Query: 305   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
             |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 67831 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 67890

                                  
Query: 365   atgtcctcacaaacttctggg 385
             | || ||||| ||||| ||||
Sbjct: 67891 acgtgctcaccaacttttggg 67911



 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                         
Query: 406   aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
             |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 68002 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 68061

                                                                         
Query: 466   accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525
             ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 68062 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 68121

                                                          
Query: 526   caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 570
             ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 68122 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 68166



 Score = 67.9 bits (34), Expect = 7e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                               
Query: 209   tcggcaagaccctcgtgtccaggacacagggtac 242
             ||||||||||||||||||||||||||||||||||
Sbjct: 66928 tcggcaagaccctcgtgtccaggacacagggtac 66961



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                         
Query: 70    gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
             |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 66671 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 66730

                      
Query: 130   aagaagaag 138
             |||||||||
Sbjct: 66731 aagaagaag 66739



to top

>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0091J11, from chromosome 3, complete sequence
          Length = 181163

 Score =  141 bits (71), Expect = 6e-30
 Identities = 164/195 (84%)
 Strand = Plus / Minus

                                                                         
Query: 580   aagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaac 639
             ||||||||||| ||||||| |||||| ||| |||||||||| ||||| ||||| ||    
Sbjct: 11649 aagatggttgaaatcatggccaaccaggcttcaagctgtgatttgaaagagctagtttca 11590

                                                                         
Query: 640   aagttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttcccg 699
             |||||||| ||||| || ||||| ||||| ||||||||||| || || || || ||||| 
Sbjct: 11589 aagttcattcctgaagttattgggaaggaaattgagaaggcgacatccagtattttcccc 11530

                                                                         
Query: 700   ctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgacctggga 759
             || ||||| ||||  |||||||| |||||||| || ||||||||||| ||||||||||| 
Sbjct: 11529 cttcagaatgtgtttgtccgcaaagtgaagattctaaaggccccgaaatttgacctgggg 11470

                            
Query: 760   aagctcatggaggtg 774
             |||||||||||||||
Sbjct: 11469 aagctcatggaggtg 11455



 Score =  129 bits (65), Expect = 2e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                         
Query: 245   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
             ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 12149 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 12090

                                                                         
Query: 305   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
             |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 12089 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 12030

                                  
Query: 365   atgtcctcacaaacttctggg 385
             | || ||||| ||||| ||||
Sbjct: 12029 acgtgctcaccaacttttggg 12009



 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 136/165 (82%)
 Strand = Plus / Minus

                                                                         
Query: 406   aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
             |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 11918 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 11859

                                                                         
Query: 466   accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525
             ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 11858 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 11799

                                                          
Query: 526   caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 570
             ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 11798 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 11754



 Score = 67.9 bits (34), Expect = 7e-08
 Identities = 34/34 (100%)
 Strand = Plus / Minus

                                               
Query: 209   tcggcaagaccctcgtgtccaggacacagggtac 242
             ||||||||||||||||||||||||||||||||||
Sbjct: 12992 tcggcaagaccctcgtgtccaggacacagggtac 12959



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                         
Query: 70    gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
             |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 13249 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 13190

                      
Query: 130   aagaagaag 138
             |||||||||
Sbjct: 13189 aagaagaag 13181



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score =  141 bits (71), Expect = 6e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                            
Query: 568      cagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaag 627
                |||||||| || |||||||| ||||||||||| ||||| ||  ||  ||||||  | |||
Sbjct: 12315503 cagatccgtcgcaagatggtggagatcatggtgaaccaggcatcatcctgtgatctcaag 12315444

                                                                            
Query: 628      gagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctca 687
                ||||| |||   || ||||| |||||||||||||| ||||| || ||||||||||| |||
Sbjct: 12315443 gagctggtgtcaaaattcattcctgaggtgattgggaaggaaatcgagaaggccacatca 12315384

                                                                            
Query: 688      agcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaag 747
                |||||||||||||| ||||| ||||  || ||||| || |||||||| |||||||| || 
Sbjct: 12315383 agcatcttcccgcttcagaatgtgtttgtgcgcaaagtcaagatcctcaaggccccaaaa 12315324

                                           
Query: 748      tttgacctgggaaagctcatggaggtg 774
                ||||||||||| ||||| |||||||||
Sbjct: 12315323 tttgacctgggcaagcttatggaggtg 12315297



 Score =  129 bits (65), Expect = 2e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                            
Query: 245      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
                ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 12316009 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 12315950

                                                                            
Query: 305      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
                |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 12315949 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 12315890

                                     
Query: 365      atgtcctcacaaacttctggg 385
                |||| || |||||||||||||
Sbjct: 12315889 atgttcttacaaacttctggg 12315869



 Score = 87.7 bits (44), Expect = 8e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                            
Query: 384      gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 443
                |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 12315798 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 12315739

                                                                            
Query: 444      tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 503
                 ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 12315738 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 12315679

                                                                            
Query: 504      cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
                ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 12315678 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 12315619



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                            
Query: 70       gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
                |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 12318599 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 12318540

                         
Query: 130      aagaagaag 138
                |||||||||
Sbjct: 12318539 aagaagaag 12318531



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                   
Query: 205      aacgtcggcaagaccctcgtgtccaggacacaggg 239
                |||||||| ||||| ||||||||||||||||||||
Sbjct: 12318352 aacgtcgggaagacgctcgtgtccaggacacaggg 12318318



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score =  141 bits (71), Expect = 6e-30
 Identities = 164/195 (84%)
 Strand = Plus / Plus

                                                                           
Query: 580     aagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaac 639
               ||||||||||| ||||||| |||||| ||| |||||||||| ||||| ||||| ||    
Sbjct: 5244084 aagatggttgaaatcatggccaaccaggcttcaagctgtgatttgaaagagctagtttca 5244143

                                                                           
Query: 640     aagttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttcccg 699
               |||||||| ||||| || ||||| ||||| ||||||||||| || || || || ||||| 
Sbjct: 5244144 aagttcattcctgaagttattgggaaggaaattgagaaggcgacatccagtattttcccc 5244203

                                                                           
Query: 700     ctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgacctggga 759
               || ||||| ||||  |||||||| |||||||| || ||||||||||| ||||||||||| 
Sbjct: 5244204 cttcagaatgtgtttgtccgcaaagtgaagattctaaaggccccgaaatttgacctgggg 5244263

                              
Query: 760     aagctcatggaggtg 774
               |||||||||||||||
Sbjct: 5244264 aagctcatggaggtg 5244278



 Score =  129 bits (65), Expect = 2e-26
 Identities = 122/141 (86%)
 Strand = Plus / Plus

                                                                           
Query: 245     agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
               ||||||| || |||||||| |||||  | |||||||| || ||  |||||||||| ||||
Sbjct: 5243584 agattgcttctgagggcctaaagcatagagtgtttgaggtctccttagctgatctccaga 5243643

                                                                           
Query: 305     acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
               |||||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||
Sbjct: 5243644 acgatgaggatcaggcgtacaggaagatcagacttcgtgctgaggatgtgcaagggaaga 5243703

                                    
Query: 365     atgtcctcacaaacttctggg 385
               | || ||||| ||||| ||||
Sbjct: 5243704 acgtgctcaccaacttttggg 5243724



 Score = 97.6 bits (49), Expect = 8e-17
 Identities = 136/165 (82%)
 Strand = Plus / Plus

                                                                           
Query: 406     aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
               |||||||| || ||||| | |||||||||||| || |||||||||||||| ||||| || 
Sbjct: 5243815 aagctcagatcacttgttaagaagtggcagacactgattgaggctcatgtggatgtcaaa 5243874

                                                                           
Query: 466     accactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaac 525
               ||||| |||   |||||||| ||  ||||    || |||||||||||| | || || |||
Sbjct: 5243875 accacagacggctacatgctgcgtctgttctgtatcggcttcaccaagcggcggcctaac 5243934

                                                            
Query: 526     caggtcaagcgcacttgctatgctcaagcaagtcagatcagacag 570
               ||||| ||| | ||||||||||||||||| |||||||||||||||
Sbjct: 5243935 caggtgaagaggacttgctatgctcaagcgagtcagatcagacag 5243979



 Score = 67.9 bits (34), Expect = 7e-08
 Identities = 34/34 (100%)
 Strand = Plus / Plus

                                                 
Query: 209     tcggcaagaccctcgtgtccaggacacagggtac 242
               ||||||||||||||||||||||||||||||||||
Sbjct: 5242741 tcggcaagaccctcgtgtccaggacacagggtac 5242774



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 60/69 (86%)
 Strand = Plus / Plus

                                                                           
Query: 70      gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
               |||||| || ||||||| || || ||||||||||||||||||||||||| ||||||   |
Sbjct: 5242484 gcagcgtcagccatggccgtaggtaagaacaagcgcatctccaaggggaagaagggatcc 5242543

                        
Query: 130     aagaagaag 138
               |||||||||
Sbjct: 5242544 aagaagaag 5242552



to top

>emb|AL713942.4|CNS07YPB Oryza sativa chromosome 12, . BAC OSJNBa0009F05 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 163702

 Score =  141 bits (71), Expect = 6e-30
 Identities = 173/207 (83%)
 Strand = Plus / Minus

                                                                         
Query: 568   cagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaag 627
             |||||||| || |||||||| ||||||||||| ||||| ||  ||  ||||||  | |||
Sbjct: 29868 cagatccgtcgcaagatggtggagatcatggtgaaccaggcatcatcctgtgatctcaag 29809

                                                                         
Query: 628   gagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctca 687
             ||||| |||   || ||||| |||||||||||||| ||||| || ||||||||||| |||
Sbjct: 29808 gagctggtgtcaaaattcattcctgaggtgattgggaaggaaatcgagaaggccacatca 29749

                                                                         
Query: 688   agcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaag 747
             |||||||||||||| ||||| ||||  || ||||| || |||||||| |||||||| || 
Sbjct: 29748 agcatcttcccgcttcagaatgtgtttgtgcgcaaagtcaagatcctcaaggccccaaaa 29689

                                        
Query: 748   tttgacctgggaaagctcatggaggtg 774
             ||||||||||| ||||| |||||||||
Sbjct: 29688 tttgacctgggcaagcttatggaggtg 29662



 Score =  129 bits (65), Expect = 2e-26
 Identities = 122/141 (86%)
 Strand = Plus / Minus

                                                                         
Query: 245   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
             ||||||| ||||||||||| |||||||| |||||||| || ||  | |||||||||||||
Sbjct: 30374 agattgcttcagagggcctcaagcaccgtgtgtttgaggtctccttggctgatcttcaga 30315

                                                                         
Query: 305   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
             |||||||||| ||||| ||| | ||||||||||| ||||| ||||||||||| ||||  |
Sbjct: 30314 acgatgaggatcaggcgtaccgtaagatcagactacgtgccgaggatgtgcaggggaaaa 30255

                                  
Query: 365   atgtcctcacaaacttctggg 385
             |||| || |||||||||||||
Sbjct: 30254 atgttcttacaaacttctggg 30234



 Score = 87.7 bits (44), Expect = 8e-14
 Identities = 146/180 (81%)
 Strand = Plus / Minus

                                                                         
Query: 384   gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 443
             |||||||  |||||| || ||||||||||| ||  | || | ||| |||||||| || ||
Sbjct: 30163 gggcatgagtttcacgaccgacaagctcagatcattggtcaagaaatggcagacgctaat 30104

                                                                         
Query: 444   tgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattgg 503
              ||||||||||| ||||| ||||||||||| || |||||||| ||  | ||   ||||||
Sbjct: 30103 agaggctcatgtggatgtaaagaccactgataactacatgctgcgtctcttctgcattgg 30044

                                                                         
Query: 504   cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
             ||||||||||||  | ||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 30043 cttcaccaagaggaggccaaatcaagtcaaacggacatgctatgctcaagcaagccagat 29984



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                         
Query: 70    gcagcggcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagc 129
             |||||| || ||||||| ||||||||||||||||| ||||| ||||||| ||||||   |
Sbjct: 32964 gcagcgtcagccatggccgtcggcaagaacaagcggatctcgaaggggaagaagggatcc 32905

                      
Query: 130   aagaagaag 138
             |||||||||
Sbjct: 32904 aagaagaag 32896



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 205   aacgtcggcaagaccctcgtgtccaggacacaggg 239
             |||||||| ||||| ||||||||||||||||||||
Sbjct: 32717 aacgtcgggaagacgctcgtgtccaggacacaggg 32683



to top

>gb|DQ531623.1| Musa acuminata clone 3-169 ribosomal S3a mRNA, partial cds
          Length = 285

 Score =  139 bits (70), Expect = 2e-29
 Identities = 229/282 (81%)
 Strand = Plus / Plus

                                                                       
Query: 348 ggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaa 407
           ||||||||| |||| ||||||  | || ||||||||||||||| | || || ||||||||
Sbjct: 1   ggatgtgcaggggaagaatgttttgactaacttctggggcatgaacttaacaactgacaa 60

                                                                       
Query: 408 gctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 467
           | |||| |   | ||  ||| ||||| ||| || |||||||| ||||| ||||| |||||
Sbjct: 61  ggtcagatacatagtccggaggtggctgactctgattgaggcacatgtggatgtcaagac 120

                                                                       
Query: 468 cactgacaattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaacca 527
           ||||||||| ||||  ||||| ||||||   |||| |||||| |||||||| ||||| ||
Sbjct: 121 cactgacaactacactctccggatgttttgtattgccttcactaagagacgtccaaatca 180

                                                                       
Query: 528 ggtcaagcgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggt 587
           ||| || |||||||| || || ||| | ||||||||||||||||| ||||| ||||||  
Sbjct: 181 ggttaaacgcacttgttacgcccaatctagtcagatcagacagatacgccgcaagatgag 240

                                                     
Query: 588 tgagatcatggtcaaccaagctgcaagctgtgacttgaagga 629
            ||||| ||||||||||| ||| ||| ||||||| |||||||
Sbjct: 241 agagattatggtcaaccaggctacaacctgtgacctgaagga 282



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score =  139 bits (70), Expect = 2e-29
 Identities = 172/206 (83%)
 Strand = Plus / Minus

                                                                            
Query: 569      agatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaagg 628
                |||||||||||||||||||||||||||||| |||||| ||  |||  ||||||||||| |
Sbjct: 10823258 agatccgccggaagatggttgagatcatggccaaccaggcatcaacatgtgacttgaaag 10823199

                                                                            
Query: 629      agcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctcaa 688
                | || ||    || ||||||||||| || |||||||||||||| |||||| | || ||||
Sbjct: 10823198 aactggtttcaaaattcatccctgaagtcattggaaaggagatcgagaagtcaacttcaa 10823139

                                                                            
Query: 689      gcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagt 748
                | || ||||| ||||| || |||| | ||||||||||||||||| ||||||| |||||||
Sbjct: 10823138 gtatattccctctccaaaatgtgttcatccgcaaggtgaagatcttgaaggcaccgaagt 10823079

                                          
Query: 749      ttgacctgggaaagctcatggaggtg 774
                |||| || || ||| | |||||||||
Sbjct: 10823078 ttgatcttgggaagttgatggaggtg 10823053



 Score = 89.7 bits (45), Expect = 2e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                            
Query: 245      agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
                ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 10823785 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 10823726

                                                                            
Query: 305      acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
                | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 10823725 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 10823666

                                     
Query: 365      atgtcctcacaaacttctggg 385
                |||||||||| || |||||||
Sbjct: 10823665 atgtcctcacgaatttctggg 10823645



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                            
Query: 442      attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 501
                ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 10823493 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 10823434

                                                   
Query: 502      ggcttcaccaagagacgcccaaaccaggtcaagcg 536
                || ||||||||| | |||||||| ||||| |||||
Sbjct: 10823433 ggtttcaccaagcgccgcccaaatcaggtgaagcg 10823399



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                           
Query: 80       ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138
                ||||||| || |||||||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 10824694 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 10824636



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                            
Query: 155      ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 214
                |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 10824487 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 10824428

