ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf54i10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|CT833048.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA042F10, full insert sequence Length = 834 Score = 722 bits (364), Expect = 0.0 Identities = 511/560 (91%) Strand = Plus / Plus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||| Sbjct: 69 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacg 128 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 129 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 188 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggac 266 ||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| Sbjct: 189 ttcaagcacctcaacctcgacttccagctgctggagggcggccgcaagctgcaggtggac 248 Query: 267 gcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 326 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 249 gcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 308 Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 309 aacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtctacgctcac 368 Query: 387 ttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctc 446 |||||||||||||||||||||||| | ||||| | |||||||||| | |||||| | Sbjct: 369 ttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcttg 428 Query: 447 ggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgag 506 ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||| Sbjct: 429 ggcgagaagaaggtgaggaaggttgacatgctcgagggggtgaccatcttgcggtcggag 488 Query: 507 aaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgcc 566 ||||| ||||| ||| |||||||||||||||||||||||||||||||||| ||||| || Sbjct: 489 aaggtgaaggacgagctcgtcctcgacggcaacgacatcgagctcgtctctcgctcagca 548 Query: 567 gccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggt 626 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 549 gccctcatcaaccagaaatgccacgtgaagaacaaggatatcaggaagttcttggatggt 608 Query: 627 atctacgtcagcgacaaggg 646 |||||||| ||||||||||| Sbjct: 609 atctacgtgagcgacaaggg 628
>dbj|AK243227.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J100044F18, full insert sequence Length = 2769 Score = 722 bits (364), Expect = 0.0 Identities = 511/560 (91%) Strand = Plus / Minus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||| Sbjct: 1857 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacg 1798 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 1797 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 1738 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggac 266 ||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| Sbjct: 1737 ttcaagcacctcaacctcgacttccagctgctggagggcggccgcaagctgcaggtggac 1678 Query: 267 gcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 326 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1677 gcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 1618 Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 1617 aacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtctacgctcac 1558 Query: 387 ttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctc 446 |||||||||||||||||||||||| | ||||| | |||||||||| | |||||| | Sbjct: 1557 ttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcttg 1498 Query: 447 ggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgag 506 ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||| Sbjct: 1497 ggcgagaagaaggtgaggaaggttgacatgctcgagggggtgaccatcttgcggtcggag 1438 Query: 507 aaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgcc 566 ||||| ||||| ||| |||||||||||||||||||||||||||||||||| ||||| || Sbjct: 1437 aaggtgaaggacgagctcgtcctcgacggcaacgacatcgagctcgtctctcgctcagca 1378 Query: 567 gccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggt 626 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 1377 gccctcatcaaccagaaatgccacgtgaagaacaaggatatcaggaagttcttggatggt 1318 Query: 627 atctacgtcagcgacaaggg 646 |||||||| ||||||||||| Sbjct: 1317 atctacgtgagcgacaaggg 1298
>ref|NM_001070055.1| Oryza sativa (japonica cultivar-group) Os09g0485900 (Os09g0485900) mRNA, complete cds Length = 884 Score = 722 bits (364), Expect = 0.0 Identities = 511/560 (91%) Strand = Plus / Plus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||| Sbjct: 69 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacg 128 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 129 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 188 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggac 266 ||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| Sbjct: 189 ttcaagcacctcaacctcgacttccagctgctggagggcggccgcaagctgcaggtggac 248 Query: 267 gcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 326 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 249 gcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 308 Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 309 aacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtctacgctcac 368 Query: 387 ttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctc 446 |||||||||||||||||||||||| | ||||| | |||||||||| | |||||| | Sbjct: 369 ttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcttg 428 Query: 447 ggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgag 506 ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||| Sbjct: 429 ggcgagaagaaggtgaggaaggttgacatgctcgagggggtgaccatcttgcggtcggag 488 Query: 507 aaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgcc 566 ||||| ||||| ||| |||||||||||||||||||||||||||||||||| ||||| || Sbjct: 489 aaggtgaaggacgagctcgtcctcgacggcaacgacatcgagctcgtctctcgctcagca 548 Query: 567 gccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggt 626 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 549 gccctcatcaaccagaaatgccacgtgaagaacaaggatatcaggaagttcttggatggt 608 Query: 627 atctacgtcagcgacaaggg 646 |||||||| ||||||||||| Sbjct: 609 atctacgtgagcgacaaggg 628
>gb|AY323481.1| Oryza sativa (japonica cultivar-group) ribosomal L9-like protein mRNA, complete cds Length = 797 Score = 722 bits (364), Expect = 0.0 Identities = 511/560 (91%) Strand = Plus / Plus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||| Sbjct: 54 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacg 113 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 114 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 173 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggac 266 ||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| Sbjct: 174 ttcaagcacctcaacctcgacttccagctgctggagggcggccgcaagctgcaggtggac 233 Query: 267 gcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 326 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 234 gcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 293 Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 294 aacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtctacgctcac 353 Query: 387 ttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctc 446 |||||||||||||||||||||||| | ||||| | |||||||||| | |||||| | Sbjct: 354 ttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcttg 413 Query: 447 ggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgag 506 ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||| Sbjct: 414 ggcgagaagaaggtgaggaaggttgacatgctcgagggggtgaccatcttgcggtcggag 473 Query: 507 aaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgcc 566 ||||| ||||| ||| |||||||||||||||||||||||||||||||||| ||||| || Sbjct: 474 aaggtgaaggacgagctcgtcctcgacggcaacgacatcgagctcgtctctcgctcagca 533 Query: 567 gccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggt 626 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 534 gccctcatcaaccagaaatgccacgtgaagaacaaggatatcaggaagttcttggatggt 593 Query: 627 atctacgtcagcgacaaggg 646 |||||||| ||||||||||| Sbjct: 594 atctacgtgagcgacaaggg 613
>dbj|AK064936.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000P02, full insert sequence Length = 886 Score = 714 bits (360), Expect = 0.0 Identities = 510/560 (91%) Strand = Plus / Plus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||| | ||||||||||| |||||||||| ||||||| Sbjct: 71 ccggcgaagatgaagaccatcctggcgcccgagacgatggagatcccggagggggtgacg 130 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 131 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 190 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggac 266 ||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| Sbjct: 191 ttcaagcacctcaacctcgacttccagctgctggagggcggccgcaagctgcaggtggac 250 Query: 267 gcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 326 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 251 gcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 310 Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 311 aacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtctacgctcac 370 Query: 387 ttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctc 446 |||||||||||||||||||||||| | ||||| | |||||||||| | |||||| | Sbjct: 371 ttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcttg 430 Query: 447 ggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgag 506 ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||| Sbjct: 431 ggcgagaagaaggtgaggaaggttgacatgctcgagggggtgaccatcttgcggtcggag 490 Query: 507 aaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgcc 566 ||||| ||||| ||| |||||||||||||||||||||||||||||||||| ||||| || Sbjct: 491 aaggtgaaggacgagctcgtcctcgacggcaacgacatcgagctcgtctctcgctcagca 550 Query: 567 gccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggt 626 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 551 gccctcatcaaccagaaatgccacgtgaagaacaaggatatcaggaagttcttggatggt 610 Query: 627 atctacgtcagcgacaaggg 646 |||||||| ||||||||||| Sbjct: 611 atctacgtgagcgacaaggg 630
