ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf58d19
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_128902.2| Arabidopsis thaliana unknown protein (AT2G33420... 46 0.25
2gb|AC002332.3| Arabidopsis thaliana chromosome 2 clone F4P9 map ... 46 0.25
3gb|BT005979.1| Arabidopsis thaliana At2g33420 gene, complete cds 46 0.25
4dbj|AK118464.1| Arabidopsis thaliana At2g33420 mRNA for unknown ... 46 0.25
5emb|CR388031.14| Zebrafish DNA sequence from clone CH211-192P3 i... 44 0.97
6gb|AC109660.8| Rattus norvegicus 14 BAC CH230-162H23 (Children's... 44 0.97
7gb|AC188555.4| Pan troglodytes BAC clone CH251-349E22 from chrom... 42 3.8
8gb|AC126010.13| Medicago truncatula clone mth2-20e4, complete se... 42 3.8
9ref|XM_711162.1| Candida albicans SC5314 hypothetical protein (C... 42 3.8
10ref|XM_711079.1| Candida albicans SC5314 hypothetical protein (C... 42 3.8
11gb|AC134551.4| Mus musculus BAC clone RP24-274B10 from chromosom... 42 3.8
12gb|BC015184.1| Homo sapiens far upstream element (FUSE) binding ... 42 3.8
13gb|BC041566.1| Homo sapiens far upstream element (FUSE) binding ... 42 3.8
14gb|AC159112.2| Pan troglodytes BAC clone CH251-495D16 from chrom... 42 3.8
15emb|CR318591.13| Zebrafish DNA sequence from clone CH211-102L7 i... 42 3.8
16gb|AC026374.19| Homo sapiens 3 BAC RP11-336E10 (Roswell Park Can... 42 3.8
17emb|AL356102.13| Human DNA sequence from clone RP11-490P13 on ch... 42 3.8
18gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 42 3.8
19emb|AJ418370.1|MTR418370 Medicago truncatula nork gene for nodul... 42 3.8
20emb|AJ418369.1|MTR418369 Medicago truncatula mRNA for nodulation... 42 3.8
21ref|XM_314582.2| Anopheles gambiae str. PEST ENSANGP00000018097 ... 42 3.8
22emb|AL359092.14| Human DNA sequence from clone RP11-57C19 on chr... 42 3.8
23gb|AC156809.2| Pan troglodytes BAC clone CH251-276J13 from chrom... 42 3.8
24emb|AL831738.4| Mouse DNA sequence from clone RP23-451K12 on chr... 42 3.8
25emb|AL606962.22| Mouse DNA sequence from clone RP23-29H22 on chr... 42 3.8 
>ref|NM_128902.2| Arabidopsis thaliana unknown protein (AT2G33420) mRNA, complete cds
          Length = 3420
 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 874 tgtctagaggaatcgatggatga 896
           |||||||||||||||||||||||
Sbjct: 855 tgtctagaggaatcgatggatga 833
to top
>gb|AC002332.3| Arabidopsis thaliana chromosome 2 clone F4P9 map ve015, complete
             sequence
          Length = 152593

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 874   tgtctagaggaatcgatggatga 896
             |||||||||||||||||||||||
Sbjct: 63514 tgtctagaggaatcgatggatga 63492
to top
>gb|BT005979.1| Arabidopsis thaliana At2g33420 gene, complete cds
          Length = 3120

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 874 tgtctagaggaatcgatggatga 896
           |||||||||||||||||||||||
Sbjct: 778 tgtctagaggaatcgatggatga 756
to top
>dbj|AK118464.1| Arabidopsis thaliana At2g33420 mRNA for unknown protein, complete
           cds, clone: RAFL19-70-G10
          Length = 3420

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 874 tgtctagaggaatcgatggatga 896
           |||||||||||||||||||||||
Sbjct: 855 tgtctagaggaatcgatggatga 833
to top
>emb|CR388031.14| Zebrafish DNA sequence from clone CH211-192P3 in linkage group 25,
             complete sequence
          Length = 95637

 Score = 44.1 bits (22), Expect = 0.97
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 576   gtaattctaagtctcgctttca 597
             ||||||||||||||||||||||
Sbjct: 61619 gtaattctaagtctcgctttca 61598
to top
>gb|AC109660.8| Rattus norvegicus 14 BAC CH230-162H23 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 140261

 Score = 44.1 bits (22), Expect = 0.97
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 2      gccagccttccttcccctcacc 23
              ||||||||||||||||||||||
Sbjct: 118041 gccagccttccttcccctcacc 118062
to top
>gb|AC188555.4| Pan troglodytes BAC clone CH251-349E22 from chromosome 7, complete
              sequence
          Length = 186794

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 305    gacaatggaatgattcatgtc 325
              |||||||||||||||||||||
Sbjct: 184961 gacaatggaatgattcatgtc 184941
to top
>gb|AC126010.13| Medicago truncatula clone mth2-20e4, complete sequence
          Length = 113964

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 826   cacttgtagaactattttgtt 846
             |||||||||||||||||||||
Sbjct: 74494 cacttgtagaactattttgtt 74474
to top
>ref|XM_711162.1| Candida albicans SC5314 hypothetical protein (CaO19_6417), mRNA
          Length = 2529