                                                
Query: 215      agaccctcgtgtccaggacacagggtaccaag 246
                |||||||||| |||||||| ||||| ||||||
Sbjct: 10824427 agaccctcgtctccaggacccaggggaccaag 10824396



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                   
Query: 770      aggtgcacggtgactacaaggaggatgttggtgtgaagcttgacaggcctg 820
                |||| ||||||||||||||||| ||||| ||| ||||||| ||||||||||
Sbjct: 10822152 aggtacacggtgactacaaggaagatgtcggtatgaagctggacaggcctg 10822102



to top

>dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1756_H07
          Length = 217205

 Score =  139 bits (70), Expect = 2e-29
 Identities = 172/206 (83%)
 Strand = Plus / Minus

                                                                         
Query: 569   agatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaagg 628
             |||||||||||||||||||||||||||||| |||||| ||  |||  ||||||||||| |
Sbjct: 29457 agatccgccggaagatggttgagatcatggccaaccaggcatcaacatgtgacttgaaag 29398

                                                                         
Query: 629   agcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctcaa 688
             | || ||    || ||||||||||| || |||||||||||||| |||||| | || ||||
Sbjct: 29397 aactggtttcaaaattcatccctgaagtcattggaaaggagatcgagaagtcaacttcaa 29338

                                                                         
Query: 689   gcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagt 748
             | || ||||| ||||| || |||| | ||||||||||||||||| ||||||| |||||||
Sbjct: 29337 gtatattccctctccaaaatgtgttcatccgcaaggtgaagatcttgaaggcaccgaagt 29278

                                       
Query: 749   ttgacctgggaaagctcatggaggtg 774
             |||| || || ||| | |||||||||
Sbjct: 29277 ttgatcttgggaagttgatggaggtg 29252



 Score = 89.7 bits (45), Expect = 2e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                         
Query: 245   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
             ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 29984 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 29925

                                                                         
Query: 305   acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
             | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 29924 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 29865

                                  
Query: 365   atgtcctcacaaacttctggg 385
             |||||||||| || |||||||
Sbjct: 29864 atgtcctcacgaatttctggg 29844



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                         
Query: 442   attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 501
             ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 29692 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 29633

                                                
Query: 502   ggcttcaccaagagacgcccaaaccaggtcaagcg 536
             || ||||||||| | |||||||| ||||| |||||
Sbjct: 29632 ggtttcaccaagcgccgcccaaatcaggtgaagcg 29598



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                        
Query: 80    ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138
             ||||||| || |||||||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 30893 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 30835



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                         
Query: 155   ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 214
             |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 30686 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 30627

                                             
Query: 215   agaccctcgtgtccaggacacagggtaccaag 246
             |||||||||| |||||||| ||||| ||||||
Sbjct: 30626 agaccctcgtctccaggacccaggggaccaag 30595



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                
Query: 770   aggtgcacggtgactacaaggaggatgttggtgtgaagcttgacaggcctg 820
             |||| ||||||||||||||||| ||||| ||| ||||||| ||||||||||
Sbjct: 28351 aggtacacggtgactacaaggaagatgtcggtatgaagctggacaggcctg 28301



to top

>dbj|AP004001.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OJ1115_D03
          Length = 169378

 Score =  139 bits (70), Expect = 2e-29
 Identities = 172/206 (83%)
 Strand = Plus / Minus

                                                                          
Query: 569    agatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaagg 628
              |||||||||||||||||||||||||||||| |||||| ||  |||  ||||||||||| |
Sbjct: 162739 agatccgccggaagatggttgagatcatggccaaccaggcatcaacatgtgacttgaaag 162680

                                                                          
Query: 629    agcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctcaa 688
              | || ||    || ||||||||||| || |||||||||||||| |||||| | || ||||
Sbjct: 162679 aactggtttcaaaattcatccctgaagtcattggaaaggagatcgagaagtcaacttcaa 162620

                                                                          
Query: 689    gcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagt 748
              | || ||||| ||||| || |||| | ||||||||||||||||| ||||||| |||||||
Sbjct: 162619 gtatattccctctccaaaatgtgttcatccgcaaggtgaagatcttgaaggcaccgaagt 162560

                                        
Query: 749    ttgacctgggaaagctcatggaggtg 774
              |||| || || ||| | |||||||||
Sbjct: 162559 ttgatcttgggaagttgatggaggtg 162534



 Score = 89.7 bits (45), Expect = 2e-14
 Identities = 117/141 (82%)
 Strand = Plus / Minus

                                                                          
Query: 245    agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
              ||||||| || ||||| || ||||| || || |||||||| ||  | || ||||||||||
Sbjct: 163266 agattgcatctgagggtctcaagcatcgtgtctttgaagtctccttggcggatcttcaga 163207

                                                                          
Query: 305    acgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaagggatga 364
              | || ||||| ||||| ||||||||| | ||||| |||||||||||||| || |||| ||
Sbjct: 163206 atgacgaggatcaggcttacaggaaggttagacttcgtgctgaggatgttcaggggagga 163147

                                   
Query: 365    atgtcctcacaaacttctggg 385
              |||||||||| || |||||||
Sbjct: 163146 atgtcctcacgaatttctggg 163126



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 80/95 (84%)
 Strand = Plus / Minus

                                                                          
Query: 442    attgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccatt 501
              ||||| || ||||| ||||| |||||||| || || |||||||||||| |||||  ||||
Sbjct: 162974 attgaagcccatgtggatgttaagaccacagataactacatgctccgcctgttttgcatt 162915

                                                 
Query: 502    ggcttcaccaagagacgcccaaaccaggtcaagcg 536
              || ||||||||| | |||||||| ||||| |||||
Sbjct: 162914 ggtttcaccaagcgccgcccaaatcaggtgaagcg 162880



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                         
Query: 80     ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138
              ||||||| || |||||||||||| | ||||||||||| |||||||| ||||||||||||
Sbjct: 164175 ccatggccgtgggcaagaacaagaggatctccaagggcaggaagggcagcaagaagaag 164117



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                          
Query: 155    ccaagaagcagtggtatgacatcaaggcgccgctgctcttcaccagccgcaacgtcggca 214
              |||||||| | ||||| |||||||||||||||    | ||| ||  ||||||| ||||||
Sbjct: 163968 ccaagaaggattggtacgacatcaaggcgccgaccgtgttctccgtccgcaacatcggca 163909

                                              
Query: 215    agaccctcgtgtccaggacacagggtaccaag 246
              |||||||||| |||||||| ||||| ||||||
Sbjct: 163908 agaccctcgtctccaggacccaggggaccaag 163877



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                                 
Query: 770    aggtgcacggtgactacaaggaggatgttggtgtgaagcttgacaggcctg 820
              |||| ||||||||||||||||| ||||| ||| ||||||| ||||||||||
Sbjct: 161633 aggtacacggtgactacaaggaagatgtcggtatgaagctggacaggcctg 161583



to top

>emb|AJ001342.1|ATCYC07 Arabidopsis thaliana mRNA for S-phase-specific ribosomal protein
          Length = 906

 Score =  139 bits (70), Expect = 2e-29
 Identities = 312/390 (80%), Gaps = 2/390 (0%)
 Strand = Plus / Plus

                                                                       
Query: 82  atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 141
           ||||| ||||| ||||||||| | || || ||||| ||||| ||  | ||||||||||| 
Sbjct: 1   atggctgtcgggaagaacaagaggatttcaaagggtaggaaaggaggaaagaagaaggct 60

                                                                       
Query: 142 gtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc-gctgctcttcaccag 200
           || ||||| ||| |||||||| | ||||||||| | ||||| || | | || ||||| | 
Sbjct: 61  gttgatcccttctccaagaaggattggtatgacgtgaaggctcctggttct-ttcacgaa 119

                                                                       
Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260
           | | || || || ||||| || || |||||||| |||||||||||||||||||| |||||
Sbjct: 120 caggaatgttgggaagactcttgtttccaggactcagggtaccaagattgcctctgaggg 179

                                                                       
Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggc 320
            ||||| ||| |||||||||| || ||||| |||||||| || || ||||||||  | ||
Sbjct: 180 actgaaacacagggtgtttgaggtttctcttgctgatctacaaaatgatgaggataatgc 239

                                                                       
Query: 321 ctacaggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaactt 380
           ||||||||||||| | ||  | ||||| ||||| || || | ||||||  | ||  | ||
Sbjct: 240 ctacaggaagatccgtcttagagctgaagatgttcagggaaggaatgtgttgacccagtt 299

                                                                       
Query: 381 ctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccct 440
           |||||| ||||||||||| || |||||||| |||||  | |||| ||||||||||||  |
Sbjct: 300 ctggggtatggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagacttt 359

                                         
Query: 441 cattgaggctcatgtcgatgtgaagaccac 470
            ||||| || |||||||||||||| |||||
Sbjct: 360 gattgaagcccatgtcgatgtgaaaaccac 389



 Score =  109 bits (55), Expect = 2e-20
 Identities = 170/206 (82%), Gaps = 3/206 (1%)
 Strand = Plus / Plus

                                                                       
Query: 616 tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
           |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 535 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 594

                                                                       
Query: 676 aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
           ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 595 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 654

                                                                       
Query: 736 aaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactaca-ag--gag 792
           ||||| || ||||||||||| |||||||||||||||||||| || || |||| ||  |||
Sbjct: 655 aaggctcccaagtttgaccttggaaagctcatggaggtgcatggagattacacagcagag 714

                                     
Query: 793 gatgttggtgtgaagcttgacaggcc 818
           ||||||||||||||| | ||||||||
Sbjct: 715 gatgttggtgtgaaggtagacaggcc 740



to top

>gb|DQ164221.1| Nicotiana tabacum cyc07 mRNA, complete cds
          Length = 786

 Score =  137 bits (69), Expect = 9e-29
 Identities = 210/257 (81%)
 Strand = Plus / Plus

                                                                       
Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264
           ||||| ||||||||||| ||  | ||||| |||||||| |||||||| || || || || 
Sbjct: 124 aacgttggcaagaccctggtcactaggactcagggtactaagattgcttcggaaggacta 183

                                                                       
Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324
           |||||| | || ||||||||   | | |||||||||||||| |||||||| ||  | | |
Sbjct: 184 aagcacagagtatttgaagtcagtttggctgatcttcagaaggatgaggatcaatctttc 243

                                                                       
Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384
           ||||||||| |  |  | || || ||||||||||||| ||||||||||||||||||||||
Sbjct: 244 aggaagatccgcttgagggcagaagatgtgcaagggaagaatgtcctcacaaacttctgg 303

                                                                       
Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444
           || ||||||||||| || |||||| | |||||||| || | ||||||||||||  | |||
Sbjct: 304 ggaatggatttcacaacagacaagttgaggtctctggtaaagaagtggcagacattgatt 363

                            
Query: 445 gaggctcatgtcgatgt 461
           ||||||||||| |||||
Sbjct: 364 gaggctcatgtggatgt 380



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 179/227 (78%)
 Strand = Plus / Plus

                                                                       
Query: 559 cagatcagacagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgt 618
           |||||| | |||||||| ||||| |||||||||||||||   ||||||||      ||||
Sbjct: 478 cagatccgtcagatccgtcggaaaatggttgagatcatgagaaaccaagcaagttcctgt 537

                                                                       
Query: 619 gacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaag 678
           |||||||||||| | ||    || ||||||||||||   ||||| |  ||||||||||| 
Sbjct: 538 gacttgaaggagttggtcgcaaaattcatccctgagtcaattggtagagagattgagaaa 597

                                                                       
Query: 679 gccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaag 738
           || || |||||||||||||| || || || || ||  | ||||| ||||||||||| |||
Sbjct: 598 gcgacttcaagcatcttcccactgcaaaatgtttatattcgcaaagtgaagatcctcaag 657

                                                          
Query: 739 gccccgaagtttgacctgggaaagctcatggaggtgcacggtgacta 785
           ||||| || |||||  | || ||||| |||||||| || ||||||||
Sbjct: 658 gccccaaaatttgatattggcaagctgatggaggttcatggtgacta 704



 Score = 50.1 bits (25), Expect = 0.017
 Identities = 82/101 (81%)
 Strand = Plus / Plus

                                                                       
Query: 82  atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 141
           ||||| ||||||||||||||| | || || ||||| | ||| ||  | ||||||||||| 
Sbjct: 1   atggctgtcggcaagaacaagaggatttcaaagggaaagaaaggaggaaagaagaaggcg 60

                                                    
Query: 142 gtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           | |||||||| | | |||||| | ||||||||||| |||||
Sbjct: 61  gcggatccgtacgcaaagaaggactggtatgacataaaggc 101



to top

>emb|BX826401.1|CNS0A38P Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZE07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 836

 Score =  137 bits (69), Expect = 9e-29
 Identities = 201/245 (82%)
 Strand = Plus / Plus

                                                                       
Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285
           |||||||| |||||||||||||||||||| ||||| ||||| ||| |||||||||| || 
Sbjct: 52  tccaggactcagggtaccaagattgcctctgagggactgaaacacagggtgtttgaggtt 111

                                                                       
Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345
           ||||| |||||||| || || ||||||||  | ||||||||||||||| | ||  | |||
Sbjct: 112 tctcttgctgatctacaaaatgatgaggataatgcctacaggaagatccgtcttagagct 171

                                                                       
Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405
           || ||||| || || | ||||||  | ||  | |||||||| ||||||||||| || |||
Sbjct: 172 gaagatgttcagggaaggaatgtgttgacccagttctggggtatggatttcacaaccgac 231

                                                                       
Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
           ||||| |||||  | |||| ||||||||||||  | ||||| || |||||||||||||| 
Sbjct: 232 aagctaaggtcattggtgaagaagtggcagactttgattgaagcccatgtcgatgtgaaa 291

                
Query: 466 accac 470
           |||||
Sbjct: 292 accac 296



 Score =  109 bits (55), Expect = 2e-20
 Identities = 170/206 (82%), Gaps = 3/206 (1%)
 Strand = Plus / Plus

                                                                       
Query: 616 tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
           |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 442 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 501

                                                                       
Query: 676 aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
           ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 502 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 561

                                                                       
Query: 736 aaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactaca-ag--gag 792
           ||||| || ||||||||||| |||||||||||||||||||| || || |||| ||  |||
Sbjct: 562 aaggctcccaagtttgaccttggaaagctcatggaggtgcatggagattacacagcagag 621

                                     
Query: 793 gatgttggtgtgaagcttgacaggcc 818
           ||||||||||||||| | ||||||||
Sbjct: 622 gatgttggtgtgaaggtagacaggcc 647



to top

>emb|Z25769.1|BRSPSG B.rapa mRNA for S phase specific gene
          Length = 1050

 Score =  131 bits (66), Expect = 6e-27
 Identities = 222/274 (81%)
 Strand = Plus / Plus

                                                                       
Query: 208 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 267
           ||||| ||||| || || ||||| || ||||||||||||||||| ||||||||  |||| 
Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291

                                                                       
Query: 268 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 327
           ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| ||||||
Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351

                                                                       
Query: 328 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 387
           |||||| | ||| | ||||| ||||| || || | ||||||| | ||  | |||||||| 
Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411

                                                                       
Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
           ||||| ||||| || ||||| ||||||||  | || | ||||||||||||  | || |||
Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471

                                             
Query: 448 gctcatgtcgatgtgaagaccactgacaattaca 481
            ||||||| ||||| |||||||||||||| ||||
Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505



 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 77  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136
           |||||||||| ||||| ||||||||| | ||||||||||| || |||||  |||||||||
Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160

                                                         
Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           ||   || ||||| ||| |||||||| | |||||||| ||||||||
Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 82/95 (86%), Gaps = 3/95 (3%)
 Strand = Plus / Plus

                                                                       
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactac 786
           |||||||| ||||| || ||||| |||||  ||||||| |||||||| ||||| ||||||
Sbjct: 754 aagatcctcaaggctcccaagttcgaccttagaaagcttatggaggttcacggagactac 813