>dbj|D83527.1|RICGA3 Rice (YK426) mRNA, complete cds Length = 816 Score = 714 bits (360), Expect = 0.0 Identities = 510/560 (91%) Strand = Plus / Plus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| | ||||| Sbjct: 67 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggaggggttgacg 126 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 127 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 186 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggac 266 ||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| Sbjct: 187 ttcaagcacctcaacctcgacttccagctgctggagggcggccgcaagctgcaggtggac 246 Query: 267 gcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 326 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 247 gcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 306 Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 307 aacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtctacgctcac 366 Query: 387 ttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctc 446 |||||||||||||||||||||||| | ||||| | |||||||||| | |||||| | Sbjct: 367 ttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcttg 426 Query: 447 ggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgag 506 ||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||| ||| Sbjct: 427 ggcgagaagaaggtgaggaaggttgacatgctcgagggggtgaccatcttgcggtcggag 486 Query: 507 aaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgcc 566 ||||| ||||| ||| |||||||||||||||||||||||||||||||||| ||||| || Sbjct: 487 aaggtgaaggacgagctcgtcctcgacggcaacgacatcgagctcgtctctcgctcagca 546 Query: 567 gccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggt 626 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 547 gccctcatcaaccagaaatgccacgtgaagaacaaggatatcaggaagttcttggatggt 606 Query: 627 atctacgtcagcgacaaggg 646 |||||||| ||||||||||| Sbjct: 607 atctacgtgagcgacaaggg 626
>gb|DQ244269.1| Zea mays clone 4037 mRNA sequence Length = 821 Score = 622 bits (314), Expect = e-175 Identities = 506/570 (88%) Strand = Plus / Plus Query: 93 aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaag 152 ||||||||||| |||||||||||||||||||||||||||||||||| || ||||| | | Sbjct: 66 aagatgaagacgatcctggcgtcggagacgatggacatcccggagggcgtcacggtcacg 125 Query: 153 gtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaag 212 ||| | |||||| || || ||||| ||| || ||||||| || ||||||||||||||| Sbjct: 126 gtggccgccaagctggtcacggtggagggcccccgcggcaagctcacccgcaacttcaag 185 Query: 213 cacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggacgcctgg 272 ||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 186 cacctcaacctcgacttccagctgcaggaggccggccgcaagctcaaggtggacgcctgg 245 Query: 273 ttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctc 332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 246 ttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctc 305 Query: 333 atcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttcccc 392 |||| || ||||||||||||| ||||||||||||| | ||||||||||| ||||||||| Sbjct: 306 atcaagggggtcaccaagggctaccgctacaagatgaggttcgtctacgcccacttcccc 365 Query: 393 atcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctcggcgag 452 |||||||||||||||||| | |||| | |||||||||| | ||||||||||||||| Sbjct: 366 atcaacgcctccatcaccaacagcaacaccgccatcgagatcagaaacttcctcggcgag 425 Query: 453 aagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtc 512 |||||||| ||||||||||||||||| || || || |||||| | ||||||||||||||| Sbjct: 426 aagaaggtcaggaaggtggacatgcttgatggcgtgaccatcctccggtccgagaaggtc 485 Query: 513 aaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctc 572 ||||||||| || |||| ||||| |||||| |||||||||| || ||||||||||||||| Sbjct: 486 aaggatgagctcatccttgacggaaacgacgtcgagctcgtatctcgctccgccgccctc 545 Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||||||||||||||| || ||||| ||||||||| | ||||| ||||| |||||||| Sbjct: 546 atcaaccagaaatgccatgtgaagaagaaggatatccgaaagtttttggacggtatctat 605 Query: 633 gtcagcgacaagggcgccatcaaggaggag 662 || ||||||||||||| |||| | |||||| Sbjct: 606 gtgagcgacaagggcgtcatcgaagaggag 635
>gb|BT016560.1| Zea mays clone Contig393 mRNA sequence Length = 747 Score = 599 bits (302), Expect = e-168 Identities = 503/570 (88%) Strand = Plus / Plus Query: 93 aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaag 152 ||||||||||| |||||||||||||||||||||||||||||||||| || ||||| | Sbjct: 45 aagatgaagacgatcctggcgtcggagacgatggacatcccggagggcgtcacggtcacc 104 Query: 153 gtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaag 212 ||| | |||||| || || ||||| ||| || ||||||| || ||||||||||||||| Sbjct: 105 gtggccgccaagctggtcacggtggagggcccccgcggcaagctcacccgcaacttcaag 164 Query: 213 cacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggacgcctgg 272 ||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 165 cacctcaacctcgacttccagctgcaggaggccggccgcaagctcaaggtggacgcctgg 224 Query: 273 ttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctc 332 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 225 ttcggcacccgccgcactatggccgccatccgcaccgccatctcccacgtccagaacctc 284 Query: 333 atcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttcccc 392 |||| || ||||||||||||| ||||||||||||| | ||||||||||| ||||||||| Sbjct: 285 atcaagggggtcaccaagggctaccgctacaagatgaggttcgtctacgcccacttcccc 344 Query: 393 atcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctcggcgag 452 |||||||||||||||||| | |||| | ||||||||| | ||||||||||||||| Sbjct: 345 atcaacgcctccatcaccaacagcaacaccgcaatcgagatcaggaacttcctcggcgag 404 Query: 453 aagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtc 512 |||||||| ||||||||||||||||| || || || |||||| | ||||||||||||||| Sbjct: 405 aagaaggtcaggaaggtggacatgcttgatggcgtgaccatcctccggtccgagaaggtc 464 Query: 513 aaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctc 572 ||||||||| || |||| ||||| |||||| |||||||||| || ||||||||||||||| Sbjct: 465 aaggatgagctcatccttgacggaaacgacgtcgagctcgtatctcgctccgccgccctc 524 Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||||||||||||||| || ||||| ||||||||| | ||||| ||||| |||||||| Sbjct: 525 atcaaccagaaatgccatgtgaagaagaaggatatccgaaagtttttggacggtatctat 584 Query: 633 gtcagcgacaagggcgccatcaaggaggag 662 || ||||||||||||| |||| | |||||| Sbjct: 585 gtgagcgacaagggcgtcatcgaagaggag 614
>gb|AY104547.1| Zea mays PCO113533 mRNA sequence Length = 927 Score = 591 bits (298), Expect = e-165 Identities = 490/554 (88%) Strand = Plus / Plus Query: 93 aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaag 152 ||||||||||| |||||||||||||||||||||||||||||||||| || | ||| | | Sbjct: 126 aagatgaagacgatcctggcgtcggagacgatggacatcccggagggcgtcatggtcacg 185 Query: 153 gtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaag 212 ||| | |||||| || || ||||| ||| || ||||||| || ||||||||||||||| Sbjct: 186 gtggccgccaagctggtcacggtggagggcccccgcggcaagctcacccgcaacttcaag 245 Query: 213 cacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggacgcctgg 272 ||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||| Sbjct: 246 cacctcaacctcgacttccagctgcaggaggccggccgcaagctcaaggtggacgcctgg 305 Query: 273 ttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctc 332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 306 ttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctc 365 Query: 333 atcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttcccc 392 |||| || ||||||||||||| ||||||||||||| | ||||||||||| || |||||| Sbjct: 366 atcaagggggtcaccaagggctaccgctacaagatgaggttcgtctacgcccatttcccc 425 Query: 393 atcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctcggcgag 452 |||||||| ||||||||| | ||||| | ||||||||| | ||||||||||||||| Sbjct: 426 atcaacgcgtccatcaccaactccaacaccgccatcgagataaggaacttcctcggcgag 485 Query: 453 aagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtc 512 |||||||| || |||||||||||||| ||||| || |||||| | || |||||||||||| Sbjct: 486 aagaaggtcagaaaggtggacatgcttgacggcgtgaccatcctccgctccgagaaggtc 545 Query: 513 aaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctc 572 ||||| ||| | | ||||| ||||||||| ||||| | ||||| ||||||||||||||| Sbjct: 546 aaggacgagcttattctcgatggcaacgacgtcgagttagtctctcgctccgccgccctc 605 Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||| Sbjct: 606 atcaaccagaaatgccatgtcaagaagaaggatatcaggaagtttttggatggtatctat 665 Query: 633 gtcagcgacaaggg 646 || ||||||||||| Sbjct: 666 gtgagcgacaaggg 679