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 473 atcatgaatacaaatcatattattttgtt 501
           |||| |||||| |||||||||||||||||
Sbjct: 462 atcaagaatactaatcatattattttgtt 434
to top
>ref|XM_711079.1| Candida albicans SC5314 hypothetical protein (CaO19_13775), mRNA
          Length = 2529

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 473 atcatgaatacaaatcatattattttgtt 501
           |||| |||||| |||||||||||||||||
Sbjct: 462 atcaagaatactaatcatattattttgtt 434
to top
>gb|AC134551.4| Mus musculus BAC clone RP24-274B10 from chromosome 5, complete sequence
          Length = 123372

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 58    cctgcgctcccttctccacctctcc 82
             ||||||||||||||||||| |||||
Sbjct: 51458 cctgcgctcccttctccacttctcc 51434
to top
>gb|BC015184.1| Homo sapiens far upstream element (FUSE) binding protein 3, mRNA
           (cDNA clone IMAGE:3913538), with apparent retained
           intron
          Length = 1601

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 655 atctgaagcacctagaagaggcaga 679
           |||||| ||||||||||||||||||
Sbjct: 191 atctgaggcacctagaagaggcaga 215
to top
>gb|BC041566.1| Homo sapiens far upstream element (FUSE) binding protein 3, mRNA
           (cDNA clone IMAGE:3351869), partial cds
          Length = 747

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 655 atctgaagcacctagaagaggcaga 679
           |||||| ||||||||||||||||||
Sbjct: 451 atctgaggcacctagaagaggcaga 475
to top
>gb|AC159112.2| Pan troglodytes BAC clone CH251-495D16 from chromosome unknown, complete
              sequence
          Length = 134235

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 655    atctgaagcacctagaagaggcaga 679
              |||||| ||||||||||||||||||
Sbjct: 111864 atctgaggcacctagaagaggcaga 111840
to top
>emb|CR318591.13| Zebrafish DNA sequence from clone CH211-102L7 in linkage group 7,
             complete sequence
          Length = 109921

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 490   tattattttgttgacaacaca 510
             |||||||||||||||||||||
Sbjct: 47495 tattattttgttgacaacaca 47515
to top
>gb|AC026374.19| Homo sapiens 3 BAC RP11-336E10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 75385

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 727   tatgtgtgatcaacaaaaact 747
             |||||||||||||||||||||
Sbjct: 50967 tatgtgtgatcaacaaaaact 50987
to top
>emb|AL356102.13| Human DNA sequence from clone RP11-490P13 on chromosome 13, complete
              sequence
          Length = 139035

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 505    aacacaatcatcagttctaaa 525
              |||||||||||||||||||||
Sbjct: 111793 aacacaatcatcagttctaaa 111813
to top
>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 640    ttggtgcaaaggatgatctga 660
              |||||||||||||||||||||
Sbjct: 235959 ttggtgcaaaggatgatctga 235939
to top
>emb|AJ418370.1|MTR418370 Medicago truncatula nork gene for nodulation receptor kinase, exons
            1-15, Allele: wild type; NN1
          Length = 8569

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 826  cacttgtagaactattttgtt 846
            |||||||||||||||||||||
Sbjct: 8276 cacttgtagaactattttgtt 8296
to top
>emb|AJ418369.1|MTR418369 Medicago truncatula mRNA for nodulation receptor kinase (nork gene),
            wild type allele
          Length = 3568

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 826  cacttgtagaactattttgtt 846
            |||||||||||||||||||||
Sbjct: 3520 cacttgtagaactattttgtt 3540
to top
>ref|XM_314582.2| Anopheles gambiae str. PEST ENSANGP00000018097
           (ENSANGG00000015608), partial mRNA
          Length = 1890

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 171 gccgcttccctgccttctttgccgc 195
           ||||||||| |||||||||||||||
Sbjct: 613 gccgcttccgtgccttctttgccgc 589
to top
>emb|AL359092.14| Human DNA sequence from clone RP11-57C19 on chromosome 9, complete
             sequence
          Length = 173463

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 655   atctgaagcacctagaagaggcaga 679
             |||||| ||||||||||||||||||
Sbjct: 15768 atctgaggcacctagaagaggcaga 15792
to top
>gb|AC156809.2| Pan troglodytes BAC clone CH251-276J13 from chromosome unknown, complete
              sequence
          Length = 168055

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 655    atctgaagcacctagaagaggcaga 679
              |||||| ||||||||||||||||||
Sbjct: 134795 atctgaggcacctagaagaggcaga 134771
to top
>emb|AL831738.4| Mouse DNA sequence from clone RP23-451K12 on chromosome 4, complete
             sequence
          Length = 188894

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     ccagccttccttcccctcacc 23
             |||||||||||||||||||||
Sbjct: 47357 ccagccttccttcccctcacc 47337
to top
>emb|AL606962.22| Mouse DNA sequence from clone RP23-29H22 on chromosome 4, complete
              sequence
          Length = 223854

 Score = 42.1 bits (21), Expect = 3.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1      ggccagccttccttcccctca 21
              |||||||||||||||||||||
Sbjct: 125771 ggccagccttccttcccctca 125791


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 194,487,352
Number of extensions: 10606349
Number of successful extensions: 227108
Number of sequences better than 10.0: 25
Number of HSP's gapped: 227108
Number of HSP's successfully gapped: 25
Length of query: 1019
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 996
Effective length of database: 18,503,978,556
Effective search space: 18429962641776
Effective search space used: 18429962641776
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top