                                              
Query: 787 a-ag--gaggatgttggtgtgaagcttgacaggcc 818
           | ||  |||||||||||||||||| ||||||||||
Sbjct: 814 acagcagaggatgttggtgtgaaggttgacaggcc 848



to top

>gb|DQ268835.1| Solanum tuberosum clone 115A11 cyc07-like protein mRNA, complete
           cds
          Length = 1020

 Score =  131 bits (66), Expect = 6e-27
 Identities = 195/238 (81%)
 Strand = Plus / Plus

                                                                       
Query: 230 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 289
           |||| |||||||| |||||||| ||||| || || |||||| | || ||||||||   | 
Sbjct: 192 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 251

                                                                       
Query: 290 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 349
           | |||||||||||||| |||||||| ||||| |||||||||||| |  |  | || || |
Sbjct: 252 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 311

                                                                       
Query: 350 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 409
           |||||||||||| |||||||||||||||||||   || ||||| ||||| || |||||| 
Sbjct: 312 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 371

                                                                     
Query: 410 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 467
           | |||||||| ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 372 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 429



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 111/141 (78%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtg 726
           ||||||||||| || || |||||||| || || ||||| || || ||  | ||||| || 
Sbjct: 629 gagattgagaaagctacttcaagcatttttccactccaaaatgtttatattcgcaaagtc 688

                                                                       
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactac 786
           |||||||| |||||||| || || || || || ||| | ||||||||||| || ||||| 
Sbjct: 689 aagatcctcaaggcccctaaattcgatcttggcaagttgatggaggtgcatggcgactat 748

                                
Query: 787 aaggaggatgttggtgtgaag 807
              || |||||||||||||||
Sbjct: 749 tcagaagatgttggtgtgaag 769



to top

>gb|DQ252490.1| Solanum tuberosum clone 059D09 cyc07-like mRNA, complete cds
          Length = 996

 Score =  131 bits (66), Expect = 6e-27
 Identities = 195/238 (81%)
 Strand = Plus / Plus

                                                                       
Query: 230 ggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctc 289
           |||| |||||||| |||||||| ||||| || || |||||| | || ||||||||   | 
Sbjct: 170 ggactcagggtactaagattgcttcagaaggactaaagcacagagtatttgaagtcagtt 229

                                                                       
Query: 290 tagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgagg 349
           | |||||||||||||| |||||||| ||||| |||||||||||| |  |  | || || |
Sbjct: 230 tggctgatcttcagaaggatgaggatcaggcttacaggaagatccgcttgagagcagaag 289

                                                                       
Query: 350 atgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagc 409
           |||||||||||| |||||||||||||||||||   || ||||| ||||| || |||||| 
Sbjct: 290 atgtgcaagggaggaatgtcctcacaaacttccatggaatggacttcacaacagacaagt 349

                                                                     
Query: 410 tcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagac 467
           | |||||||| ||| | |||||||||||  | |||||||||||||| ||||| |||||
Sbjct: 350 tgaggtctctggtgcgcaagtggcagactttgattgaggctcatgtggatgtcaagac 407



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 111/141 (78%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtg 726
           ||||||||||| || || |||||||| || || ||||| || || ||  | ||||| || 
Sbjct: 607 gagattgagaaagctacttcaagcatttttccactccaaaatgtttatattcgcaaagtc 666

                                                                       
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactac 786
           |||||||| |||||||| || || || || || ||| | ||||||||||| || ||||| 
Sbjct: 667 aagatcctcaaggcccctaaattcgatcttggcaagttgatggaggtgcatggcgactat 726

                                
Query: 787 aaggaggatgttggtgtgaag 807
              || |||||||||||||||
Sbjct: 727 tcagaagatgttggtgtgaag 747



to top

>gb|L23553.1|BRRSPSK Brassica rapa S-phase-specific (BIS289) mRNA, complete cds
          Length = 1050

 Score =  131 bits (66), Expect = 6e-27
 Identities = 222/274 (81%)
 Strand = Plus / Plus

                                                                       
Query: 208 gtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctgaag 267
           ||||| ||||| || || ||||| || ||||||||||||||||| ||||||||  |||| 
Sbjct: 232 gtcggaaagacacttgtttccagaactcagggtaccaagattgcatcagagggtttgaaa 291

                                                                       
Query: 268 caccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctacagg 327
           ||| | || ||||| || ||||| ||||||||| | || |||||||||||||| ||||||
Sbjct: 292 cacagagtctttgaggtgtctcttgctgatcttaacaaggatgaggaccaggcttacagg 351

                                                                       
Query: 328 aagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctggggc 387
           |||||| | ||| | ||||| ||||| || || | ||||||| | ||  | |||||||| 
Sbjct: 352 aagatccgtctcagagctgaagatgtccagggcaggaatgtcttgacccagttctggggt 411

                                                                       
Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
           ||||| ||||| || ||||| ||||||||  | || | ||||||||||||  | || |||
Sbjct: 412 atggacttcacaaccgacaaactcaggtccttggttaagaagtggcagactttgatcgag 471

                                             
Query: 448 gctcatgtcgatgtgaagaccactgacaattaca 481
            ||||||| ||||| |||||||||||||| ||||
Sbjct: 472 tctcatgttgatgttaagaccactgacaactaca 505



 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 77  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136
           |||||||||| ||||| ||||||||| | ||||||||||| || |||||  |||||||||
Sbjct: 101 caaccatggccgtcggtaagaacaagaggatctccaagggaagaaagggaggcaagaaga 160

                                                         
Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           ||   || ||||| ||| |||||||| | |||||||| ||||||||
Sbjct: 161 agattgttgatcctttcgccaagaaggattggtatgatatcaaggc 206



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 82/95 (86%), Gaps = 3/95 (3%)
 Strand = Plus / Plus

                                                                       
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactac 786
           |||||||| ||||| || ||||| |||||  ||||||| |||||||| ||||| ||||||
Sbjct: 754 aagatcctcaaggctcccaagttcgaccttagaaagcttatggaggttcacggagactac 813

                                              
Query: 787 a-ag--gaggatgttggtgtgaagcttgacaggcc 818
           | ||  |||||||||||||||||| ||||||||||
Sbjct: 814 acagcagaggatgttggtgtgaaggttgacaggcc 848



to top

>gb|DQ445133.1| Striga asiatica isolate St513 S phase protein mRNA, partial cds
          Length = 571

 Score =  123 bits (62), Expect = 1e-24
 Identities = 101/114 (88%)
 Strand = Plus / Plus

                                                                       
Query: 363 gaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctcttgt 422
           |||||| |||||||||||||||||||||||||||||||| |||||||| || ||||| ||
Sbjct: 123 gaatgttctcacaaacttctggggcatggatttcaccaccgacaagctgagatctctcgt 182

                                                                 
Query: 423 gaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaa 476
           |||||| |||||| | || |||||||||||||| ||||| ||||| || |||||
Sbjct: 183 gaggaaatggcagtcactaattgaggctcatgttgatgtcaagactaccgacaa 236



to top

>dbj|AB029635.1| Daucus carota mRNA for cyc07, complete cds
          Length = 1050

 Score =  119 bits (60), Expect = 2e-23
 Identities = 282/356 (79%)
 Strand = Plus / Plus

                                                                       
Query: 235 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 294
           ||||||||||||||||| || || || || || ||||| ||||| || || |  || |||
Sbjct: 175 cagggtaccaagattgcttctgaaggactcaaacaccgagtgttcgaggtttgccttgct 234

                                                                       
Query: 295 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 354
           || ||||||   |||||||||||||| || ||||||||  | ||  | || |||||||||
Sbjct: 235 gaccttcagggagatgaggaccaggcttataggaagattcgcctgagagcagaggatgtg 294

                                                                       
Query: 355 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 414
           ||||||| |||||| || ||||||||||  || ||||| ||||| ||||||||| | |||
Sbjct: 295 caagggaagaatgtgcttacaaacttctatggaatggacttcacaactgacaagttgagg 354

                                                                       
Query: 415 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 474
           ||||| ||  | ||||||||||| || ||||| |||||||| ||||||||||| ||||| 
Sbjct: 355 tctctggtacgcaagtggcagacactgattgaagctcatgtagatgtgaagacaactgat 414

                                                                       
Query: 475 aattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaag 534
           | ||| |  || || ||||||  |||||| || ||||||| |||  |||| |||   |||
Sbjct: 415 agttatactctgcgaatgttttgcattggatttaccaagaaacgtgcaaatcagcagaag 474

                                                                   
Query: 535 cgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttga 590
            | || |||||||| ||| | || |||||| | ||||| ||||| |||||||||||
Sbjct: 475 agaacctgctatgcccaatctagccagatccggcagattcgccgtaagatggttga 530



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                       
Query: 76  gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaag 135
           ||||||||||| ||||||||||||||| | ||||| ||||| | ||||||  ||||||||
Sbjct: 16  gcaaccatggctgtcggcaagaacaagaggatctcgaagggaaagaagggaggcaagaag 75

                
Query: 136 aaggc 140
           |||||
Sbjct: 76  aaggc 80



 Score = 54.0 bits (27), Expect = 0.001
 Identities = 114/143 (79%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtg 726
           ||||||||||| || || || ||||||||||| ||||| || || |   ||||||| || 
Sbjct: 607 gagattgagaaagcaacttcgagcatcttccctctccaaaatgtctttatccgcaaagtc 666

                                                                       
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactac 786
           ||||||||||| || || || |||||  | || ||  | |||||||| || |||||||||
Sbjct: 667 aagatcctgaaagcacctaaatttgatattggcaaattgatggaggttcatggtgactac 726

                                  
Query: 787 aaggaggatgttggtgtgaagct 809
              ||||||||||||||||||||
Sbjct: 727 tctgaggatgttggtgtgaagct 749



to top

>gb|DQ241862.1| Solanum tuberosum clone 027B03 40S ribosomal protein S3a-like mRNA,
           complete cds
          Length = 1118

 Score =  117 bits (59), Expect = 9e-23
 Identities = 212/263 (80%)
 Strand = Plus / Plus

                                                                       
Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||||||||| 
Sbjct: 210 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagagggccta 269

                                                                       
Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 270 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 329

                                                                       
Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384
           ||||| ||| |  |  | || || ||||||||||||| |||||| ||||||||||||   
Sbjct: 330 aggaaaatccgtttgagagcagaagatgtgcaagggaggaatgttctcacaaacttccat 389

                                                                       
Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 390 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 449

                                  
Query: 445 gaggctcatgtcgatgtgaagac 467
           ||||| ||||| ||||| |||||
Sbjct: 450 gaggcccatgttgatgtcaagac 472



 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 721 aaggtgaagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggt 780
           ||||| ||||||||||||||||| || |||||||| || ||||| |||||||| || |||
Sbjct: 726 aaggtcaagatcctgaaggcccctaaatttgacctaggcaagctgatggaggttcatggt 785

                                      
Query: 781 gactacaaggaggatgttggtgtgaag 807
           |||||    || |||||||||||||||
Sbjct: 786 gactattcagaagatgttggtgtgaag 812



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 83/102 (81%)
 Strand = Plus / Plus

                                                                       
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140
           |||||| ||||||||||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 86  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 145

                                                     
Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
            | |||||| |   | |||||| | ||||| |||||||||||
Sbjct: 146 ggcggatccttatgcaaagaaggactggtacgacatcaaggc 187



to top

>gb|AY643842.1|AY643842S1 Hordeum vulgare subsp. vulgare clone BAC 519K7 hardness locus region
          Length = 12998

 Score =  113 bits (57), Expect = 1e-21
 Identities = 81/89 (91%)
 Strand = Plus / Plus

                                                                        
Query: 432  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 491
            |||||||||||||||||||||||  ||||| ||||| |||||||| ||||||||||||||
Sbjct: 3401 gcagaccctcattgaggctcatgcagatgtcaagacaactgacaactacatgctccgcat 3460

                                         
Query: 492  gtttgccattggcttcaccaagagacgcc 520
            |||| ||| |||||||||||||| |||||
Sbjct: 3461 gtttcccactggcttcaccaagaaacgcc 3489



to top

>gb|DQ159867.1| Cymbidium faberi clone CDD-470 40s ribosomal protein S3 mRNA,
           partial cds
          Length = 462

 Score =  113 bits (57), Expect = 1e-21
 Identities = 132/157 (84%)
 Strand = Plus / Plus

                                                                       
Query: 664 aaggagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaag 723
           |||||||| |||||||| ||  | ||||||| ||| || ||||| || | | ||||||||
Sbjct: 13  aaggagatcgagaaggcgacaacgagcatctaccccctgcagaatgtattcatccgcaag 72

                                                                       
Query: 724 gtgaagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgac 783
           || |||||||| ||||| || |||||||| || ||||| ||||||||||| || || || 
Sbjct: 73  gttaagatcctcaaggctccaaagtttgatcttggaaaactcatggaggttcatggagat 132

                                                
Query: 784 tacaaggaggatgttggtgtgaagcttgacaggcctg 820
           |||||||| ||| ||||||||||||||||||||||||
Sbjct: 133 tacaaggaagattttggtgtgaagcttgacaggcctg 169



to top

>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus
              region
          Length = 160897

 Score =  111 bits (56), Expect = 5e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                          
Query: 433    cagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcatg 492
              |||||||||| |||||||||||  ||||| ||||| ||||||||||||||||| ||||||
Sbjct: 128530 cagaccctcagtgaggctcatgcagatgtcaagacaactgacaattacatgcttcgcatg 128471

                                          
Query: 493    tttgccattggcttcaccaagagacgcc 520
              ||||||||||||||||| |||| |||||
Sbjct: 128470 tttgccattggcttcacaaagaaacgcc 128443



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                  
Query: 432    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483
              ||||| |||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 128702 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 128651



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 432    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483
              ||||| |||||||||| ||||||| ||||| ||||| |||||||||||||||
Sbjct: 128758 gcagaacctcattgagactcatgtagatgtcaagacaactgacaattacatg 128707



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                  
Query: 432    gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483
              |||||||| |||||| |||||||| ||||| ||||| |||||||||||||||
Sbjct: 128814 gcagacccacattgaagctcatgtagatgtcaagacaactgacaattacatg 128763



to top

>gb|AF093109.1| Tortula ruralis ribosomal protein S3 (rps3) mRNA, complete cds
          Length = 899

 Score =  105 bits (53), Expect = 3e-19
 Identities = 143/173 (82%)
 Strand = Plus / Plus

                                                                       
Query: 301 cagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtgcaaggg 360
           |||||||||||||||||||| | | | |||||||  ||  | || ||||||||||| || 
Sbjct: 238 cagaacgatgaggaccaggctttccgcaagatcaagctgagggcggaggatgtgcagggc 297

                                                                       
Query: 361 atgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcaggtctctt 420
           | ||| || ||||| ||||||||||||||||| |||||||| ||||||||  ||||||| 
Sbjct: 298 aagaacgtgctcaccaacttctggggcatggacttcaccacggacaagctgcggtctctg 357

                                                                
Query: 421 gtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactga 473
           ||| | ||||||||||   | ||  ||||||| ||||||||||||||||||||
Sbjct: 358 gtgcgcaagtggcagagtttgatccaggctcacgtcgatgtgaagaccactga 410



 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 89/106 (83%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| ||||| ||| | |||||||| |||||||| | ||||||  ||||||||||  
Sbjct: 20  ccatggccgtcggaaaggataagcgcatttccaagggcaagaagggcggcaagaagaaaa 79

                                                         
Query: 140 ccgtggatccgttcaccaagaagcagtggtatgacatcaaggcgcc 185
             || ||||||||| |||||||| | ||||||||||||||||||||
Sbjct: 80  ttgtcgatccgttctccaagaaggactggtatgacatcaaggcgcc 125



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 639 caagttcatccctgaggtgattggaaaggagat 671
           |||||||||||| ||||| || |||||||||||
Sbjct: 570 caagttcatcccagaggtaatcggaaaggagat 602



to top

>emb|CT985361.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 893

 Score = 99.6 bits (50), Expect = 2e-17
 Identities = 347/446 (77%)
 Strand = Plus / Plus