>gb|DQ245423.1| Zea mays clone 15375 mRNA sequence Length = 784 Score = 583 bits (294), Expect = e-163 Identities = 489/554 (88%) Strand = Plus / Plus Query: 93 aagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaag 152 ||||||||||| |||||||||||||||||||||||||||||||||| || ||||||| | Sbjct: 61 aagatgaagacgatcctggcgtcggagacgatggacatcccggagggcgtcacggtgacg 120 Query: 153 gtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaag 212 ||| |||||||| || | | ||| ||| || ||||| | || ||||| ||||||||| Sbjct: 121 gtggcggccaagctggtgacagtggagggcccccgcgggaagctcacccggaacttcaag 180 Query: 213 cacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggacgcctgg 272 ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||| ||| Sbjct: 181 cacctcaacctcgacttccagctgcaggagggcggccgcaagctcaaggtggacgcatgg 240 Query: 273 ttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctc 332 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 241 ttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctc 300 Query: 333 atcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttcccc 392 |||| || ||||||||||||| ||||||||||||| | ||||||||||| || |||||| Sbjct: 301 atcaagggggtcaccaagggctaccgctacaagatgaggttcgtctacgcccatttcccc 360 Query: 393 atcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctcggcgag 452 |||||||| ||||||||| | ||||| | ||||||||| | ||||||||||||||| Sbjct: 361 atcaacgcgtccatcaccaactccaacaccgccatcgagataaggaacttcctcggcgag 420 Query: 453 aagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtc 512 |||||||| || |||||||||||||| ||||| || |||||| | || |||||||||||| Sbjct: 421 aagaaggtcagaaaggtggacatgcttgacggcgtgaccatcctccgctccgagaaggtc 480 Query: 513 aaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctc 572 ||||| ||| | | ||||| ||||||||| ||||| | ||||| ||||||||||||||| Sbjct: 481 aaggacgagcttattctcgatggcaacgacgtcgagttagtctctcgctccgccgccctc 540 Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||| Sbjct: 541 atcaaccagaaatgccatgtcaagaagaaggatatcaggaagtttttggatggtatctat 600 Query: 633 gtcagcgacaaggg 646 || ||||||||||| Sbjct: 601 gtgagcgacaaggg 614
>gb|AY107309.1| Zea mays PCO113532 mRNA sequence Length = 1063 Score = 567 bits (286), Expect = e-158 Identities = 490/558 (87%) Strand = Plus / Plus Query: 96 atgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaaggtg 155 ||||||||||||||||| ||||||||||||||||||| |||| ||| ||||| | |||| Sbjct: 154 atgaagaccatcctggccacggagacgatggacatccccgagggggtcacggtcacggtg 213 Query: 156 tcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaagcac 215 |||||||| || | ||||| |||||||||||| | || |||||||||||||||||| Sbjct: 214 gcggccaagctggtgacggtggaggggccgcgcggtaagctcacccgcaacttcaagcac 273 Query: 216 ctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggacgcctggttc 275 |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 274 ctcaacctcgacttccagctgcaggacggcggtcgcaagctcaaggtcgacgcctggttt 333 Query: 276 ggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctcatc 335 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 334 ggcacccgccgaaccatggccgccatccgcaccgccatctcccacgtccagaacctcatc 393 Query: 336 accggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatc 395 | |||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||| Sbjct: 394 gcaggcgtcaccaagggtttccgctacaagatgcggttcgtctacgctcactttcccatc 453 Query: 396 aacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctcggcgagaag 455 ||||||||||||||| ||||||| | ||| |||||| | ||||||||||| |||||| Sbjct: 454 aacgcctccatcaccaacgccaactccgccattgagatcagaaacttcctcggggagaag 513 Query: 456 aaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtcaag 515 ||||| |||||||| || ||||| || || || ||||||||||| || |||||||||||| Sbjct: 514 aaggtcaggaaggttgatatgcttgaaggtgtgaccatcttgcgttcagagaaggtcaag 573 Query: 516 gatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctcatc 575 |||||| | || || || ||||| || | ||||| ||||| |||||||| || ||||| Sbjct: 574 gatgagcttgttcttgaaggcaatgatgttgagcttgtctctcgctccgctgctctcata 633 Query: 576 aaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||||||||| |||||||| ||||||||| ||||||||||||| |||||||| || Sbjct: 634 aaccagaaatgccatgtcaagaagaaggatatccggaagttcttggacggtatctatgtg 693 Query: 636 agcgacaagggcgccatc 653 || ||||||||| ||||| Sbjct: 694 agtgacaagggccccatc 711
>gb|BT016425.1| Zea mays clone Contig258 mRNA sequence Length = 1002 Score = 559 bits (282), Expect = e-156 Identities = 489/558 (87%) Strand = Plus / Plus Query: 96 atgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaaggtg 155 ||||||||||||||||| | ||||||||||||||||| |||| ||| ||||| | |||| Sbjct: 57 atgaagaccatcctggccaccgagacgatggacatccccgagggggtcacggtcacggtg 116 Query: 156 tcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaagcac 215 |||||||| || | ||||| |||||||||||| | || |||||||||||||||||| Sbjct: 117 gcggccaagctggtgacggtggaggggccgcgcggtaagctcacccgcaacttcaagcac 176 Query: 216 ctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggacgcctggttc 275 |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 177 ctcaacctcgacttccagctgcaggacggcggtcgcaagctcaaggtcgacgcctggttt 236 Query: 276 ggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccagaacctcatc 335 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 237 ggcacccgccgaaccatggccgccatccgcaccgccatctcccacgtccagaacctcatc 296 Query: 336 accggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatc 395 | |||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||| Sbjct: 297 gcaggcgtcaccaagggtttccgctacaagatgcggttcgtctacgctcactttcccatc 356 Query: 396 aacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctcggcgagaag 455 ||||||||||||||| ||||||| | ||| |||||| | ||||||||||| |||||| Sbjct: 357 aacgcctccatcaccaacgccaactccgccattgagatcagaaacttcctcggggagaag 416 Query: 456 aaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtcaag 515 ||||| |||||||| || ||||| || || || ||||||||||| || |||||||||||| Sbjct: 417 aaggtcaggaaggttgatatgcttgaaggtgtgaccatcttgcgttcagagaaggtcaag 476 Query: 516 gatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctcatc 575 |||||| | || || || ||||| || | ||||| ||||| |||||||| || ||||| Sbjct: 477 gatgagcttgttcttgaaggcaatgatgttgagcttgtctctcgctccgctgctctcata 536 Query: 576 aaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||||||||| |||||||| ||||||||| ||||||||||||| |||||||| || Sbjct: 537 aaccagaaatgccatgtcaagaagaaggatatccggaagttcttggacggtatctatgtg 596 Query: 636 agcgacaagggcgccatc 653 || ||||||||| ||||| Sbjct: 597 agtgacaagggccccatc 614
>ref|NM_001052142.1| Oryza sativa (japonica cultivar-group) Os02g0103700 (Os02g0103700) mRNA, complete cds Length = 913 Score = 468 bits (236), Expect = e-128 Identities = 356/396 (89%) Strand = Plus / Plus Query: 259 aggtggacgcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 318 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 255 aggtggacgcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 314 Query: 319 acgtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtct 378 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 315 acgtccagaacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtct 374 Query: 379 acgctcacttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgca 438 | || || |||||||||||||||||||||||| | ||||| | |||||||||| | | Sbjct: 375 atgcccatttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcagga 434 Query: 439 acttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgc 498 |||||||||||||||||||||||||||| ||||||||||| || || || || || |||| Sbjct: 435 acttcctcggcgagaagaaggtgaggaaagtggacatgcttgagggtgtgacaattttgc 494 Query: 499 ggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctccc 558 | || |||||||||||||||||| | ||||| || ||||| || |||||||| ||||||| Sbjct: 495 gttctgagaaggtcaaggatgagctggtccttgatggcaatgatatcgagcttgtctccc 554 Query: 559 gctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttct 618 | || || || || ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 555 gttctgcggcactgatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcc 614 Query: 619 tggatggtatctacgtcagcgacaagggcgccatca 654 ||||||| ||||| ||||| ||||||||| |||||| Sbjct: 615 tggatggcatctatgtcagtgacaagggcaccatca 650 Score = 79.8 bits (40), Expect = 2e-11 Identities = 118/144 (81%) Strand = Plus / Plus Query: 94 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaagg 153 |||||||||| ||| |||| |||||||||||||| |||||| || |||||||||| | | Sbjct: 84 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggtgcacg 143 Query: 154 tgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaagc 213 || |||| ||| || | ||||| ||| || || || | ||||| ||||||||||||| Sbjct: 144 tggcggcgaaggtggtgacggtggagggtccccgtgggaagctgacgcgcaacttcaagc 203 Query: 214 acctcaacctcgacttccagctgc 237 |||| ||||| ||||||||||||| Sbjct: 204 acctgaacctggacttccagctgc 227