                                                                       
Query: 235 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 294
           ||||||||||||||||| ||||| || || || ||| | |||||||| || ||  | |||
Sbjct: 226 cagggtaccaagattgcttcagaaggtctcaaacacagagtgtttgaggtgtcattggct 285

                                                                       
Query: 295 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 354
           || ||||||   ||||||||||| |||||||| |||||  | ||  |   ||| ||||| 
Sbjct: 286 gaccttcagggtgatgaggaccatgcctacagaaagattcgtctgaggagtgaagatgtt 345

                                                                       
Query: 355 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 414
           || || | ||||||| | || || |||||||| ||||| ||||| || || ||| | |||
Sbjct: 346 cagggaaggaatgtcttgactaatttctggggaatggacttcacaaccgataagttgagg 405

                                                                       
Query: 415 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 474
           ||  | ||||| || ||||||||  | ||||| |||||||| ||||||||||| || || 
Sbjct: 406 tccttggtgagaaaatggcagacattgattgaagctcatgttgatgtgaagacaacagat 465

                                                                       
Query: 475 aattacatgctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaag 534
           |||||||   |  | |||||   ||| ||||||||||||||||| ||||| |||||||||
Sbjct: 466 aattacactttgaggatgttctgcatcggcttcaccaagagacgtccaaatcaggtcaag 525

                                                                       
Query: 535 cgcacttgctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatc 594
            | || |||||||| ||| | || |||||||||||||| ||| ||||||||   || || 
Sbjct: 526 agaacctgctatgcgcaatccagccagatcagacagattcgcaggaagatgagggaaatt 585

                                                                       
Query: 595 atggtcaaccaagctgcaagctgtgacttgaaggagcttgtgaacaagttcatccctgag 654
           ||||||||||| ||  | |  || ||| |||||||  | || |  |||||||| ||||||
Sbjct: 586 atggtcaaccaggccactacttgcgacctgaaggaattggtcaggaagttcattcctgag 645

                                     
Query: 655 gtgattggaaaggagattgagaaggc 680
            ||||||| ||||| |||||||||||
Sbjct: 646 atgattgggaaggaaattgagaaggc 671



 Score = 89.7 bits (45), Expect = 2e-14
 Identities = 90/105 (85%)
 Strand = Plus / Plus

                                                                       
Query: 78  aaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137
           ||||||||| ||||| ||||||||| | || |||||||||| ||||||  ||||||||||
Sbjct: 69  aaccatggccgtcgggaagaacaagaggatttccaaggggaagaagggaggcaagaagaa 128

                                                        
Query: 138 ggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           ||| || ||||||||  |||||||| | |||||||| ||||||||
Sbjct: 129 ggcggtcgatccgttttccaagaaggactggtatgatatcaaggc 173



to top

>emb|CT982739.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 797

 Score = 99.6 bits (50), Expect = 2e-17
 Identities = 218/274 (79%)
 Strand = Plus / Plus

                                                                       
Query: 421 gtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattac 480
           ||||| || ||||||||  | ||||| |||||||| ||||||||||| || || ||||||
Sbjct: 80  gtgagaaaatggcagacattgattgaagctcatgttgatgtgaagacaacagataattac 139

                                                                       
Query: 481 atgctccgcatgtttgccattggcttcaccaagagacgcccaaaccaggtcaagcgcact 540
           |   |  | |||||   ||| ||||||||||||||||| ||||| ||||||||| | || 
Sbjct: 140 actttgaggatgttctgcatcggcttcaccaagagacgtccaaatcaggtcaagagaacc 199

                                                                       
Query: 541 tgctatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatcatggtc 600
           |||||||| ||| | || |||||||||||||| ||| ||||||||   || || ||||||
Sbjct: 200 tgctatgcgcaatccagccagatcagacagattcgcaggaagatgagggaaattatggtc 259

                                                                       
Query: 601 aaccaagctgcaagctgtgacttgaaggagcttgtgaacaagttcatccctgaggtgatt 660
           ||||| ||  | |  || ||| |||||||  | || |  |||||||| |||||| |||||
Sbjct: 260 aaccaggccactacttgcgacctgaaggaattggtcaggaagttcattcctgagatgatt 319

                                             
Query: 661 ggaaaggagattgagaaggccacctcaagcatct 694
           || ||||| ||||||||||| || ||||||||||
Sbjct: 320 gggaaggaaattgagaaggcaacatcaagcatct 353



to top

>gb|DQ268856.1| Solanum tuberosum clone 174A02 cyc07-like protein mRNA, complete
           cds
          Length = 1045

 Score = 93.7 bits (47), Expect = 1e-15
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 197 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 256

                                                                       
Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 257 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 316

                                                                       
Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 317 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 376

                                                                       
Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 377 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 436

                                  
Query: 445 gaggctcatgtcgatgtgaagac 467
           ||||| ||||| ||||| |||||
Sbjct: 437 gaggcccatgttgatgtaaagac 459



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 188/240 (78%)
 Strand = Plus / Plus

                                                                       
Query: 568 cagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaag 627
           ||||||||| |||||||||||||||| |||   ||||||||      |||||||||||||
Sbjct: 560 cagatccgcaggaagatggttgagattatgaggaaccaagcaagttcctgtgacttgaag 619

                                                                       
Query: 628 gagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctca 687
           ||| | ||    || |||||||||||    ||||| | ||||||||| || || || || 
Sbjct: 620 gagttagttgcaaaattcatccctgaatcaattggcagggagattgaaaaagcaacttcc 679

                                                                       
Query: 688 agcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaag 747
           ||||||||||| || || || || ||  | || ||||| |||||||| |||||||| || 
Sbjct: 680 agcatcttccccctacaaaatgtctatattcgaaaggtcaagatcctcaaggcccctaaa 739

                                                                       
Query: 748 tttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgttggtgtgaag 807
           |||||||| || ||||| |||||||| || ||||||||    || |||||||||||||||
Sbjct: 740 tttgaccttggcaagctgatggaggttcatggtgactattcagaagatgttggtgtgaag 799



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140
           |||||| ||||||||||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 73  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 132

                                                     
Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
            | |||||| | | | |||||| | ||||| |||||||||||
Sbjct: 133 ggcggatccttacgcaaagaaggactggtacgacatcaaggc 174



to top

>gb|DQ268849.1| Solanum tuberosum clone 155F06 cyc07-like protein mRNA, complete
           cds
          Length = 1038

 Score = 93.7 bits (47), Expect = 1e-15
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 181 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 240

                                                                       
Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 241 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 300

                                                                       
Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 301 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 360

                                                                       
Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 361 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 420

                                  
Query: 445 gaggctcatgtcgatgtgaagac 467
           ||||| ||||| ||||| |||||
Sbjct: 421 gaggcccatgttgatgtaaagac 443



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 188/240 (78%)
 Strand = Plus / Plus

                                                                       
Query: 568 cagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaag 627
           ||||||||| |||||||||||||||| |||   ||||||||      |||||||||||||
Sbjct: 544 cagatccgcaggaagatggttgagattatgaggaaccaagcaagttcctgtgacttgaag 603

                                                                       
Query: 628 gagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctca 687
           ||| | ||    || |||||||||||    ||||| | ||||||||| || || || || 
Sbjct: 604 gagttagttgcaaaattcatccctgaatcaattggcagggagattgaaaaagcaacttcc 663

                                                                       
Query: 688 agcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaag 747
           ||||||||||| || || || || ||  | || ||||| |||||||| |||||||| || 
Sbjct: 664 agcatcttccccctacaaaatgtctatattcgaaaggtcaagatcctcaaggcccctaaa 723

                                                                       
Query: 748 tttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgttggtgtgaag 807
           |||||||| || ||||| |||||||| || ||||||||    || |||||||||||||||
Sbjct: 724 tttgaccttggcaagctgatggaggttcatggtgactattcagaagatgttggtgtgaag 783



to top

>gb|DQ252485.1| Solanum tuberosum clone 048H05 cyc07-like mRNA, complete cds
          Length = 998

 Score = 93.7 bits (47), Expect = 1e-15
 Identities = 209/263 (79%)
 Strand = Plus / Plus

                                                                       
Query: 205 aacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagagggcctg 264
           ||||||||||| ||||| ||  ||||||| ||||||||||||||||| ||||| ||||| 
Sbjct: 157 aacgtcggcaaaacccttgttaccaggactcagggtaccaagattgcttcagatggccta 216

                                                                       
Query: 265 aagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgaggaccaggcctac 324
           || ||| | || ||||||||    || |||||||||||||| |||||||| ||||| | |
Sbjct: 217 aaacacagagtatttgaagttagcctggctgatcttcagaaggatgaggatcaggctttc 276

                                                                       
Query: 325 aggaagatcagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttctgg 384
           ||||| ||| |  |  | || || |||||||||||||  ||||| |||||||| |||   
Sbjct: 277 aggaaaatccgtttgagagcagaagatgtgcaagggagaaatgttctcacaaatttccat 336

                                                                       
Query: 385 ggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcatt 444
           || ||||||||||| || || ||| | |||||||| ||  | || ||||||||  | |||
Sbjct: 337 ggaatggatttcacaacagataagttgaggtctctggtccgcaaatggcagactttgatt 396

                                  
Query: 445 gaggctcatgtcgatgtgaagac 467
           ||||| ||||| ||||| |||||
Sbjct: 397 gaggcccatgttgatgtaaagac 419



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 188/240 (78%)
 Strand = Plus / Plus

                                                                       
Query: 568 cagatccgccggaagatggttgagatcatggtcaaccaagctgcaagctgtgacttgaag 627
           ||||||||| |||||||||||||||| |||   ||||||||      |||||||||||||
Sbjct: 520 cagatccgcaggaagatggttgagattatgaggaaccaagcaagttcctgtgacttgaag 579

                                                                       
Query: 628 gagcttgtgaacaagttcatccctgaggtgattggaaaggagattgagaaggccacctca 687
           ||| | ||    || |||||||||||    ||||| | ||||||||| || || || || 
Sbjct: 580 gagttagttgcaaaattcatccctgaatcaattggcagggagattgaaaaagcaacttcc 639

                                                                       
Query: 688 agcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaag 747
           ||||||||||| || || || || ||  | || ||||| |||||||| |||||||| || 
Sbjct: 640 agcatcttccccctacaaaatgtctatattcgaaaggtcaagatcctcaaggcccctaaa 699

                                                                       
Query: 748 tttgacctgggaaagctcatggaggtgcacggtgactacaaggaggatgttggtgtgaag 807
           |||||||| || ||||| |||||||| || ||||||||    || |||||||||||||||
Sbjct: 700 tttgaccttggcaagctgatggaggttcatggtgactattcagaagatgttggtgtgaag 759



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 84/102 (82%)
 Strand = Plus / Plus

                                                                       
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140
           |||||| ||||||||||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 33  catggccgtcggcaagaacaagaggatttccaagggaaagaagggaggaaagaagaaggc 92

                                                     
Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
            | |||||| | | | |||||| | ||||| |||||||||||
Sbjct: 93  ggcggatccttacgcaaagaaggactggtacgacatcaaggc 134



to top

>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82
          Length = 195165

 Score = 91.7 bits (46), Expect = 5e-15
 Identities = 130/158 (82%)
 Strand = Plus / Plus

                                                                        
Query: 616  tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
            |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 4650 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 4709

                                                                        
Query: 676  aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
            ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 4710 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 4769

                                                  
Query: 736  aaggccccgaagtttgacctgggaaagctcatggaggt 773
            ||||| || ||||||||||| |||||||||||||||||
Sbjct: 4770 aaggctcccaagtttgaccttggaaagctcatggaggt 4807



 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                        
Query: 245  agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
            |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 4117 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 4176

                                         
Query: 305  acgatgaggaccaggcctacaggaagatc 333
            | ||||||||  | |||||||||||||||
Sbjct: 4177 atgatgaggataatgcctacaggaagatc 4205



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 388  atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
            ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 4330 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 4389

                                   
Query: 448  gctcatgtcgatgtgaagaccac 470
            || |||||||||||||| |||||
Sbjct: 4390 gcccatgtcgatgtgaaaaccac 4412



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 790  gaggatgttggtgtgaagcttgacaggcc 818
            |||||||||||||||||| | ||||||||
Sbjct: 4923 gaggatgttggtgtgaaggtagacaggcc 4951



to top

>emb|AL161585.2|ATCHRIV81 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 81
          Length = 195921

 Score = 91.7 bits (46), Expect = 5e-15
 Identities = 130/158 (82%)
 Strand = Plus / Plus

                                                                          
Query: 616    tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
              |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 195571 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 195630

                                                                          
Query: 676    aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
              ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 195631 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 195690

                                                    
Query: 736    aaggccccgaagtttgacctgggaaagctcatggaggt 773
              ||||| || ||||||||||| |||||||||||||||||
Sbjct: 195691 aaggctcccaagtttgaccttggaaagctcatggaggt 195728



 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                          
Query: 245    agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
              |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 195038 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 195097

                                           
Query: 305    acgatgaggaccaggcctacaggaagatc 333
              | ||||||||  | |||||||||||||||
Sbjct: 195098 atgatgaggataatgcctacaggaagatc 195126



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                          
Query: 388    atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
              ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 195251 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 195310

                                     
Query: 448    gctcatgtcgatgtgaagaccac 470
              || |||||||||||||| |||||
Sbjct: 195311 gcccatgtcgatgtgaaaaccac 195333



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 790    gaggatgttggtgtgaagcttgacaggcc 818
              |||||||||||||||||| | ||||||||
Sbjct: 195844 gaggatgttggtgtgaaggtagacaggcc 195872



to top

>emb|AL023094.2|ATT4L20 Arabidopsis thaliana DNA chromosome 4, BAC clone T4L20 (ESSA project)
          Length = 125502

 Score = 91.7 bits (46), Expect = 5e-15
 Identities = 130/158 (82%)
 Strand = Plus / Plus

                                                                         
Query: 616   tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
             |||||| | |||||||| |||  |||||||||||| ||||  |||||||  |||||||||
Sbjct: 85882 tgtgacctcaaggagctagtggccaagttcatcccagaggccattggaagagagattgag 85941

                                                                         
Query: 676   aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
             ||||| ||     |||||| |||| | ||||| |||| | |||| || ||||||||||| 
Sbjct: 85942 aaggcaacacagggcatctacccgttgcagaatgtgttcatccgtaaagtgaagatccta 86001

                                                   
Query: 736   aaggccccgaagtttgacctgggaaagctcatggaggt 773
             ||||| || ||||||||||| |||||||||||||||||
Sbjct: 86002 aaggctcccaagtttgaccttggaaagctcatggaggt 86039



 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 76/89 (85%)
 Strand = Plus / Plus

                                                                         
Query: 245   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
             |||||||||| ||||| ||||| ||| |||||||||| || ||||| |||||||| || |
Sbjct: 85349 agattgcctctgagggactgaaacacagggtgtttgaggtttctcttgctgatctacaaa 85408

                                          
Query: 305   acgatgaggaccaggcctacaggaagatc 333
             | ||||||||  | |||||||||||||||
Sbjct: 85409 atgatgaggataatgcctacaggaagatc 85437



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 388   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
             ||||||||||| || |||||||| |||||  | |||| ||||||||||||  | ||||| 
Sbjct: 85562 atggatttcacaaccgacaagctaaggtcattggtgaagaagtggcagactttgattgaa 85621

                                    
Query: 448   gctcatgtcgatgtgaagaccac 470
             || |||||||||||||| |||||
Sbjct: 85622 gcccatgtcgatgtgaaaaccac 85644



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 790   gaggatgttggtgtgaagcttgacaggcc 818
             |||||||||||||||||| | ||||||||
Sbjct: 86155 gaggatgttggtgtgaaggtagacaggcc 86183



to top

>gb|AC189529.1| Brassica rapa subsp. pekinensis clone KBrB092P05, complete sequence
          Length = 145402

 Score = 85.7 bits (43), Expect = 3e-13
 Identities = 130/159 (81%)
 Strand = Plus / Plus

                                                                          
Query: 616    tgtgacttgaaggagcttgtgaacaagttcatccctgaggtgattggaaaggagattgag 675
              |||||| | ||||||||||||  ||||||||||||||||   || || |  || ||||||
Sbjct: 115934 tgtgaccttaaggagcttgtggccaagttcatccctgagtccatcgggagagatattgag 115993

                                                                          
Query: 676    aaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtgaagatcctg 735
              ||||||     |||||||| |||| | |||||||||| | |||| || || |||||||| 
Sbjct: 115994 aaggccgttcaaagcatctacccgttgcagaacgtgttcatccgtaaagtcaagatcctc 116053

                                                     
Query: 736    aaggccccgaagtttgacctgggaaagctcatggaggtg 774
              ||||| || ||||||||||| ||||||||||||||||||
Sbjct: 116054 aaggctcccaagtttgaccttggaaagctcatggaggtg 116092



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 74/88 (84%)
 Strand = Plus / Plus

                                                                          
Query: 388    atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
              ||||| ||||| || |||||||| |||||  | ||||  |||||||||||  | ||||| 
Sbjct: 115627 atggacttcacaaccgacaagctgaggtcgttggtgaaaaagtggcagacgttgattgaa 115686

                                          
Query: 448    gctcatgtcgatgtgaagaccactgaca 475
              || |||||||||||||||||||||||||
Sbjct: 115687 gcccatgtcgatgtgaagaccactgaca 115714



 Score = 50.1 bits (25), Expect = 0.017
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 499    attggcttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctca 551
              ||||| ||||||||||| ||  | |||||||||||||| ||||| ||||||||
Sbjct: 115738 attggtttcaccaagaggcgtgctaaccaggtcaagcgtacttgttatgctca 115790



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 145    gatccgttcaccaagaagcagtggtatgacatcaaggc 182
              ||||| ||| |||||||| | |||||||||||||||||
Sbjct: 115210 gatcctttctccaagaaggattggtatgacatcaaggc 115247



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 790    gaggatgttggtgtgaagcttgacaggcc 818
              |||||||||||||||||| | ||||||||
Sbjct: 116197 gaggatgttggtgtgaaggtagacaggcc 116225



to top

>emb|Z18417.1|ATTS0792 Arabidopsis thaliana transcribed sequence; clone GBGa463, 5' end;
           similar to Cyc07 protein, S-phase specific - Madagascar
          Length = 187

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 114/138 (82%)
 Strand = Plus / Plus

                                                                       
Query: 639 caagttcatccctgaggtgattggaaaggagattgagaaggccacctcaagcatcttccc 698
           |||||||||||| ||||  |||||||  |||||||||||||| ||     |||||| |||
Sbjct: 21  caagttcatcccagaggccattggaagagagattgagaaggcaacacagggcatctaccc 80

                                                                       
Query: 699 gctccagaacgtgtacgtccgcaaggtgaagatcctgaaggccccgaagtttgacctggg 758
           | | ||||| |||| | |||| || ||||||||||| ||||  || ||||||||||| ||
Sbjct: 81  gttgcagaatgtgttcatccgtaaagtgaagatcctaaaggatcccaagtttgaccttgg 140

                             
Query: 759 aaagctcatggaggtgca 776
           ||||||||||||||||||
Sbjct: 141 aaagctcatggaggtgca 158



to top

>dbj|AB023436.1| Hordeum vulgare DNA, down stream region of HvNAS1 gene
          Length = 10603

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 67/74 (90%), Gaps = 1/74 (1%)
 Strand = Plus / Minus

                                                                        
Query: 432  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatgctccgcat 491
            ||||||||||| |||||||||||  ||||| ||||| |||||||||| ||||||| ||||
Sbjct: 4956 gcagaccctcagtgaggctcatgcagatgtcaagacaactgacaatt-catgctctgcat 4898

                          
Query: 492  gtttgccattggct 505
            ||||||||||||||
Sbjct: 4897 gtttgccattggct 4884



 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                
Query: 432  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483
            ||||| |||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 5127 gcagaacctcattgaggctcatgtagatgtcaagacaactgacaattacatg 5076



 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 432  gcagaccctcattgaggctcatgtcgatgtgaagaccactgacaattacatg 483
            |||||||||||||||| ||||||| ||||| ||||| |||||||| ||||||
Sbjct: 5183 gcagaccctcattgagcctcatgtagatgtcaagacaactgacaaatacatg 5132



to top

>gb|AC146852.15| Medicago truncatula clone mth2-58k21, complete sequence
          Length = 145314

 Score = 81.8 bits (41), Expect = 5e-12
 Identities = 140/173 (80%)
 Strand = Plus / Plus

                                                                         
Query: 388   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
             |||||||| ||||| |||||||| |||||  | ||| | ||||||||||| |||||||| 
Sbjct: 48503 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 48562

                                                                         
Query: 448   gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 507
             |||||||| ||||| ||||||||||| || || |   |  | |||||   |||||| |||
Sbjct: 48563 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 48622

                                                                  
Query: 508   accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 560
             |||||||| ||| |||||||||| ||| | ||||| ||||| ||| |||||||
Sbjct: 48623 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 48675



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                       
Query: 639   caagttcatccctgaggtgattggaaaggagattgagaaggc 680
             |||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 49131 caagtttatccctgagatgattggaaaagagattgagaaggc 49172



 Score = 50.1 bits (25), Expect = 0.017
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 81    catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137
             |||||||||||| ||||||||| | || || ||||| | ||||||| ||||||||||
Sbjct: 47391 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 47447



to top

>gb|AC135320.6| Medicago truncatula clone mth2-28e9, complete sequence
          Length = 108644

 Score = 81.8 bits (41), Expect = 5e-12
 Identities = 140/173 (80%)
 Strand = Plus / Minus

                                                                         
Query: 388   atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
             |||||||| ||||| |||||||| |||||  | ||| | ||||||||||| |||||||| 
Sbjct: 42408 atggattttaccaccgacaagcttaggtcattggtgcgtaagtggcagactctcattgaa 42349

                                                                         
Query: 448   gctcatgtcgatgtgaagaccactgacaattacatgctccgcatgtttgccattggcttc 507
             |||||||| ||||| ||||||||||| || || |   |  | |||||   |||||| |||
Sbjct: 42348 gctcatgtggatgttaagaccactgataactatactttgagaatgttctgcattgggttc 42289

                                                                  
Query: 508   accaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtca 560
             |||||||| ||| |||||||||| ||| | ||||| ||||| ||| |||||||
Sbjct: 42288 accaagaggcgctcaaaccaggtgaagaggacttgttatgcccaatcaagtca 42236



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 639   caagttcatccctgaggtgattggaaaggagattgagaaggc 680
             |||||| ||||||||| |||||||||| ||||||||||||||
Sbjct: 41780 caagtttatccctgagatgattggaaaagagattgagaaggc 41739



 Score = 50.1 bits (25), Expect = 0.017
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                      
Query: 81    catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaa 137
             |||||||||||| ||||||||| | || || ||||| | ||||||| ||||||||||
Sbjct: 43520 catggcggtcggaaagaacaagagaatttcaaagggaaagaagggtggcaagaagaa 43464



to top

>dbj|AB116637.1| Lentinula edodes Le. cyc07 mRNA for putative S-phase specific
           ribosomal protein cyc07, complete cds
          Length = 980

 Score = 77.8 bits (39), Expect = 7e-11
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                       
Query: 388 atggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgag 447
           |||||||||||| | ||||||||  | ||||| ||  |||| |||||||| |||||||| 
Sbjct: 367 atggatttcacctccgacaagctgcgatctctcgtacggaaatggcagactctcattgaa 426

                                      
Query: 448 gctcatgtcgatgtgaagaccactgac 474
           || ||||||||||||||||||||||||
Sbjct: 427 gcccatgtcgatgtgaagaccactgac 453



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140
           |||||| || || |||||||||||| | || ||||| | |||||||| |||||| |||| 
Sbjct: 60  catggctgttggaaagaacaagcgcctttcgaagggcaagaagggtatcaagaaaaaggt 119

                                                         
Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggcgccg 186
           ||| ||||||||| |||  ||| | ||||| || ||||| ||||||
Sbjct: 120 cgtcgatccgttctccagaaaggactggtacgatatcaaagcgccg 165



to top

>gb|L31645.1|HNNSPSP Helianthus annuus ribosomal protein S3a mRNA, complete cds
          Length = 982

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 191/242 (78%)
 Strand = Plus / Plus

                                                                       
Query: 235 cagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagct 294
           |||||||| |||||||| || |||||  |||| || ||||||||||| || ||| | |||
Sbjct: 223 cagggtactaagattgcttccgagggattgaaacatcgggtgtttgaggtgtctttggct 282

                                                                       
Query: 295 gatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgctgaggatgtg 354
           ||||| ||||| ||||| || ||  ||||||| |||||| |  |  | ||||| || || 
Sbjct: 283 gatctccagaatgatgaagatcattcctacagaaagatccggttgagagctgaagacgtt 342

                                                                       
Query: 355 caagggatgaatgtcctcacaaacttctggggcatggatttcaccactgacaagctcagg 414
           ||||||| ||||||  | || || |||||||| |||||| | ||||| || |||||||||
Sbjct: 343 caagggaagaatgttttgaccaatttctggggtatggatgttaccacagataagctcagg 402

                                                                       
Query: 415 tctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccactgac 474
           || ||||||| ||| |||||| |  | || || || ||||||||||| ||||| || |||
Sbjct: 403 tcgcttgtgaagaaatggcagtctttgatcgaagcacatgtcgatgttaagacaaccgac 462

             
Query: 475 aa 476
           ||
Sbjct: 463 aa 464



to top

>gb|DQ268842.1| Solanum tuberosum clone 135C12 40S ribosomal protein S3a-like
           protein mRNA, complete cds
          Length = 1059

 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 232 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 291
           ||||||||||| |||||||| ||||| ||||||||||| || ||||||||||| ||  | 
Sbjct: 182 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgtttgaagtgtcattg 241

                         
Query: 292 gctgatcttcagaa 305
           ||||||||||||||
Sbjct: 242 gctgatcttcagaa 255



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 114/141 (80%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtg 726
           |||||||||||||| || |||||||||| |||  | ||||| |||| | | |||||||| 
Sbjct: 617 gagattgagaaggcaacttcaagcatctaccctttgcagaatgtgttcattcgcaaggtc 676

                                                                       
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactac 786
           |||||| ||||||| || || || ||||| || | | | |||||||| |||||||| |||
Sbjct: 677 aagatcttgaaggctcctaaattcgaccttgggaggttgatggaggttcacggtgattac 736

                                
Query: 787 aaggaggatgttggtgtgaag 807
              || |||||||||||||||
Sbjct: 737 tcagaagatgttggtgtgaag 757



to top

>ref|XM_001177407.1| PREDICTED: Strongylocentrotus purpuratus similar to v-fos
           transformation effector protein, transcript variant 1
           (LOC575056), mRNA
          Length = 770

 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 145 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 204

                                                                
Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 205 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 257



to top

>ref|XM_001177536.1| PREDICTED: Strongylocentrotus purpuratus similar to v-fos
           transformation effector protein, transcript variant 2
           (LOC575056), mRNA
          Length = 1029

 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 145 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 204

                                                                
Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 205 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 257



to top

>ref|XM_001179472.1| PREDICTED: Strongylocentrotus purpuratus similar to Rps3a protein
           (LOC757845), partial mRNA
          Length = 956

 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 61  ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 120

                                                                
Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 121 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 173



to top

>ref|XM_796644.2| PREDICTED: Strongylocentrotus purpuratus similar to v-fos
           transformation effector protein, transcript variant 2
           (LOC575056), mRNA
          Length = 770

 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 145 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 204

                                                                
Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 205 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 257



to top

>ref|XM_774945.2| PREDICTED: Strongylocentrotus purpuratus similar to v-fos
           transformation effector protein, transcript variant 1
           (LOC575056), mRNA
          Length = 1029

 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 145 ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 204

                                                                
Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 205 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 257



to top

>ref|XM_785062.2| PREDICTED: Strongylocentrotus purpuratus similar to v-fos
           transformation effector protein (LOC585229), partial
           mRNA
          Length = 292

 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                       
Query: 201 ccgcaacgtcggcaagaccctcgtgtccaggacacagggtaccaagattgcctcagaggg 260
           ||||||| |||||||||| |||||  ||||||||||||| || || || ||||| || ||
Sbjct: 61  ccgcaacatcggcaagactctcgtaaccaggacacagggaacaaaaatcgcctctgacgg 120

                                                                
Query: 261 cctgaagcaccgggtgtttgaagtatctctagctgatcttcagaacgatgagg 313
            ||||||   || |||||||| || ||||| |||||||| |||||||||||||
Sbjct: 121 tctgaagggacgtgtgtttgaggtctctctggctgatctgcagaacgatgagg 173



to top

>ref|NM_111356.3| Arabidopsis thaliana structural constituent of ribosome (AT3G04840)
           mRNA, complete cds
          Length = 1004

 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262

                                                                       
Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322

                                                                       
Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382

                                                                       
Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442

                           
Query: 466 accactgacaattaca 481
           ||||| |||| |||||
Sbjct: 443 accaccgacagttaca 458



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540

                                 
Query: 564 cagacagatccgccggaagatg 585
           | | ||||||||| ||||||||
Sbjct: 541 ccgtcagatccgcaggaagatg 562



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 57  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116

                                 
Query: 140 ccgtggatccgttcaccaagaa 161
           | || ||||| ||| |||||||
Sbjct: 117 ctgttgatcctttctccaagaa 138



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacgg 779
           |||||||| |||||||| || || ||||| || ||||||||||| || |||||
Sbjct: 704 aagatcctcaaggcccctaaattcgaccttggcaagctcatggatgttcacgg 756



to top

>gb|AY081585.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840) mRNA, complete cds
          Length = 870

 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 145 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 204

                                                                       
Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 205 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 264

                                                                       
Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 265 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 324

                                                                       
Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 325 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 384

                           
Query: 466 accactgacaattaca 481
           ||||| |||| |||||
Sbjct: 385 accaccgacagttaca 400



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 423 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 482

                                 
Query: 564 cagacagatccgccggaagatg 585
           | | ||||||||| ||||||||
Sbjct: 483 ccgtcagatccgcaggaagatg 504



 Score = 48.1 bits (24), Expect = 0.067
 Identities = 66/80 (82%)
 Strand = Plus / Plus

                                                                       
Query: 82  atggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggcc 141
           ||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||| 
Sbjct: 1   atggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaaggct 60

                               
Query: 142 gtggatccgttcaccaagaa 161
           || ||||| ||| |||||||
Sbjct: 61  gttgatcctttctccaagaa 80



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacgg 779
           |||||||| |||||||| || || ||||| || ||||||||||| || |||||
Sbjct: 646 aagatcctcaaggcccctaaattcgaccttggcaagctcatggatgttcacgg 698



to top

>gb|AY062796.1| Arabidopsis thaliana putative 40S ribosomal protein S3A (S phase
           specific) (At3g04840; T9J14.21) mRNA, complete cds
          Length = 1000

 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 202 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 261

                                                                       
Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 262 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 321

                                                                       
Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 322 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 381

                                                                       
Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 382 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 441

                           
Query: 466 accactgacaattaca 481
           ||||| |||| |||||
Sbjct: 442 accaccgacagttaca 457



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 480 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 539

                                 
Query: 564 cagacagatccgccggaagatg 585
           | | ||||||||| ||||||||
Sbjct: 540 ccgtcagatccgcaggaagatg 561



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 56  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 115

                                 
Query: 140 ccgtggatccgttcaccaagaa 161
           | || ||||| ||| |||||||
Sbjct: 116 ctgttgatcctttctccaagaa 137



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacgg 779
           |||||||| |||||||| || || ||||| || ||||||||||| || |||||
Sbjct: 703 aagatcctcaaggcccctaaattcgaccttggcaagctcatggatgttcacgg 755



to top

>gb|AY085787.1| Arabidopsis thaliana clone 18185 mRNA, complete sequence
          Length = 1001

 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 203 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 262

                                                                       
Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 263 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 322

                                                                       
Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 323 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 382