>dbj|AK102186.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086N17, full insert sequence Length = 914 Score = 468 bits (236), Expect = e-128 Identities = 356/396 (89%) Strand = Plus / Plus Query: 259 aggtggacgcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 318 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 256 aggtggacgcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 315 Query: 319 acgtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtct 378 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 316 acgtccagaacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtct 375 Query: 379 acgctcacttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgca 438 | || || |||||||||||||||||||||||| | ||||| | |||||||||| | | Sbjct: 376 atgcccatttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcagga 435 Query: 439 acttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgc 498 |||||||||||||||||||||||||||| ||||||||||| || || || || || |||| Sbjct: 436 acttcctcggcgagaagaaggtgaggaaagtggacatgcttgagggtgtgacaattttgc 495 Query: 499 ggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctccc 558 | || |||||||||||||||||| | ||||| || ||||| || |||||||| ||||||| Sbjct: 496 gttctgagaaggtcaaggatgagctggtccttgatggcaatgatatcgagcttgtctccc 555 Query: 559 gctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttct 618 | || || || || ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 556 gttctgcggcactgatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcc 615 Query: 619 tggatggtatctacgtcagcgacaagggcgccatca 654 ||||||| ||||| ||||| ||||||||| |||||| Sbjct: 616 tggatggcatctatgtcagtgacaagggcaccatca 651 Score = 79.8 bits (40), Expect = 2e-11 Identities = 118/144 (81%) Strand = Plus / Plus Query: 94 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaagg 153 |||||||||| ||| |||| |||||||||||||| |||||| || |||||||||| | | Sbjct: 85 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggtgcacg 144 Query: 154 tgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaagc 213 || |||| ||| || | ||||| ||| || || || | ||||| ||||||||||||| Sbjct: 145 tggcggcgaaggtggtgacggtggagggtccccgtgggaagctgacgcgcaacttcaagc 204 Query: 214 acctcaacctcgacttccagctgc 237 |||| ||||| ||||||||||||| Sbjct: 205 acctgaacctggacttccagctgc 228
>dbj|AK062502.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-A12, full insert sequence Length = 823 Score = 468 bits (236), Expect = e-128 Identities = 356/396 (89%) Strand = Plus / Plus Query: 259 aggtggacgcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 318 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 251 aggtggacgcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 310 Query: 319 acgtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtct 378 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 311 acgtccagaacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtct 370 Query: 379 acgctcacttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgca 438 | || || |||||||||||||||||||||||| | ||||| | |||||||||| | | Sbjct: 371 atgcccatttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcagga 430 Query: 439 acttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgc 498 |||||||||||||||||||||||||||| ||||||||||| || || || || || |||| Sbjct: 431 acttcctcggcgagaagaaggtgaggaaagtggacatgcttgagggtgtgacaattttgc 490 Query: 499 ggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctccc 558 | || |||||||||||||||||| | ||||| || ||||| || |||||||| ||||||| Sbjct: 491 gttctgagaaggtcaaggatgagctggtccttgatggcaatgatatcgagcttgtctccc 550 Query: 559 gctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttct 618 | || || || || ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 551 gttctgcggcactgatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcc 610 Query: 619 tggatggtatctacgtcagcgacaagggcgccatca 654 ||||||| ||||| ||||| ||||||||| |||||| Sbjct: 611 tggatggcatctatgtcagtgacaagggcaccatca 646 Score = 79.8 bits (40), Expect = 2e-11 Identities = 118/144 (81%) Strand = Plus / Plus Query: 94 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaagg 153 |||||||||| ||| |||| |||||||||||||| |||||| || |||||||||| | | Sbjct: 80 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggtgcacg 139 Query: 154 tgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaagc 213 || |||| ||| || | ||||| ||| || || || | ||||| ||||||||||||| Sbjct: 140 tggcggcgaaggtggtgacggtggagggtccccgtgggaagctgacgcgcaacttcaagc 199 Query: 214 acctcaacctcgacttccagctgc 237 |||| ||||| ||||||||||||| Sbjct: 200 acctgaacctggacttccagctgc 223
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9 Length = 22696651 Score = 448 bits (226), Expect = e-122 Identities = 337/374 (90%) Strand = Plus / Minus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||| Sbjct: 18585053 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacg 18584994 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 18584993 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 18584934 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgggcgcaagctcaaggtggac 266 ||||||||||||||||||||||||||||||| ||| ||||| |||||||| |||||||| Sbjct: 18584933 ttcaagcacctcaacctcgacttccagctgctggagggcggccgcaagctgcaggtggac 18584874 Query: 267 gcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 326 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 18584873 gcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctcccacgtccag 18584814 Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 18584813 aacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtctacgctcac 18584754 Query: 387 ttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctc 446 |||||||||||||||||||||||| | ||||| | |||||||||| | |||||| | Sbjct: 18584753 ttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcttg 18584694 Query: 447 ggcgagaagaaggt 460 |||||||||||||| Sbjct: 18584693 ggcgagaagaaggt 18584680 Score = 168 bits (85), Expect = 2e-38 Identities = 115/125 (92%) Strand = Plus / Minus Query: 457 aggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtcaagg 516 ||||||||||||| ||||||||||| ||||| |||||||||||||| |||||||| |||| Sbjct: 18584569 aggtgaggaaggttgacatgctcgagggggtgaccatcttgcggtcggagaaggtgaagg 18584510 Query: 517 atgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctcatca 576 | ||| |||||||||||||||||||||||||||||||||| ||||| || |||||||||| Sbjct: 18584509 acgagctcgtcctcgacggcaacgacatcgagctcgtctctcgctcagcagccctcatca 18584450 Query: 577 accag 581 ||||| Sbjct: 18584449 accag 18584445 Score = 119 bits (60), Expect = 2e-23 Identities = 66/68 (97%) Strand = Plus / Minus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 18583713 cagaaatgccacgtgaagaacaaggatatcaggaagttcttggatggtatctacgtgagc 18583654 Query: 639 gacaaggg 646 |||||||| Sbjct: 18583653 gacaaggg 18583646
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2 Length = 35954743 Score = 289 bits (146), Expect = 9e-75 Identities = 188/202 (93%) Strand = Plus / Minus Query: 259 aggtggacgcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 318 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 183186 aggtggacgcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 183127 Query: 319 acgtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtct 378 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 183126 acgtccagaacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtct 183067 Query: 379 acgctcacttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgca 438 | || || |||||||||||||||||||||||| | ||||| | |||||||||| | | Sbjct: 183066 atgcccatttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcagga 183007 Query: 439 acttcctcggcgagaagaaggt 460 |||||||||||||||||||||| Sbjct: 183006 acttcctcggcgagaagaaggt 182985 Score = 111 bits (56), Expect = 5e-21 Identities = 71/76 (93%) Strand = Plus / Minus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||| Sbjct: 180690 cagaaatgccacgtcaagaacaaggatatcaggaagttcctggatggcatctatgtcagt 180631 Query: 639 gacaagggcgccatca 654 ||||||||| |||||| Sbjct: 180630 gacaagggcaccatca 180615 Score = 81.8 bits (41), Expect = 4e-12 Identities = 104/125 (83%) Strand = Plus / Minus Query: 457 aggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtcaagg 516 |||||||||| ||||||||||| || || || || || ||||| || ||||||||||||| Sbjct: 182518 aggtgaggaaagtggacatgcttgagggtgtgacaattttgcgttctgagaaggtcaagg 182459 Query: 517 atgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctcatca 576 ||||| | ||||| || ||||| || |||||||| |||||||| || || || || |||| Sbjct: 182458 atgagctggtccttgatggcaatgatatcgagcttgtctcccgttctgcggcactgatca 182399 Query: 577 accag 581 ||||| Sbjct: 182398 accag 182394 Score = 79.8 bits (40), Expect = 2e-11 Identities = 118/144 (81%) Strand = Plus / Minus Query: 94 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaagg 153 |||||||||| ||| |||| |||||||||||||| |||||| || |||||||||| | | Sbjct: 183357 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggtgcacg 183298 Query: 154 tgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaagc 213 || |||| ||| || | ||||| ||| || || || | ||||| ||||||||||||| Sbjct: 183297 tggcggcgaaggtggtgacggtggagggtccccgtgggaagctgacgcgcaacttcaagc 183238 Query: 214 acctcaacctcgacttccagctgc 237 |||| ||||| ||||||||||||| Sbjct: 183237 acctgaacctggacttccagctgc 183214