                                                                       
Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 383 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 442

                           
Query: 466 accactgacaattaca 481
           ||||| |||| |||||
Sbjct: 443 accaccgacagttaca 458



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 481 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 540

                                 
Query: 564 cagacagatccgccggaagatg 585
           | | ||||||||| ||||||||
Sbjct: 541 ccgtcagatccgcaggaagatg 562



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 68/82 (82%)
 Strand = Plus / Plus

                                                                       
Query: 80  ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaagg 139
           ||||||| ||||| || |||||| | ||||| ||||| ||||||||  | ||||||||||
Sbjct: 57  ccatggccgtcgggaaaaacaagagaatctctaagggtaggaagggaggaaagaagaagg 116

                                 
Query: 140 ccgtggatccgttcaccaagaa 161
           | || ||||| ||| |||||||
Sbjct: 117 ctgttgatcctttctccaagaa 138



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacgg 779
           |||||||| |||||||| || || ||||| || ||||||||||| || |||||
Sbjct: 704 aagatcctcaaggcccctaaattcgaccttggcaagctcatggatgttcacgg 756



to top

>emb|BX824488.1|CNS0A5KP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH51ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 927

 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 201/256 (78%)
 Strand = Plus / Plus

                                                                       
Query: 226 tccaggacacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagta 285
           ||||| || ||||||||||| ||||||||||| ||| |||| ||| | || ||||| || 
Sbjct: 135 tccagaactcagggtaccaaaattgcctcagaaggcttgaaacacagagtttttgaggtt 194

                                                                       
Query: 286 tctctagctgatcttcagaacgatgaggaccaggcctacaggaagatcagactccgtgct 345
           ||||| |||||||||||    ||||||||  | || |||||||||||| | ||| | |||
Sbjct: 195 tctcttgctgatcttcaaggtgatgaggataacgcttacaggaagatccgtctcagagct 254

                                                                       
Query: 346 gaggatgtgcaagggatgaatgtcctcacaaacttctggggcatggatttcaccactgac 405
           || ||||| || || | ||| || ||     | |||||||||||||| |||||||| || 
Sbjct: 255 gaagatgtccagggcaggaacgttctgtgccaattctggggcatggacttcaccaccgat 314

                                                                       
Query: 406 aagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaag 465
           || || |||||  | || | ||||||||||||  | |||||||||||||| ||||| || 
Sbjct: 315 aaacttaggtcattggttaagaagtggcagactttgattgaggctcatgttgatgttaaa 374

                           
Query: 466 accactgacaattaca 481
           ||||| |||| |||||
Sbjct: 375 accaccgacagttaca 390



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 413 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 472

                                 
Query: 564 cagacagatccgccggaagatg 585
           | | ||||||||| ||||||||
Sbjct: 473 ccgtcagatccgcaggaagatg 494



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                       
Query: 97  aacaagcgcatctccaaggggaggaagggtagcaagaagaaggccgtggatccgttcacc 156
           |||||| | ||||| ||||| ||||||||  | ||||||||||| || ||||| ||| ||
Sbjct: 6   aacaagagaatctctaagggtaggaagggaggaaagaagaaggctgttgatcctttctcc 65

                
Query: 157 aagaa 161
           |||||
Sbjct: 66  aagaa 70



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacgg 779
           |||||||| |||||||| || || ||||| || ||||||||||| || |||||
Sbjct: 636 aagatcctcaaggcccctaaattcgaccttggcaagctcatggatgttcacgg 688



to top

>dbj|D01058.1|CTRCYC07 Catharanthus roseus cyc07 mRNA, complete cds
          Length = 1100

 Score = 71.9 bits (36), Expect = 5e-09
 Identities = 84/100 (84%)
 Strand = Plus / Plus

                                                                       
Query: 376 aacttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcag 435
           ||||||||||| ||||| ||||| || || ||| | ||||||||||||||||||||||| 
Sbjct: 366 aacttctggggtatggacttcactacagataagttgaggtctcttgtgaggaagtggcaa 425

                                                   
Query: 436 accctcattgaggctcatgtcgatgtgaagaccactgaca 475
            || | || || |||||||| ||||| ||||| |||||||
Sbjct: 426 tccttgatagaagctcatgttgatgttaagacaactgaca 465



 Score = 52.0 bits (26), Expect = 0.004
 Identities = 86/106 (81%)
 Strand = Plus / Plus

                                                                       
Query: 77  caaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaaga 136
           |||||||||| ||||| ||||||||| | || || ||||| | ||| ||  | |||||||
Sbjct: 67  caaccatggccgtcggtaagaacaagaggatatcgaagggtaagaaaggaggaaagaaga 126

                                                         
Query: 137 aggccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           |||| | |||||| ||  |||||||| | |||||||| ||||||||
Sbjct: 127 aggcagcggatccatttgccaagaaggattggtatgatatcaaggc 172



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                       
Query: 544 tatgctcaagcaagtcagatcagacagatccgccggaagatggttgagatcatggtcaac 603
           ||||| ||| ||||||| ||| | ||||| || |||||||||   |||||||||||||||
Sbjct: 534 tatgcacaatcaagtcaaatccgccagattcgtcggaagatgcgggagatcatggtcaac 593

             
Query: 604 ca 605
           ||
Sbjct: 594 ca 595



to top

>gb|BT012853.1| Lycopersicon esculentum clone 113933F, mRNA sequence
          Length = 1053

 Score = 67.9 bits (34), Expect = 7e-08
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                       
Query: 232 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 291
           ||||||||||| |||||||| ||||| ||||||||||| || ||||| ||||| ||  | 
Sbjct: 222 acacagggtacaaagattgcttcagaaggcctgaagcatcgtgtgttcgaagtgtcattg 281

                         
Query: 292 gctgatcttcagaa 305
           ||||||||||||||
Sbjct: 282 gctgatcttcagaa 295



 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 113/141 (80%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtg 726
           |||||||||||||| || |||||||||| |||  | ||||| || | | | |||||||| 
Sbjct: 657 gagattgagaaggcaacttcaagcatctaccctttgcagaatgtattcattcgcaaggtc 716

                                                                       
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacggtgactac 786
           |||||| ||||||| || || |||||||| || | | | |||||||| |||||||| |||
Sbjct: 717 aagatcttgaaggctcctaaatttgaccttgggaggttgatggaggttcacggtgattac 776

                                
Query: 787 aaggaggatgttggtgtgaag 807
              || ||||| |||||||||
Sbjct: 777 tcagaagatgtcggtgtgaag 797



to top

>ref|XM_568980.1| Cryptococcus neoformans var. neoformans JEC21 40s ribosomal protein
           s3ae-a (s1-a) (CNB04880) partial mRNA
          Length = 826

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 86/104 (82%)
 Strand = Plus / Plus

                                                                       
Query: 79  accatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138
           |||||||| ||||||||||||||| |  | || ||||| | |||||| |  |||||||||
Sbjct: 10  accatggctgtcggcaagaacaagaggctttcaaagggaaagaagggaattaagaagaag 69

                                                       
Query: 139 gccgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
           | ||| || || ||||||| |||| ||||||| |||||||||||
Sbjct: 70  gtcgtcgaccccttcaccaggaaggagtggtacgacatcaaggc 113



to top

>emb|BX822077.1|CNS0A7LX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZB01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 716

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 85/103 (82%)
 Strand = Plus / Plus

                                                                       
Query: 379 ttctggggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagacc 438
           |||||||||||||| |||||||| || || || |||||  | || | |||||||||||| 
Sbjct: 68  ttctggggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagact 127

                                                      
Query: 439 ctcattgaggctcatgtcgatgtgaagaccactgacaattaca 481
            | |||||||||||||| ||||| || ||||| |||| |||||
Sbjct: 128 ttgattgaggctcatgttgatgttaaaaccaccgacagttaca 170



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 504 cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaagcaagtcagat 563
           |||||||||||||||  | |||||||||||| | |||||||| |||||| | || || ||
Sbjct: 193 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaatccagccaaat 252

                                 
Query: 564 cagacagatccgccggaagatg 585
           | | ||||||||| ||||||||
Sbjct: 253 ccgtcagatccgcaggaagatg 274



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 727 aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggtgcacgg 779
           |||||||| |||||||| || || ||||| || ||||||||||| || |||||
Sbjct: 416 aagatcctcaaggcccctaaattcgaccttggcaagctcatggatgttcacgg 468



to top

>ref|XM_001233016.1| PREDICTED: Gallus gallus ribosomal protein S3A, transcript variant
           2 (RPS3A), mRNA
          Length = 1038

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 79  accatggcggtcggcaagaacaagcgcatctccaaggg 116
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 195 accatggcggtcggcaagaacaagcgcctcaccaaggg 232



to top

>ref|XM_420443.2| PREDICTED: Gallus gallus ribosomal protein S3A, transcript variant
           3 (RPS3A), mRNA
          Length = 957

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 79  accatggcggtcggcaagaacaagcgcatctccaaggg 116
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 195 accatggcggtcggcaagaacaagcgcctcaccaaggg 232



to top

>ref|XM_001232989.1| PREDICTED: Gallus gallus ribosomal protein S3A, transcript variant
           1 (RPS3A), mRNA
          Length = 1038

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 79  accatggcggtcggcaagaacaagcgcatctccaaggg 116
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 195 accatggcggtcggcaagaacaagcgcctcaccaaggg 232



to top

>emb|AJ720257.1| Gallus gallus partial mRNA for hypothetical protein, clone 13j13
          Length = 107

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 79  accatggcggtcggcaagaacaagcgcatctccaaggg 116
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgcctcaccaaggg 60



to top

>gb|AF042107.1|AF042107 Eimeria tenella ribosomal protein S3a mRNA, complete cds
          Length = 858

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 79  accatggcggtcggcaagaacaagcgcatctccaaggg 116
           ||||||||||||||||||||||||||| || |||||||
Sbjct: 4   accatggcggtcggcaagaacaagcgcctcaccaaggg 41



to top

>ref|XM_001218105.1| Aspergillus terreus NIH2624 40S ribosomal protein S3aE (ATEG_09484)
           mRNA, complete cds
          Length = 771

 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 74/89 (83%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaagcatcttcccgctccagaacgtgtacgtccgcaaggtg 726
           ||||| ||||||||||||    |||||| ||| |||||||||||  || |||||||||| 
Sbjct: 586 gagatcgagaaggccacccagggcatctaccctctccagaacgtccacatccgcaaggtc 645

                                        
Query: 727 aagatcctgaaggccccgaagtttgacct 755
           ||| |||||||| |||| ||||| |||||
Sbjct: 646 aagctcctgaagtcccccaagttcgacct 674



 Score = 46.1 bits (23), Expect = 0.26
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 496 gccattggcttcaccaagagacgcccaaaccaggtcaag 534
           |||||||  ||||||||||||||||| |||||| |||||
Sbjct: 415 gccattgctttcaccaagagacgccccaaccagatcaag 453



to top

>gb|AY373965.1| Hyaloperonospora parasitica clone 72T-2G4 mRNA sequence
          Length = 157

 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 53/61 (86%)
 Strand = Plus / Plus

                                                                       
Query: 76  gcaaccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaag 135
           |||| |||||| ||||| |||||||||||| |||| ||||| | |||||||| |||||||
Sbjct: 69  gcaatcatggctgtcggaaagaacaagcgcctctcaaagggaaagaagggtatcaagaag 128

            
Query: 136 a 136
           |
Sbjct: 129 a 129



to top

>gb|AY857460.1| Suberites domuncula S3a mRNA, complete cds
          Length = 759

 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                       
Query: 397 accactgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtc 456
           ||||| ||||| |||||| | ||||| | ||| |||||||| || ||||||||  |||||
Sbjct: 313 accacagacaaactcagggcacttgtaaagaaatggcagactctgattgaggccaatgtc 372

                            
Query: 457 gatgtgaagaccactga 473
           ||||||||||| |||||
Sbjct: 373 gatgtgaagacaactga 389



to top

>dbj|D26058.1|CTRCYC07A Catharanthus roseus cyc07 gene, exon1-7, complete cds
          Length = 4798

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                        
Query: 412  aggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgtgaagaccact 471
            |||||||||||||||||||||||  || | || || |||||||| ||||| ||||| |||
Sbjct: 3458 aggtctcttgtgaggaagtggcaatccttgatagaagctcatgttgatgttaagacaact 3517

                
Query: 472  gaca 475
            ||||
Sbjct: 3518 gaca 3521



to top

>gb|AC189329.1| Brassica rapa subsp. pekinensis clone KBrB037C07, complete sequence
          Length = 103109

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 80   ccatggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaag 138
            ||||||| ||||| ||||||||||| |||||||| || || |||||  |||||||||||
Sbjct: 8502 ccatggccgtcgggaagaacaagcgaatctccaaaggaagaaagggaggcaagaagaag 8560



 Score = 50.1 bits (25), Expect = 0.017
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 790  gaggatgttggtgtgaagcttgacaggcc 818
            |||||||||||||||||| ||||||||||
Sbjct: 9726 gaggatgttggtgtgaaggttgacaggcc 9754



 Score = 46.1 bits (23), Expect = 0.26
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 727  aagatcctgaaggccccgaagtttgacctgggaaagctcatggaggt 773
            |||||||| ||||| || || || ||||| |||||||||||||||||
Sbjct: 9560 aagatcctcaaggctcccaaattcgaccttggaaagctcatggaggt 9606



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 145  gatccgttcaccaagaagcagtggtatgacatcaaggc 182
            ||||| ||| |||||||| | |||||||||||||||||
Sbjct: 8662 gatcctttctccaagaaggattggtatgacatcaaggc 8699



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 72/89 (80%)
 Strand = Plus / Plus

                                                                        
Query: 245  agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttcaga 304
            ||||||| ||||||||  |||| ||| | |||||||| || ||||| |||||||| ||  
Sbjct: 8917 agattgcatcagagggtttgaaacacagagtgtttgaggtttctcttgctgatctccaag 8976

                                         
Query: 305  acgatgaggaccaggcctacaggaagatc 333
              ||||||||| | || ||||||||||||
Sbjct: 8977 gtgatgaggacaacgcttacaggaagatc 9005



to top

>ref|XR_002919.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC544977), mRNA
          Length = 895

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XM_974769.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC674452), mRNA
          Length = 889

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XM_994545.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC668144), mRNA
          Length = 889

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>ref|XR_002253.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC668799), mRNA
          Length = 847

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 8   accatggcggtcggcaagaacaagcgc 34



to top

>ref|XR_005031.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC677290), mRNA
          Length = 853

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 8   accatggcggtcggcaagaacaagcgc 34



to top

>emb|CT571277.10| Mouse DNA sequence from clone RP24-327L5 on chromosome 14, complete
             sequence
          Length = 142749

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             |||||||||||||||||||||||||||
Sbjct: 34612 accatggcggtcggcaagaacaagcgc 34586



to top

>gb|BC106115.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:117914
           IMAGE:2599128), complete cds
          Length = 870

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 12  accatggcggtcggcaagaacaagcgc 38



to top

>gb|AC156571.3| Mus musculus BAC clone RP23-264I19 from chromosome 13, complete
             sequence
          Length = 196911

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             |||||||||||||||||||||||||||
Sbjct: 22654 accatggcggtcggcaagaacaagcgc 22628



to top

>gb|AC133508.3| Mus musculus BAC clone RP23-383K24 from chromosome 3, complete sequence
          Length = 192136

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             |||||||||||||||||||||||||||
Sbjct: 21193 accatggcggtcggcaagaacaagcgc 21219



to top

>gb|AC104414.8| Mus musculus chromosome 3, clone RP23-99I7, complete sequence
          Length = 212613

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             |||||||||||||||||||||||||||
Sbjct: 81045 accatggcggtcggcaagaacaagcgc 81019



to top

>gb|BC084675.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102469
           IMAGE:5319512), complete cds
          Length = 869

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 14  accatggcggtcggcaagaacaagcgc 40



to top

>gb|BC083338.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102070
           IMAGE:6820218), complete cds
          Length = 861