>dbj|AP004187.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1435_F07 Length = 139041 Score = 289 bits (146), Expect = 9e-75 Identities = 188/202 (93%) Strand = Plus / Minus Query: 259 aggtggacgcctggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 318 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 132213 aggtggacgcgtggttcggcacccgccgcaccatggccgccatccgcaccgccatctccc 132154 Query: 319 acgtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtct 378 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 132153 acgtccagaacctcatcaccggcgtcaccaagggctaccgctacaagatgcgcttcgtct 132094 Query: 379 acgctcacttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgca 438 | || || |||||||||||||||||||||||| | ||||| | |||||||||| | | Sbjct: 132093 atgcccatttccccatcaacgcctccatcaccaactccaacaccgccatcgagatcagga 132034 Query: 439 acttcctcggcgagaagaaggt 460 |||||||||||||||||||||| Sbjct: 132033 acttcctcggcgagaagaaggt 132012 Score = 111 bits (56), Expect = 5e-21 Identities = 71/76 (93%) Strand = Plus / Minus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 ||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||| Sbjct: 129717 cagaaatgccacgtcaagaacaaggatatcaggaagttcctggatggcatctatgtcagt 129658 Query: 639 gacaagggcgccatca 654 ||||||||| |||||| Sbjct: 129657 gacaagggcaccatca 129642 Score = 81.8 bits (41), Expect = 4e-12 Identities = 104/125 (83%) Strand = Plus / Minus Query: 457 aggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtcaagg 516 |||||||||| ||||||||||| || || || || || ||||| || ||||||||||||| Sbjct: 131545 aggtgaggaaagtggacatgcttgagggtgtgacaattttgcgttctgagaaggtcaagg 131486 Query: 517 atgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctcatca 576 ||||| | ||||| || ||||| || |||||||| |||||||| || || || || |||| Sbjct: 131485 atgagctggtccttgatggcaatgatatcgagcttgtctcccgttctgcggcactgatca 131426 Query: 577 accag 581 ||||| Sbjct: 131425 accag 131421 Score = 79.8 bits (40), Expect = 2e-11 Identities = 118/144 (81%) Strand = Plus / Minus Query: 94 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtgaagg 153 |||||||||| ||| |||| |||||||||||||| |||||| || |||||||||| | | Sbjct: 132384 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggtgcacg 132325 Query: 154 tgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaacttcaagc 213 || |||| ||| || | ||||| ||| || || || | ||||| ||||||||||||| Sbjct: 132324 tggcggcgaaggtggtgacggtggagggtccccgtgggaagctgacgcgcaacttcaagc 132265 Query: 214 acctcaacctcgacttccagctgc 237 |||| ||||| ||||||||||||| Sbjct: 132264 acctgaacctggacttccagctgc 132241
>dbj|D38012.1|RICRPL9 Oryza sativa (japonica cultivar-group) mRNA for ribosomal protein L9, partial cds Length = 527 Score = 240 bits (121), Expect = 8e-60 Identities = 226/261 (86%) Strand = Plus / Plus Query: 394 tcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcctcggcgaga 453 ||||||||||||||||| | ||||| | |||||||||| | |||||||||||||||| Sbjct: 1 tcaacgcctccatcaccaactccaacaccgccatcgagatcaggaacttcctcggcgaga 60 Query: 454 agaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtccgagaaggtca 513 ||||||||||||| ||||||||||| || || || || || ||||| || |||||||||| Sbjct: 61 agaaggtgaggaaagtggacatgcttgagggtgtgacaattttgcgttctgagaaggtca 120 Query: 514 aggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctccgccgccctca 573 |||||||| | ||||| || ||||| || |||||||| |||||||| || || || || | Sbjct: 121 aggatgagctggtccttgatggcaatgatatcgagcttgtctcccgttctgcggcactga 180 Query: 574 tcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacg 633 |||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| | Sbjct: 181 tcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcctggatggcatctatg 240 Query: 634 tcagcgacaagggcgccatca 654 |||| ||||||||| |||||| Sbjct: 241 tcagtgacaagggcaccatca 261
>gb|AY072817.1| Oryza sativa ARE1 mRNA, partial cds Length = 218 Score = 153 bits (77), Expect = 1e-33 Identities = 140/161 (86%) Strand = Plus / Plus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| ||||||| Sbjct: 54 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggagggggtgacg 113 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 114 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 173 Query: 207 ttcaagcacctcaacctcgacttccagctgcaggacggcgg 247 ||||||||||||||||||||||||||||||| ||| ||||| Sbjct: 174 ttcaagcacctcaacctcgacttccagctgctggagggcgg 214
>emb|CT984912.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 758 Score = 147 bits (74), Expect = 9e-32 Identities = 185/222 (83%) Strand = Plus / Plus Query: 425 catcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacgg 484 ||||||||||||||||||| | |||||||||||||||||||||||||| ||||| || || Sbjct: 287 catcgagatccgcaacttcttgggcgagaagaaggtgaggaaggtggaaatgcttgaagg 346 Query: 485 ggtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacat 544 || | | | || ||||||||||| |||||||| | ||| | || || || ||||| Sbjct: 347 agtatctgttctccgttccgagaaggtgaaggatgaactggtcgtggatgggaatgacat 406 Query: 545 cgagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaagga 604 |||||| || ||||| || ||||||||| |||||||||||||| || ||||||||||| Sbjct: 407 cgagcttgtttcccggtcttgcgccctcataaaccagaaatgccatgtgaagaacaagga 466 Query: 605 tatcaggaagttcttggatggtatctacgtcagcgacaaggg 646 ||||||||||||| | |||||||| || |||||||| ||||| Sbjct: 467 tatcaggaagttccttgatggtatttatgtcagcgagaaggg 508 Score = 127 bits (64), Expect = 8e-26 Identities = 94/104 (90%) Strand = Plus / Plus Query: 298 ccatccgcaccgccatctcccacgtccagaacctcatcaccggcgtcaccaagggcttcc 357 ||||||| |||||| || ||||||| |||||||||||||||||||||||||||| | | Sbjct: 160 ccatccggaccgccctcagccacgtcgagaacctcatcaccggcgtcaccaagggttaca 219 Query: 358 gctacaagatgcgcttcgtctacgctcacttccccatcaacgcc 401 | ||||||||||||||||| |||||||||||||||||||||||| Sbjct: 220 ggtacaagatgcgcttcgtgtacgctcacttccccatcaacgcc 263 Score = 77.8 bits (39), Expect = 7e-11 Identities = 39/39 (100%) Strand = Plus / Plus Query: 198 acccgcaacttcaagcacctcaacctcgacttccagctg 236 ||||||||||||||||||||||||||||||||||||||| Sbjct: 48 acccgcaacttcaagcacctcaacctcgacttccagctg 86
>emb|CT983941.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 757 Score = 147 bits (74), Expect = 9e-32 Identities = 185/222 (83%) Strand = Plus / Plus Query: 425 catcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacgg 484 ||||||||||||||||||| | |||||||||||||||||||||||||| ||||| || || Sbjct: 287 catcgagatccgcaacttcttgggcgagaagaaggtgaggaaggtggaaatgcttgaagg 346 Query: 485 ggtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacat 544 || | | | || ||||||||||| |||||||| | ||| | || || || ||||| Sbjct: 347 agtatctgttctccgttccgagaaggtgaaggatgaactggtcgtggatgggaatgacat 406 Query: 545 cgagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaagga 604 |||||| || ||||| || ||||||||| |||||||||||||| || ||||||||||| Sbjct: 407 cgagcttgtttcccggtcttgcgccctcataaaccagaaatgccatgtgaagaacaagga 466 Query: 605 tatcaggaagttcttggatggtatctacgtcagcgacaaggg 646 ||||||||||||| | |||||||| || |||||||| ||||| Sbjct: 467 tatcaggaagttccttgatggtatttatgtcagcgagaaggg 508 Score = 127 bits (64), Expect = 8e-26 Identities = 94/104 (90%) Strand = Plus / Plus Query: 298 ccatccgcaccgccatctcccacgtccagaacctcatcaccggcgtcaccaagggcttcc 357 ||||||| |||||| || ||||||| |||||||||||||||||||||||||||| | | Sbjct: 160 ccatccggaccgccctcagccacgtcgagaacctcatcaccggcgtcaccaagggttaca 219 Query: 358 gctacaagatgcgcttcgtctacgctcacttccccatcaacgcc 401 | ||||||||||||||||| |||||||||||||||||||||||| Sbjct: 220 ggtacaagatgcgcttcgtgtacgctcacttccccatcaacgcc 263 Score = 77.8 bits (39), Expect = 7e-11 Identities = 39/39 (100%) Strand = Plus / Plus Query: 198 acccgcaacttcaagcacctcaacctcgacttccagctg 236 ||||||||||||||||||||||||||||||||||||||| Sbjct: 48 acccgcaacttcaagcacctcaacctcgacttccagctg 86
>dbj|D29705.1|RICYK17 Oryza sativa mRNA, partial homologous to GAmRNA (cloneF) Length = 207 Score = 137 bits (69), Expect = 8e-29 Identities = 129/149 (86%) Strand = Plus / Plus Query: 87 ccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacg 146 ||||||||||||||||||||||||||||| ||||||||||| |||||||||| |||||| Sbjct: 59 ccggcgaagatgaagaccatcctggcgtccgagacgatggagatcccggagggtgtgacg 118 Query: 147 gtgaaggtgtcggccaagatgatctcggtgacggggccgcgcggcaccctgacccgcaac 206 ||| |||| | || ||| || | ||||| ||| || ||||| | |||||||||||| Sbjct: 119 gtgcaggtcgccgcgaaggtggtgacggtggagggcccccgcgggaagctgacccgcaac 178 Query: 207 ttcaagcacctcaacctcgacttccagct 235 ||||||||||||||||||||||||||||| Sbjct: 179 ttcaagcacctcaacctcgacttccagct 207
>ref|NM_103046.2| Arabidopsis thaliana structural constituent of ribosome (AT1G33120) mRNA, complete cds Length = 966 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 423 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 482 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 483 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 542 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 543 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 602 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 603 atcaggaagttccttgacggtatctatgttagcga 637 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 351 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 404 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 192 ttcaagcatctcaacctcgatttccagctg 221