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 3   accatggcggtcggcaagaacaagcgc 29



to top

>ref|XM_863937.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 1 (LOC613340), mRNA
          Length = 910

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 32  accatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_871858.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 4 (LOC613340), mRNA
          Length = 872

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 31  accatggcggtcggcaagaacaagcgc 57



to top

>ref|XM_871665.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 3 (LOC613340), mRNA
          Length = 587

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_871576.1| PREDICTED: Bos taurus similar to ribosomal protein S3a, transcript
           variant 2 (LOC613340), mRNA
          Length = 717

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 6   accatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_872846.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 6
           (LOC613460), mRNA
          Length = 918

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872754.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 5
           (LOC613460), mRNA
          Length = 862

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_593124.2| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 2
           (LOC613460), mRNA
          Length = 876

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>ref|XM_872539.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 4
           (LOC613460), mRNA
          Length = 584

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 17  accatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_872447.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 3
           (LOC613460), mRNA
          Length = 714

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 6   accatggcggtcggcaagaacaagcgc 32



to top

>gb|BC081451.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:102071
           IMAGE:6824188), complete cds
          Length = 872

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 10  accatggcggtcggcaagaacaagcgc 36



to top

>dbj|AK146304.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730048K19 product:ribosomal protein S3a, full
           insert sequence
          Length = 871

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 31  accatggcggtcggcaagaacaagcgc 57



to top

>dbj|AK135318.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720473N01 product:ribosomal protein S3a, full
           insert sequence
          Length = 864

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK151982.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830044H24 product:ribosomal
           protein S3a, full insert sequence
          Length = 873

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK150814.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015K17 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK150796.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830015H22 product:ribosomal
           protein S3a, full insert sequence
          Length = 873

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 33  accatggcggtcggcaagaacaagcgc 59



to top

>dbj|AK148513.1| Mus musculus adult pancreas islet cells cDNA, RIKEN full-length
           enriched library, clone:C820015M15 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK151429.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830030B03 product:ribosomal
           protein S3a, full insert sequence
          Length = 864

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK150441.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830007K16 product:ribosomal
           protein S3a, full insert sequence
          Length = 862

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK166713.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0005O17 product:40S ribosomal protein
           S3a homolog [Mus musculus], full insert sequence
          Length = 865

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK153480.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830165N20 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK167562.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530022H01
           product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 22  accatggcggtcggcaagaacaagcgc 48



to top

>dbj|AK167512.1| Mus musculus 11 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530018C11
           product:ribosomal protein S3a, full insert sequence
          Length = 870

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 24  accatggcggtcggcaagaacaagcgc 50



to top

>dbj|AK159777.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420030N20 product:ribosomal protein S3a,
           full insert sequence
          Length = 869

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK168240.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730070G06 product:ribosomal protein S3a, full
           insert sequence
          Length = 868

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 21  accatggcggtcggcaagaacaagcgc 47



to top

>dbj|AK010605.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410029J05 product:ribosomal protein S3a, full
           insert sequence
          Length = 860

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>ref|NM_016959.2| Mus musculus ribosomal protein S3a (Rps3a), mRNA
 dbj|AK003158.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001E09 product:ribosomal
           protein S3a, full insert sequence
          Length = 863

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK088113.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:E430004H05
           product:ribosomal protein S3a, full insert sequence
          Length = 860

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>dbj|AK050610.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN
           full-length enriched library, clone:C920016J02
           product:ribosomal protein S3a, full insert sequence
          Length = 862

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 23  accatggcggtcggcaagaacaagcgc 49



to top

>dbj|AK012345.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700038N16 product:ribosomal
           protein S3a, full insert sequence
          Length = 860

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 20  accatggcggtcggcaagaacaagcgc 46



to top

>emb|Z83368.1|MMRPS3A M.musculus RPS3a gene
          Length = 5695

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 842 accatggcggtcggcaagaacaagcgc 868



to top

>gb|BC039659.1| Mus musculus ribosomal protein S3a, mRNA (cDNA clone MGC:49186
           IMAGE:5025347), complete cds
          Length = 877

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 22  accatggcggtcggcaagaacaagcgc 48



to top

>gb|AC112969.12| Mus musculus chromosome 8, clone RP24-331K7, complete sequence
          Length = 164201

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             |||||||||||||||||||||||||||
Sbjct: 92495 accatggcggtcggcaagaacaagcgc 92469



to top

>dbj|AK196258.1| Mus musculus cDNA, clone:Y1G0121E15, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000029722, based on BLAT search
          Length = 282

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||||||
Sbjct: 9   accatggcggtcggcaagaacaagcgc 35



to top

>emb|AL691416.9| Mouse DNA sequence from clone RP23-110I8 on chromosome 2, complete
              sequence
          Length = 208363

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                         
Query: 79     accatggcggtcggcaagaacaagcgc 105
              |||||||||||||||||||||||||||
Sbjct: 155043 accatggcggtcggcaagaacaagcgc 155017



to top

>ref|XM_862533.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 10 (RPS3A), mRNA
          Length = 1065

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_862525.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 9 (RPS3A), mRNA
          Length = 1056

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 50  ccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862515.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 8 (RPS3A), mRNA
          Length = 982

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862504.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 7 (RPS3A), mRNA
          Length = 912

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_862496.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 6 (RPS3A), mRNA
          Length = 876

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 20  ccatggcggtcggcaagaacaagcgc 45



to top

>ref|XM_862563.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 13 (RPS3A), mRNA
          Length = 1051

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 7   ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862552.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 12 (RPS3A), mRNA
          Length = 1051

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 7   ccatggcggtcggcaagaacaagcgc 32



to top

>ref|XM_862541.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 11 (RPS3A), mRNA
          Length = 852

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 51  ccatggcggtcggcaagaacaagcgc 76



to top

>ref|XM_862454.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 3 (RPS3A), mRNA
          Length = 774

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 50  ccatggcggtcggcaagaacaagcgc 75



to top

>ref|XM_862446.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 2 (RPS3A), mRNA
          Length = 553

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_534275.2| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 1 (RPS3A), mRNA
          Length = 1106

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 62  ccatggcggtcggcaagaacaagcgc 87



to top

>ref|XM_862466.1| PREDICTED: Canis familiaris Ribosomal protein S3A, transcript
           variant 4 (RPS3A), mRNA
          Length = 769

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 17  ccatggcggtcggcaagaacaagcgc 42



to top

>ref|XM_860742.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 7 (LOC609500), mRNA
          Length = 875

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860726.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC609500), mRNA
          Length = 857

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860710.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC609500), mRNA
          Length = 866

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860701.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC609500), mRNA
          Length = 1072

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_860686.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC609500), mRNA
          Length = 879

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 21  ccatggcggtcggcaagaacaagcgc 46



to top

>ref|XM_847366.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC609500), mRNA
          Length = 1069

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>ref|XM_860652.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC609500), mRNA
          Length = 760

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 16  ccatggcggtcggcaagaacaagcgc 41



to top

>ref|XM_856573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 8 (LOC608454), mRNA
          Length = 883

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856546.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 7 (LOC608454), mRNA
          Length = 882

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856691.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 12 (LOC608454), mRNA
          Length = 874

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856663.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 11 (LOC608454), mRNA
          Length = 875

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856635.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 10 (LOC608454), mRNA
          Length = 879

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856605.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 9 (LOC608454), mRNA
          Length = 883

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_856515.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 6 (LOC608454), mRNA
          Length = 1042

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 10  ccatggcggtcggcaagaacaagcgc 35



to top

>ref|XM_856484.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 5 (LOC608454), mRNA
          Length = 1047

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 15  ccatggcggtcggcaagaacaagcgc 40



to top

>ref|XM_856455.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC608454), mRNA
          Length = 1080

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 33  ccatggcggtcggcaagaacaagcgc 58



to top

>ref|XM_845382.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 2 (LOC608454), mRNA
          Length = 1058

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 26  ccatggcggtcggcaagaacaagcgc 51



to top

>ref|XM_856398.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 3 (LOC608454), mRNA
          Length = 901

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 19  ccatggcggtcggcaagaacaagcgc 44



to top

>ref|XM_535263.2| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC608454), mRNA
          Length = 759

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           ||||||||||||||||||||||||||
Sbjct: 18  ccatggcggtcggcaagaacaagcgc 43



to top

>gb|AC009465.7|AC009465 Arabidopsis thaliana chromosome 3 BAC T9J14 genomic sequence, complete
             sequence
          Length = 93234

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                         
Query: 384   gggcatggatttcaccactgacaagctcaggtctcttgtgaggaagtggcagaccctcat 443
             ||||||||| |||||||| || || || |||||  | || | ||||||||||||  | ||
Sbjct: 74315 gggcatggacttcaccaccgataaacttaggtcattggttaagaagtggcagactttgat 74256

                                                   
Query: 444   tgaggctcatgtcgatgtgaagaccactgacaattaca 481
             |||||||||||| ||||| || ||||| |||| |||||
Sbjct: 74255 tgaggctcatgttgatgttaaaaccaccgacagttaca 74218



 Score = 50.1 bits (25), Expect = 0.017
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 504   cttcaccaagagacgcccaaaccaggtcaagcgcacttgctatgctcaa 552
             |||||||||||||||  | |||||||||||| | |||||||| ||||||
Sbjct: 74195 cttcaccaagagacgtgctaaccaggtcaagaggacttgctacgctcaa 74147



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 245   agattgcctcagagggcctgaagcaccgggtgtttgaagtatctctagctgatcttca 302
             ||||||||||||| ||| |||| ||| | || ||||| || ||||| |||||||||||
Sbjct: 74563 agattgcctcagaaggcttgaaacacagagtttttgaggtttctcttgctgatcttca 74506



to top

>emb|X68555.1|ACKRPA A.californica KRP-A gene
          Length = 849

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 402 tgacaagctcaggtctcttgtgaggaagtggcagaccctcattgaggctcatgtcgatgt 461
           |||||||||| | ||| | |||| |||||||||||| || ||||||||  |||| |||||
Sbjct: 330 tgacaagctctgctctatggtgaagaagtggcagactcttattgaggccaatgttgatgt 389

                 
Query: 462 gaagac 467
           ||||||
Sbjct: 390 gaagac 395



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 292 gctgatcttcagaacgatgagg 313
           ||||||||||||||||||||||
Sbjct: 223 gctgatcttcagaacgatgagg 244



to top

>gb|AY850276.1| Periplaneta americana Parcxpwex01 mRNA, complete cds
          Length = 893

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                       
Query: 232 acacagggtaccaagattgcctcagagggcctgaagcaccgggtgtttgaagtatctcta 291
           |||||||| || |||||||| ||||||||  ||||| || | ||||||||||| ||||| 
Sbjct: 162 acacagggcacaaagattgcgtcagagggtttgaagtacagagtgtttgaagtgtctctg 221

                 
Query: 292 gctgat 297
           ||||||
Sbjct: 222 gctgat 227



to top

>ref|XM_370422.1| Magnaporthe grisea 70-15 chromosome II hypothetical protein
           (MG06919.4) partial mRNA
          Length = 771

 Score = 50.1 bits (25), Expect = 0.017
 Identities = 63/73 (86%), Gaps = 2/73 (2%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaa-gcatcttcccgctccagaacgtgtacgtccgcaaggt 725
           |||||||||||||||| ||||| |||||| ||| || ||||||||| || ||||||||||
Sbjct: 586 gagattgagaaggcca-ctcaaggcatctaccccctgcagaacgtgcacatccgcaaggt 644

                        
Query: 726 gaagatcctgaag 738
            ||| | ||||||
Sbjct: 645 taagctgctgaag 657



to top

>gb|BC058483.1| Rattus norvegicus ribosomal protein S3a, mRNA (cDNA clone MGC:72868
           IMAGE:6887884), complete cds
          Length = 896

 Score = 50.1 bits (25), Expect = 0.017
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 375 aagtggcagaccatgattgaagctcatgttgatgtgaagac 415



 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||| ||||||||||||
Sbjct: 27  accatggcggtcgggaagaacaagcgc 53



to top

>gb|AY151152.1| Ilyanassa obsoleta 40S ribosomal protein-like protein mRNA, partial
           cds
          Length = 489

 Score = 50.1 bits (25), Expect = 0.017
 Identities = 40/45 (88%)
 Strand = Plus / Plus

                                                        
Query: 426 gaagtggcagaccctcattgaggctcatgtcgatgtgaagaccac 470
           ||||||||||||||| || ||||| ||||| || |||||||||||
Sbjct: 36  gaagtggcagaccctgatcgaggcccatgtggacgtgaagaccac 80



to top

>gb|AY849647.1| Magnaporthe grisea 40S ribosomal protein S1-like protein mRNA,
           complete cds
          Length = 1110

 Score = 50.1 bits (25), Expect = 0.017
 Identities = 63/73 (86%), Gaps = 2/73 (2%)
 Strand = Plus / Plus

                                                                       
Query: 667 gagattgagaaggccacctcaa-gcatcttcccgctccagaacgtgtacgtccgcaaggt 725
           |||||||||||||||| ||||| |||||| ||| || ||||||||| || ||||||||||
Sbjct: 680 gagattgagaaggcca-ctcaaggcatctaccccctgcagaacgtgcacatccgcaaggt 738

                        
Query: 726 gaagatcctgaag 738
            ||| | ||||||
Sbjct: 739 taagctgctgaag 751



to top

>ref|NM_017153.1| Rattus norvegicus ribosomal protein S3a (Rps3a), mRNA
 emb|X75161.1|RNRNAS3A R.norvegicus (Sprague-Dawley) mRNA for ribosomal protein S3a
          Length = 880

 Score = 50.1 bits (25), Expect = 0.017
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467
           |||||||||||| | ||||| |||||||| |||||||||||
Sbjct: 370 aagtggcagaccatgattgaagctcatgttgatgtgaagac 410



 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||| ||||||||||||
Sbjct: 22  accatggcggtcgggaagaacaagcgc 48



to top

>gb|DQ214673.1| Taeniopygia guttata clone 0061P0008B04 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 922

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggg 116
           |||||||||||| |||||||||||| || |||||||
Sbjct: 43  catggcggtcgggaagaacaagcgcctcaccaaggg 78



to top

>gb|DQ214671.1| Taeniopygia guttata clone 0058P0045E12 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 893

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggg 116
           |||||||||||| |||||||||||| || |||||||
Sbjct: 40  catggcggtcgggaagaacaagcgcctcaccaaggg 75



to top

>gb|DQ214668.1| Taeniopygia guttata clone 0063P0025A12 ribosomal protein S3a-like
           mRNA, complete sequence
          Length = 630

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggg 116
           |||||||||||| |||||||||||| || |||||||
Sbjct: 24  catggcggtcgggaagaacaagcgcctcaccaaggg 59



to top

>ref|XM_875949.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 8
           (LOC613769), mRNA
          Length = 900

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 79  accatggcggtcggcaagaacaag 102
           ||||||||||||||||||||||||
Sbjct: 49  accatggcggtcggcaagaacaag 72



to top

>ref|XM_875867.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 7
           (LOC613769), mRNA
          Length = 879

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 79  accatggcggtcggcaagaacaag 102
           ||||||||||||||||||||||||
Sbjct: 39  accatggcggtcggcaagaacaag 62



to top

>ref|XM_875801.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 6
           (LOC613769), mRNA
          Length = 884

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 79  accatggcggtcggcaagaacaag 102
           ||||||||||||||||||||||||
Sbjct: 39  accatggcggtcggcaagaacaag 62



to top

>ref|XM_875730.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 5
           (LOC613769), mRNA
          Length = 871

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 79  accatggcggtcggcaagaacaag 102
           ||||||||||||||||||||||||
Sbjct: 20  accatggcggtcggcaagaacaag 43



to top

>ref|XM_875654.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 4
           (LOC613769), mRNA
          Length = 890

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 79  accatggcggtcggcaagaacaag 102
           ||||||||||||||||||||||||
Sbjct: 39  accatggcggtcggcaagaacaag 62



to top

>ref|XM_875583.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 3
           (LOC613769), mRNA
          Length = 878

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 79  accatggcggtcggcaagaacaag 102
           ||||||||||||||||||||||||
Sbjct: 39  accatggcggtcggcaagaacaag 62



to top

>ref|XM_865235.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein), transcript variant 2
           (LOC613769), mRNA
          Length = 876

 Score = 48.1 bits (24), Expect = 0.067
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 79  accatggcggtcggcaagaacaag 102
           ||||||||||||||||||||||||
Sbjct: 39  accatggcggtcggcaagaacaag 62



to top

>ref|XM_001135906.1| PREDICTED: Pan troglodytes hypothetical protein LOC735927
           (LOC735927), mRNA
          Length = 741

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 21  accatggcggttggcaagaacaagcgc 47



to top

>ref|XM_526720.2| PREDICTED: Pan troglodytes similar to ribosomal protein S3a
           (LOC471338), mRNA
          Length = 473

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 24  accatggcggttggcaagaacaagcgc 50



to top

>ref|XM_001152942.1| PREDICTED: Pan troglodytes similar to v-fos transformation effector
           protein, transcript variant 2 (LOC461536), mRNA
          Length = 1027

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 20  accatggcggttggcaagaacaagcgc 46



to top

>ref|XM_001152885.1| PREDICTED: Pan troglodytes similar to v-fos transformation effector
           protein, transcript variant 1 (LOC461536), mRNA
          Length = 987

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>ref|XM_001153182.1| PREDICTED: Pan troglodytes similar to v-fos transformation effector
           protein, transcript variant 6 (LOC461536), mRNA
          Length = 890

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 35  accatggcggttggcaagaacaagcgc 61



to top

>ref|XM_001153073.1| PREDICTED: Pan troglodytes similar to v-fos transformation effector
           protein, transcript variant 4 (LOC461536), mRNA
          Length = 867

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 12  accatggcggttggcaagaacaagcgc 38



to top

>ref|XM_001153128.1| PREDICTED: Pan troglodytes similar to v-fos transformation effector
           protein, transcript variant 5 (LOC461536), mRNA
          Length = 879

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 24  accatggcggttggcaagaacaagcgc 50



to top

>ref|XM_940167.2| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 6 (LOC400652), mRNA
          Length = 741

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 745 aagtttgacctgggaaagctcatggag 771
           |||||||| ||||||||||||||||||
Sbjct: 540 aagtttgaactgggaaagctcatggag 566



to top

>ref|XM_927103.2| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a,
           transcript variant 2 (LOC400652), mRNA
          Length = 741

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 745 aagtttgacctgggaaagctcatggag 771
           |||||||| ||||||||||||||||||
Sbjct: 540 aagtttgaactgggaaagctcatggag 566



to top

>ref|XR_001449.2| PREDICTED: Homo sapiens similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC644972), mRNA
          Length = 867

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 21  accatggcggttggcaagaacaagcgc 47



to top

>gb|BC036712.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:4541172),
            **** WARNING: chimeric clone ****
          Length = 2821

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 79   accatggcggtcggcaagaacaagcgc 105
            ||||||||||| |||||||||||||||
Sbjct: 1961 accatggcggttggcaagaacaagcgc 1987



to top

>gb|BC007607.1| Homo sapiens cDNA clone IMAGE:3351222, **** WARNING: chimeric clone
            ****
          Length = 2744

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 79   accatggcggtcggcaagaacaagcgc 105
            ||||||||||| |||||||||||||||
Sbjct: 1884 accatggcggttggcaagaacaagcgc 1910



to top

>ref|XR_013969.1| PREDICTED: Macaca mulatta similar to ribosomal protein S3a
           (LOC714801), mRNA
          Length = 892

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 22  accatggcggttggcaagaacaagcgc 48



to top

>ref|XR_011647.1| PREDICTED: Macaca mulatta similar to ribosomal protein S3a
           (LOC706910), mRNA
          Length = 915

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 38  accatggcggttggcaagaacaagcgc 64



to top

>ref|XR_013290.1| PREDICTED: Macaca mulatta similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC709241),
           mRNA
          Length = 888

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 26  accatggcggttggcaagaacaagcgc 52



to top

>ref|XM_001093267.1| PREDICTED: Macaca mulatta similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC703455),
           mRNA
          Length = 664

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 62  accatggcggttggcaagaacaagcgc 88



to top

>ref|XR_013279.1| PREDICTED: Macaca mulatta similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC715814),
           mRNA
          Length = 729

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 27  accatggcggttggcaagaacaagcgc 53



to top

>ref|XM_001099771.1| PREDICTED: Macaca mulatta similar to ribosomal protein S3a
           (LOC711043), mRNA
          Length = 904

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 25  accatggcggttggcaagaacaagcgc 51



to top

>ref|XR_003814.1| PREDICTED: Mus musculus similar to 40S ribosomal protein S3a
           (LOC670633), mRNA
          Length = 893

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 33  accatggcggttggcaagaacaagcgc 59



to top

>gb|BC094829.1| Homo sapiens cDNA clone IMAGE:4647813, **** WARNING: chimeric clone
           ****
          Length = 1415

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 555 accatggcggttggcaagaacaagcgc 581



to top

>gb|BC099924.1| Homo sapiens cDNA clone IMAGE:6371780, **** WARNING: chimeric clone
            ****
          Length = 2186

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 79   accatggcggtcggcaagaacaagcgc 105
            ||||||||||| |||||||||||||||
Sbjct: 1325 accatggcggttggcaagaacaagcgc 1351



to top

>gb|BC045105.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:3160242),
            **** WARNING: chimeric clone ****
          Length = 2436

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 79   accatggcggtcggcaagaacaagcgc 105
            ||||||||||| |||||||||||||||
Sbjct: 1578 accatggcggttggcaagaacaagcgc 1604



to top

>gb|BC023666.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone
           IMAGE:5022252), **** WARNING: chimeric clone ****
          Length = 1551

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 670 accatggcggttggcaagaacaagcgc 696



to top

>gb|BC011660.1| Homo sapiens cDNA clone IMAGE:4120690, **** WARNING: chimeric clone
            ****
          Length = 2268

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 79   accatggcggtcggcaagaacaagcgc 105
            ||||||||||| |||||||||||||||
Sbjct: 1407 accatggcggttggcaagaacaagcgc 1433



to top

>gb|BC021075.1| Homo sapiens cDNA clone IMAGE:3530401, **** WARNING: chimeric clone
           ****
          Length = 1553

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 670 accatggcggttggcaagaacaagcgc 696



to top

>ref|XM_844705.1| PREDICTED: Canis familiaris similar to 40S ribosomal protein S3a
           (V-fos transformation effector protein) (LOC607868),
           mRNA
          Length = 1106

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 83  tggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||||||
Sbjct: 75  tggcggtcggcaagaacaagcgc 97



to top

>gb|AC093799.2| Homo sapiens BAC clone RP11-307C18 from 7, complete sequence
          Length = 156195

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             ||||||||||| |||||||||||||||
Sbjct: 74343 accatggcggttggcaagaacaagcgc 74317



to top

>gb|BC102789.1| Bos taurus ribosomal protein S3A, mRNA (cDNA clone MGC:127088
           IMAGE:7943245), complete cds
          Length = 899

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||| ||||||
Sbjct: 20  accatggcggtcggcaagaataagcgc 46



to top

>gb|BC004981.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3883
           IMAGE:2906117), complete cds
          Length = 891

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>dbj|AB169748.1| Macaca fascicularis brain cDNA, clone: QnpA-15704, similar to human
           ribosomal protein S3A (RPS3A), mRNA, RefSeq: NM_001006.2
          Length = 915

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 55  accatggcggttggcaagaacaagcgc 81



to top

>gb|AC095055.3| Homo sapiens BAC clone RP11-372K14 from 4, complete sequence
          Length = 183478

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             ||||||||||| |||||||||||||||
Sbjct: 36381 accatggcggttggcaagaacaagcgc 36407



to top

>gb|AC090771.4| Homo sapiens chromosome 18, clone RP11-795H16, complete sequence
          Length = 186031

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 745   aagtttgacctgggaaagctcatggag 771
             |||||||| ||||||||||||||||||
Sbjct: 90884 aagtttgaactgggaaagctcatggag 90910



to top

>emb|BX039677.1|CNS092S1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 133 aagaaggccgtggatccgttcac 155
           |||||||||||||||||||||||
Sbjct: 80  aagaaggccgtggatccgttcac 102



to top

>gb|AC090621.10| Homo sapiens chromosome 18, clone RP11-396N11, complete sequence
          Length = 188858

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 745    aagtttgacctgggaaagctcatggag 771
              |||||||| ||||||||||||||||||
Sbjct: 183162 aagtttgaactgggaaagctcatggag 183136



to top

>gb|AC146532.3| Otolemur garnettii clone CH256-151F13, complete sequence
          Length = 197659

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 745   aagtttgacctgggaaagctcatggag 771
             ||||||||||||||||| |||||||||
Sbjct: 59502 aagtttgacctgggaaaactcatggag 59528



to top

>emb|CR860858.1| Pongo pygmaeus mRNA; cDNA DKFZp469E172 (from clone DKFZp469E172)
          Length = 923

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 38  accatggcggttggcaagaacaagcgc 64



to top

>dbj|AK129825.1| Homo sapiens cDNA FLJ26315 fis, clone DMC09112, highly similar to
           40S ribosomal protein S3A
          Length = 861

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 21  accatggcggttggcaagaacaagcgc 47



to top

>ref|NM_001034038.1| Bos taurus ribosomal protein S3A (RPS3A), mRNA
 gb|AY911372.1| Bos taurus clone IMAGE:7961511 ribosomal protein S3a mRNA, complete
           cds
          Length = 865

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||| ||||||
Sbjct: 24  accatggcggtcggcaagaataagcgc 50



to top

>ref|NM_001006.3| Homo sapiens ribosomal protein S3A (RPS3A), mRNA
          Length = 930

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 49  accatggcggttggcaagaacaagcgc 75



to top

>gb|BC001708.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:1626
           IMAGE:3544072), complete cds
          Length = 906

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 40  accatggcggttggcaagaacaagcgc 66



to top

>gb|BC071916.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88598
           IMAGE:6285242), complete cds
          Length = 868

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC017123.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:18002
           IMAGE:3922810), complete cds
          Length = 869

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC030161.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29710
           IMAGE:5020904), complete cds
          Length = 921

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 61  accatggcggttggcaagaacaagcgc 87



to top

>gb|BC019072.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:29668
           IMAGE:5020581), complete cds
          Length = 925

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 61  accatggcggttggcaagaacaagcgc 87



to top

>gb|BC000204.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:3109
           IMAGE:3350750), complete cds
          Length = 866

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC009219.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:16359
           IMAGE:3927639), complete cds
          Length = 869

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 10  accatggcggttggcaagaacaagcgc 36



to top

>gb|BC009404.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:15425
           IMAGE:4308955), complete cds
          Length = 873

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 12  accatggcggttggcaagaacaagcgc 38



to top

>gb|AC004841.2|AC004841 Homo sapiens PAC clone RP4-607J23 from 7q21.2-q31.1, complete sequence
          Length = 132072

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             ||||||||||| |||||||||||||||
Sbjct: 85736 accatggcggttggcaagaacaagcgc 85710



to top

>dbj|AB099017.1| Bos taurus mRNA for similar to ribosomal protein S3a, partial cds,
           clone: ORCS12387
          Length = 644

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||||||||| ||||||
Sbjct: 4   accatggcggtcggcaagaataagcgc 30



to top

>emb|Z83334.1|HSZ83334 H.sapiens RPS3a gene
          Length = 5107

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 118 accatggcggttggcaagaacaagcgc 144



to top

>gb|BC070211.1| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:88192
           IMAGE:5809691), complete cds
          Length = 892

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 23  accatggcggttggcaagaacaagcgc 49



to top

>gb|BC018954.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone IMAGE:4136755)
          Length = 890

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 12  accatggcggttggcaagaacaagcgc 38



to top

>gb|BC006298.2| Homo sapiens ribosomal protein S3A, mRNA (cDNA clone MGC:13266
           IMAGE:4079651), complete cds
          Length = 871

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 3   accatggcggttggcaagaacaagcgc 29



to top

>gb|AC129329.3| Mus musculus BAC clone RP23-43M12 from 10, complete sequence
          Length = 176092

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             ||||||||||| |||||||||||||||
Sbjct: 48107 accatggcggttggcaagaacaagcgc 48133



to top

>emb|AL845262.3| Mouse DNA sequence from clone RP23-14N22 on chromosome 2, complete
             sequence
          Length = 207718

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 79    accatggcggtcggcaagaacaagcgc 105
             ||||||||||| |||||||||||||||
Sbjct: 62194 accatggcggttggcaagaacaagcgc 62220



to top

>emb|X87373.1|HSRPS3AGE Homo sapiens RPS3a gene for ribosomal protein S3a
          Length = 5529

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 384 accatggcggttggcaagaacaagcgc 410



to top

>gb|M84711.1|HUMFTE1A Human v-fos transformation effector protein (Fte-1), mRNA complete
           cds
          Length = 874

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 34  accatggcggttggcaagaacaagcgc 60



to top

>gb|M84716.1|RATVFOSPR R.norvegicus putative v-fos transformation effector protein (Fte-1)
           mRNA, complete cds
          Length = 860

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           |||||||||||||| ||||||||||||
Sbjct: 16  accatggcggtcgggaagaacaagcgc 42



 Score = 42.1 bits (21), Expect = 4.1
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 427 aagtggcagaccctcattgaggctcatgtcgatgtgaagac 467
           |||||||||||| | ||||| |||||||| || ||||||||
Sbjct: 364 aagtggcagaccatgattgaagctcatgttgacgtgaagac 404



to top

>gb|L13802.1|HUMCH13C3A Homo sapiens (clone 03) liver expessed ribosomal protein S3
           homologue mRNA, complete cds
          Length = 845

 Score = 46.1 bits (23), Expect = 0.26
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 79  accatggcggtcggcaagaacaagcgc 105
           ||||||||||| |||||||||||||||
Sbjct: 4   accatggcggttggcaagaacaagcgc 30



to top

>emb|CT029277.1| Poplar cDNA sequences
          Length = 300

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 82/102 (80%)
 Strand = Plus / Plus

                                                                       
Query: 81  catggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaagaagaaggc 140
           |||||| ||||| ||||||||| | || |||||||| | ||||||  | |||||||||||
Sbjct: 135 catggccgtcgggaagaacaagagaatttccaagggaaagaagggaggaaagaagaaggc 194

                                                     
Query: 141 cgtggatccgttcaccaagaagcagtggtatgacatcaaggc 182
            |  ||||| ||  | |||||| | |||||||| ||||||||
Sbjct: 195 agctgatccattttcaaagaaggattggtatgatatcaaggc 236



to top

>ref|XM_868916.1| PREDICTED: Bos taurus similar to 40S ribosomal protein S3a (V-fos
           transformation effector protein) (LOC515006), mRNA
          Length = 531

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 82  atggcggtcggcaagaacaagc 103
           ||||||||||||||||||||||
Sbjct: 1   atggcggtcggcaagaacaagc 22



to top

>ref|XM_855573.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 4 (LOC608684), mRNA
          Length = 875

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           |||||| |||||||||||||||||||
Sbjct: 10  ccatggtggtcggcaagaacaagcgc 35



to top

>ref|XM_844989.1| PREDICTED: Canis familiaris similar to ribosomal protein S3a,
           transcript variant 1 (LOC608684), mRNA
          Length = 886

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 80  ccatggcggtcggcaagaacaagcgc 105
           |||||| |||||||||||||||||||
Sbjct: 21  ccatggtggtcggcaagaacaagcgc 46


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 190,992,204
Number of extensions: 10320392
Number of successful extensions: 195078
Number of sequences better than 10.0: 309
Number of HSP's gapped: 195000
Number of HSP's successfully gapped: 521
Length of query: 1089
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1066
Effective length of database: 18,503,978,556
Effective search space: 19725241140696
Effective search space used: 19725241140696
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top