>ref|NM_103048.3| Arabidopsis thaliana structural constituent of ribosome (AT1G33140) mRNA, complete cds Length = 935 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 428 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 487 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 488 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgacatc 547 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| | |||||||||||||| ||||| ||||| |||||| Sbjct: 548 gagcttgtttcaaggtcatgcgctttgatcaaccagaaatgtcacgtgaagaagaaggat 607 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 ||||||||||| | ||||||||||| || ||||| Sbjct: 608 atcaggaagtttcttgatggtatctatgttagcga 642 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 356 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 409 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 197 ttcaagcatctcaacctcgatttccagctg 226
>gb|AF339694.1| Arabidopsis thaliana putative ribosomal protein L9 (At1g33120) mRNA, complete cds Length = 635 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 343 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 402 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 403 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 462 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 463 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 522 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 523 atcaggaagttccttgacggtatctatgttagcga 557 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 271 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 324 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 112 ttcaagcatctcaacctcgatttccagctg 141
>gb|AF326873.1| Arabidopsis thaliana putative ribosomal protein L9 (At1g33120) mRNA, complete cds Length = 824 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 423 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 482 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 483 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 542 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 543 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 602 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 603 atcaggaagttccttgacggtatctatgttagcga 637 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 351 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 404 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 192 ttcaagcatctcaacctcgatttccagctg 221
>gb|AY128910.1| Arabidopsis thaliana ribosomal protein L9, putative (At1g33120) mRNA, complete cds Length = 661 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 343 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 402 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 403 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 462 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 463 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 522 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 523 atcaggaagttccttgacggtatctatgttagcga 557 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 271 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 324 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 112 ttcaagcatctcaacctcgatttccagctg 141
>dbj|AK222147.1| Arabidopsis thaliana mRNA for ribosomal protein L9, partial cds, clone: RAFL23-02-D12 Length = 504 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 56 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 115 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 116 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgacatc 175 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| | |||||||||||||| ||||| ||||| |||||| Sbjct: 176 gagcttgtttcaaggtcatgcgctttgatcaaccagaaatgtcacgtgaagaagaaggat 235 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 ||||||||||| | ||||||||||| || ||||| Sbjct: 236 atcaggaagtttcttgatggtatctatgttagcga 270
>gb|AF375419.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds Length = 898 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 391 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 450 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 451 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgacatc 510 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| | |||||||||||||| ||||| ||||| |||||| Sbjct: 511 gagcttgtttcaaggtcatgcgctttgatcaaccagaaatgtcacgtgaagaagaaggat 570 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 ||||||||||| | ||||||||||| || ||||| Sbjct: 571 atcaggaagtttcttgatggtatctatgttagcga 605 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 319 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 372 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 160 ttcaagcatctcaacctcgatttccagctg 189
>gb|AY072446.1| Arabidopsis thaliana ribosomal protein L9, putative (At1g33120) mRNA, complete cds Length = 770 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 387 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 446 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 447 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 506 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 507 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 566 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 567 atcaggaagttccttgacggtatctatgttagcga 601 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 315 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 368 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 156 ttcaagcatctcaacctcgatttccagctg 185
>gb|AY058051.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds Length = 809 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 397 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 456 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 457 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgacatc 516 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| | |||||||||||||| ||||| ||||| |||||| Sbjct: 517 gagcttgtttcaaggtcatgcgctttgatcaaccagaaatgtcacgtgaagaagaaggat 576 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 ||||||||||| | ||||||||||| || ||||| Sbjct: 577 atcaggaagtttcttgatggtatctatgttagcga 611 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 325 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 378 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 166 ttcaagcatctcaacctcgatttccagctg 195
>gb|AY054156.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds Length = 585 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 343 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 402 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 403 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgacatc 462 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| | |||||||||||||| ||||| ||||| |||||| Sbjct: 463 gagcttgtttcaaggtcatgcgctttgatcaaccagaaatgtcacgtgaagaagaaggat 522 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 ||||||||||| | ||||||||||| || ||||| Sbjct: 523 atcaggaagtttcttgatggtatctatgttagcga 557 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 271 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 324 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 112 ttcaagcatctcaacctcgatttccagctg 141
>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence Length = 439641 Score = 125 bits (63), Expect = 3e-25 Identities = 75/79 (94%) Strand = Plus / Minus Query: 76 ccaccccctcaccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccgg 135 |||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||| || Sbjct: 233614 ccaccccctcaccggcaaagatgaagaccatcctggcgtcggagacaatggagatcctgg 233555 Query: 136 aggaggtgacggtgaaggt 154 ||||||||||||||||||| Sbjct: 233554 aggaggtgacggtgaaggt 233536 Score = 117 bits (59), Expect = 8e-23 Identities = 74/79 (93%) Strand = Plus / Minus Query: 76 ccaccccctcaccggcgaagatgaagaccatcctggcgtcggagacgatggacatcccgg 135 |||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||| || Sbjct: 343469 ccaccccctcaccggcaaagatgaagaccatcctggcgtcggagacaatggagatcctgg 343410 Query: 136 aggaggtgacggtgaaggt 154 |||||||||| |||||||| Sbjct: 343409 aggaggtgacagtgaaggt 343391
>gb|AY039593.1| Arabidopsis thaliana At1g33140/T9L6_10 mRNA, complete cds Length = 929 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 422 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 481 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 482 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgacatc 541 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| | |||||||||||||| ||||| ||||| |||||| Sbjct: 542 gagcttgtttcaaggtcatgcgctttgatcaaccagaaatgtcacgtgaagaagaaggat 601 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 ||||||||||| | ||||||||||| || ||||| Sbjct: 602 atcaggaagtttcttgatggtatctatgttagcga 636 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 350 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 403 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 191 ttcaagcatctcaacctcgatttccagctg 220
>gb|AF324688.2|AF324688 Arabidopsis thaliana At1g33120 (At1g33120/T9L6_8) mRNA, complete cds Length = 808 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 423 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 482 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 483 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 542 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 543 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 602 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 603 atcaggaagttccttgacggtatctatgttagcga 637 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 351 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 404 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 192 ttcaagcatctcaacctcgatttccagctg 221
>emb|BX814591.1|CNS0ACBL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB83ZB06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 817 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 411 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 470 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 471 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 530 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 531 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 590 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 591 atcaggaagttccttgacggtatctatgttagcga 625 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 339 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 392 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 180 ttcaagcatctcaacctcgatttccagctg 209
>emb|BX816763.1|CNS0ABNW Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH67ZC07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 873 Score = 125 bits (63), Expect = 3e-25 Identities = 177/215 (82%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 416 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 475 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || || |||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 476 gtaaccattgttcgatctgagaaggtgaaggatgagattgttcttgacggtaacgatatc 535 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| || |||||||||||||| ||||| ||||| |||||| Sbjct: 536 gagcttgtttcaaggtcgtgcgctctgatcaaccagaaatgtcacgtgaagaagaaggat 595 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 |||||||||||| | || |||||||| || ||||| Sbjct: 596 atcaggaagttccttgacggtatctatgttagcga 630 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 344 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 397 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 185 ttcaagcatctcaacctcgatttccagctg 214
>gb|AY086680.1| Arabidopsis thaliana clone 26744 mRNA, complete sequence Length = 829 Score = 121 bits (61), Expect = 5e-24 Identities = 176/215 (81%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggg 485 ||||||||||| |||||||| ||||||||||||||||||||||| || ||| | || || Sbjct: 429 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggtagagatgttggatggt 488 Query: 486 gtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatc 545 || ||||| | || | |||||||| ||||||||||| || || ||||| ||||||||| Sbjct: 489 gtaaccattgttcgayctgagaaggtgaaggatgagattgttcttgacggtaacgacatc 548 Query: 546 gagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggat 605 ||||| || || | || ||| | |||||||||||||| ||||| ||||| |||||| Sbjct: 549 gagcttgtttcaaggtcatgcgctttgatcaaccagaaatgtcacgtgaagaagaaggat 608 Query: 606 atcaggaagttcttggatggtatctacgtcagcga 640 ||||||||||| | ||||||||||| || ||||| Sbjct: 609 atcaggaagtttcttgatggtatctatgttagcga 643 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 357 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 410 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 198 ttcaagcatctcaacctcgatttccagctg 227
>gb|DQ235200.1| Solanum tuberosum clone 171E12 unknown mRNA Length = 858 Score = 117 bits (59), Expect = 8e-23 Identities = 230/287 (80%) Strand = Plus / Plus Query: 360 tacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatcaccgccgccaac 419 ||||||||||| || || || |||||||| |||||||| ||||||||||||| | ||| Sbjct: 335 tacaagatgcgttttgtgtatgctcactttcccatcaatgcctccatcaccggaggtaac 394 Query: 420 cggggcatcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctc 479 | ||| |||||||| |||||||| |||||||||||||| ||||| || |||||||| Sbjct: 395 aaagccattgagatccgtaacttccttggcgagaagaaggttaggaaagttgacatgctt 454 Query: 480 gacggggtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaac 539 || || || || | | || || |||||||| ||||||||| | || | || || || Sbjct: 455 gatggagtaacagttgttcgatctgagaaggttaaggatgagcttgtattggatggaaat 514 Query: 540 gacatcgagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaac 599 ||||| |||||||| || ||||| || |||||||| ||||| |||||||| || |||||| Sbjct: 515 gacattgagctcgtttctcgctctgcagccctcattaaccaaaaatgccatgtgaagaac 574 Query: 600 aaggatatcaggaagttcttggatggtatctacgtcagcgacaaggg 646 ||||||||| | ||||| | ||||||||||| ||||| || ||||| Sbjct: 575 aaggatatccgaaagtttcttgatggtatctatgtcagtgagaaggg 621
>gb|DQ245850.1| Zea mays clone 20857 mRNA sequence Length = 893 Score = 93.7 bits (47), Expect = 1e-15 Identities = 176/219 (80%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggggtc 488 |||||||| |||||||| || |||||||||||||||||||| || ||| | || || || Sbjct: 398 gagatccgtaacttccttggggagaagaaggtgaggaaggttgatatgttggatggtgtt 457 Query: 489 accatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgag 548 ||||| | ||||| |||||||| ||||||||||| || || || || || |||||| Sbjct: 458 accattgttcggtctgagaaggttaaggatgagattactcttgagggaaatgatatcgag 517 Query: 549 ctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggatatc 608 || ||||| || || ||| | ||||||||||||||||| || ||||| ||||||||| Sbjct: 518 ctagtctctcggtcatgcgctttgatcaaccagaaatgccatgtgaagaagaaggatatc 577 Query: 609 aggaagttcttggatggtatctacgtcagcgacaagggc 647 || ||||| | ||||||||||| || ||||| |||||| Sbjct: 578 agaaagtttcttgatggtatctatgtgagcgagaagggc 616 Score = 42.1 bits (21), Expect = 3.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 93 aagatgaagaccatcctggcgtcggagacgatggacatccc 133 ||||||||||| ||| || | || ||||||||||||||||| Sbjct: 50 aagatgaagacgatcttgtcatctgagacgatggacatccc 90 Score = 42.1 bits (21), Expect = 3.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagct 235 |||||||| ||||||||||| |||||||| Sbjct: 164 ttcaagcatctcaacctcgatttccagct 192
>gb|BT013259.1| Lycopersicon esculentum clone 134794R, mRNA sequence Length = 870 Score = 93.7 bits (47), Expect = 1e-15 Identities = 227/287 (79%) Strand = Plus / Plus Query: 360 tacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatcaccgccgccaac 419 ||||||||||| || ||||| ||||| || || ||||| || ||||| |||| || ||| Sbjct: 331 tacaagatgcgttttgtctatgctcattttcctatcaatgcttccattaccggcgggaac 390 Query: 420 cggggcatcgagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctc 479 | ||| |||||||| ||||| ||||||||||| ||||||||||| || || ||||| Sbjct: 391 aagtccattgagatccgtaactttctcggcgagaaaaaggtgaggaaagttgatatgctt 450 Query: 480 gacggggtcaccatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaac 539 ||||| ||||| | | || || ||||| || ||||||||| | || | || || || Sbjct: 451 gacggtgtcactgttgtccgttcagagaaagttaaggatgagttggttttggatggaaat 510 Query: 540 gacatcgagctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaac 599 ||||| || || ||||| || || || ||||| || ||||| |||||||| || |||||| Sbjct: 511 gacattgaacttgtctcacgatcagctgccctgataaaccaaaaatgccatgtgaagaac 570 Query: 600 aaggatatcaggaagttcttggatggtatctacgtcagcgacaaggg 646 || |||||| | |||||| | |||||||||||||||||||| ||||| Sbjct: 571 aaagatatccgtaagttccttgatggtatctacgtcagcgagaaggg 617
>gb|DQ207848.1| Solanum tuberosum clone 074A07 unknown mRNA Length = 838 Score = 91.7 bits (46), Expect = 4e-15 Identities = 175/218 (80%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggtggacatgctcgacggggtc 488 |||||||| ||||| ||||||||||| ||||||||||| || || ||||| ||||| ||| Sbjct: 371 gagatccgtaactttctcggcgagaaaaaggtgaggaaagttgatatgcttgacggtgtc 430 Query: 489 accatcttgcggtccgagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgag 548 || | | || || ||||| || ||||||||| | || | || || || ||||| || Sbjct: 431 actgttgtccgctcagagaaagttaaggatgagttggttttggatggaaatgacattgaa 490 Query: 549 ctcgtctcccgctccgccgccctcatcaaccagaaatgccacgtcaagaacaaggatatc 608 || ||||| || || || ||||| || ||||| |||||||| || |||||||| |||||| Sbjct: 491 cttgtctctcgatcagctgccctgataaaccaaaaatgccatgtgaagaacaaagatatc 550 Query: 609 aggaagttcttggatggtatctacgtcagcgacaaggg 646 | |||||| | |||||||||||||||||||| ||||| Sbjct: 551 cgtaagttccttgatggtatctacgtcagcgagaaggg 588
>ref|XM_863754.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN9465.2), mRNA Length = 579 Score = 89.7 bits (45), Expect = 2e-14 Identities = 66/73 (90%) Strand = Plus / Plus Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 |||||||||| ||| ||||||||||||||| ||||||||||||| ||||||||||||| Sbjct: 229 aacctcatcatcggtgtcaccaagggcttcaagtacaagatgcgctacgtctacgctcac 288 Query: 387 ttccccatcaacg 399 || |||||||||| Sbjct: 289 tttcccatcaacg 301
>gb|AY310780.1| Nicotiana benthamiana clone 8-334 unknown mRNA Length = 252 Score = 89.7 bits (45), Expect = 2e-14 Identities = 197/248 (79%) Strand = Plus / Plus Query: 384 cacttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttc 443 ||||| |||||||| ||||||||||||| | ||| | ||| ||||||| |||||| Sbjct: 4 cactttcccatcaatgcctccatcaccggtggtaacaagtccattgagatccntaacttc 63 Query: 444 ctcggcgagaagaaggtgaggaaggtggacatgctcgacggggtcaccatcttgcggtcc 503 || |||||||||| || ||||| |||||||||||||| ||||| || | | || || Sbjct: 64 cttggcgagaagagagttaggaaagtggacatgctcgatggggtaacagttgttcgatct 123 Query: 504 gagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctcc 563 |||||||| || |||||| | || | || || || ||||| |||||||| || ||||| Sbjct: 124 gagaaggtgaaagatgagcttgtattggatggaaatgacattgagctcgtttctcgctct 183 Query: 564 gccgccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggat 623 || ||||||||||| || |||||||| || ||||||||||||||| | ||||| | ||| Sbjct: 184 gctgccctcatcaatcaaaaatgccatgtgaagaacaaggatatccgaaagtttcttgat 243 Query: 624 ggtatcta 631 |||||||| Sbjct: 244 ggtatcta 251
>emb|X91958.1|AT60SRL9 A.thaliana mRNA for 60S ribosomal protein L9 Length = 768 Score = 81.8 bits (41), Expect = 4e-12 Identities = 113/137 (82%) Strand = Plus / Plus Query: 504 gagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagctcgtctcccgctcc 563 |||||||| ||||||||||| || || ||||| |||||||||||||| || || | || Sbjct: 450 gagaaggtgaaggatgagattgttcttgacggtaacgacatcgagcttgtttcaaggtca 509 Query: 564 gccgccctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggat 623 ||| | |||||||||||||| ||||| ||||| ||||||||||||||||| | ||| Sbjct: 510 tgcgctttgatcaaccagaaatgtcacgtgaagaagaaggatatcaggaagtttcttgat 569 Query: 624 ggtatctacgtcagcga 640 |||||||| || ||||| Sbjct: 570 ggtatctatgttagcga 586 Score = 79.8 bits (40), Expect = 2e-11 Identities = 43/44 (97%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggt 469 |||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 369 atcgagatccgcaacttccttggcgagaagaaggtgaggaaggt 412 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 138 ttcaagcatctcaacctcgatttccagctg 167
>emb|AJ718406.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC-22-260B, cultivar Bright Yellow 2 Length = 219 Score = 79.8 bits (40), Expect = 2e-11 Identities = 132/163 (80%) Strand = Plus / Plus Query: 325 agaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctc 384 |||| |||||||| || || ||||| || | ||||||||||||||| ||||| || |||| Sbjct: 34 agaatctcatcactggtgtgaccaaaggttaccgctacaagatgcgtttcgtgtatgctc 93 Query: 385 acttccccatcaacgcctccatcaccgccgccaaccggggcatcgagatccgcaacttcc 444 |||| || ||||| ||||||||||||| | ||| | ||| ||||| || ||||||| Sbjct: 94 actttccgatcaatgcctccatcaccggtggtaacaagtccattgagattcgtaacttcc 153 Query: 445 tcggcgagaagaaggtgaggaaggtggacatgctcgacggggt 487 | |||||||||| ||| ||||| | ||||||||| || ||||| Sbjct: 154 ttggcgagaagagggttaggaaagnggacatgcttgatggggt 196
>dbj|AB226272.1| Aspergillus oryzae cDNA, contig sequence: AoEST3132 Length = 1032 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 342 gtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||| Sbjct: 425 gtcaccaagggcttcaagtacaagatgcgctacgtctacgctcactttcccatcaacg 482
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 75.8 bits (38), Expect = 3e-10 Identities = 53/58 (91%) Strand = Plus / Plus Query: 342 gtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||| Sbjct: 4295700 gtcaccaagggcttcaagtacaagatgcgctacgtctacgctcactttcccatcaacg 4295757
>gb|DQ214109.1| Taeniopygia guttata clone 0058P0056F08 ribosomal protein L9-like mRNA, complete sequence Length = 783 Score = 73.8 bits (37), Expect = 1e-09 Identities = 40/41 (97%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 574 gtcaagaacaaggatatcaggaaattcttggatggtatcta 614
>gb|DQ214108.1| Taeniopygia guttata clone 0058P0018B08 ribosomal protein L9-like mRNA, complete sequence Length = 1025 Score = 73.8 bits (37), Expect = 1e-09 Identities = 40/41 (97%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 808 gtcaagaacaaggatatcaggaaattcttggatggtatcta 848
>gb|DQ214107.1| Taeniopygia guttata clone 0061P0006A08 ribosomal protein L9-like mRNA, complete sequence Length = 735 Score = 73.8 bits (37), Expect = 1e-09 Identities = 40/41 (97%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 526 gtcaagaacaaggatatcaggaaattcttggatggtatcta 566
>gb|DQ214106.1| Taeniopygia guttata clone 0061P0015B05 ribosomal protein L9-like mRNA, complete sequence Length = 737 Score = 73.8 bits (37), Expect = 1e-09 Identities = 40/41 (97%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 526 gtcaagaacaaggatatcaggaaattcttggatggtatcta 566
>gb|DQ214105.1| Taeniopygia guttata clone 0058P0059H09 ribosomal protein L9-like mRNA, complete sequence Length = 735 Score = 73.8 bits (37), Expect = 1e-09 Identities = 40/41 (97%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 526 gtcaagaacaaggatatcaggaaattcttggatggtatcta 566
>gb|DQ214104.1| Taeniopygia guttata clone 0061P0008H06 ribosomal protein L9-like mRNA, complete sequence Length = 732 Score = 73.8 bits (37), Expect = 1e-09 Identities = 40/41 (97%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| ||||||||||||||||| Sbjct: 515 gtcaagaacaaggatatcaggaaattcttggatggtatcta 555
>ref|XM_566460.1| Cryptococcus neoformans var. neoformans JEC21 60s ribosomal protein l9 (CNA00250) partial mRNA Length = 661 Score = 73.8 bits (37), Expect = 1e-09 Identities = 61/69 (88%) Strand = Plus / Plus Query: 333 atcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttcccc 392 |||| ||| |||||||||||||||| |||||||||||| | |||||||| || |||||| Sbjct: 250 atcatcggtgtcaccaagggcttcctctacaagatgcgacttgtctacgcgcatttcccc 309 Query: 393 atcaacgcc 401 ||||||||| Sbjct: 310 atcaacgcc 318
>gb|AC119415.13| Medicago truncatula clone mth2-27n2, complete sequence Length = 139330 Score = 71.9 bits (36), Expect = 4e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 325 agaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctc 384 |||| |||||||| || ||||||||||| ||||||||||||||| | || || || |||| Sbjct: 100581 agaatctcatcactggtgtcaccaagggattccgctacaagatgaggtttgtgtatgctc 100640 Query: 385 acttccccatcaacgc 400 | |||||||||||||| Sbjct: 100641 atttccccatcaacgc 100656 Score = 52.0 bits (26), Expect = 0.004 Identities = 35/38 (92%) Strand = Plus / Plus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagtt 616 ||||||||||| || ||||| ||||||||||||||||| Sbjct: 101388 cagaaatgccatgttaagaagaaggatatcaggaagtt 101425
>emb|BX813929.1|CNS0AC47 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB48ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 700 Score = 71.9 bits (36), Expect = 4e-09 Identities = 42/44 (95%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggtgaggaaggt 469 ||||||||||| |||||||| ||||||||||||||||||||||| Sbjct: 335 atcgagatccgtaacttccttggcgagaagaaggtgaggaaggt 378 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 104 ttcaagcatctcaacctcgatttccagctg 133 Score = 44.1 bits (22), Expect = 0.93 Identities = 46/54 (85%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || | |||||||||||||||||| Sbjct: 263 ttccgttacaagatgaggttcgtgtacgcccatgttcccatcaacgcctccatc 316
>gb|AC126789.20| Medicago truncatula clone mth2-36n23, complete sequence Length = 126875 Score = 71.9 bits (36), Expect = 4e-09 Identities = 66/76 (86%) Strand = Plus / Plus Query: 325 agaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctc 384 |||| |||||||| || ||||||||||| ||||||||||||||| | || || || |||| Sbjct: 54741 agaatctcatcactggtgtcaccaagggattccgctacaagatgaggtttgtgtatgctc 54800 Query: 385 acttccccatcaacgc 400 | |||||||||||||| Sbjct: 54801 atttccccatcaacgc 54816 Score = 52.0 bits (26), Expect = 0.004 Identities = 35/38 (92%) Strand = Plus / Plus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagtt 616 ||||||||||| || ||||| ||||||||||||||||| Sbjct: 55548 cagaaatgccatgttaagaagaaggatatcaggaagtt 55585
>emb|Y13428.1|HCRIBOL9 Haemonchus contortus mRNA for ribosomal protein L9 Length = 460 Score = 67.9 bits (34), Expect = 6e-08 Identities = 52/58 (89%) Strand = Plus / Plus Query: 342 gtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||| ||||||||||||||||| | ||| ||||| || ||||||||||||| Sbjct: 281 gtcaccaagggtttccgctacaagatgcgatccgtatacgcccatttccccatcaacg 338
>gb|AC084598.1|CBRG42J05 Caenorhabditis briggsae cosmid G42J05, complete sequence Length = 40229 Score = 67.9 bits (34), Expect = 6e-08 Identities = 88/106 (83%) Strand = Plus / Minus Query: 294 gccgccatccgcaccgccatctcccacgtccagaacctcatcaccggcgtcaccaagggc 353 |||||||||||||||| | |||||||||| ||||| | |||| || |||||| || Sbjct: 11628 gccgccatccgcaccgtctgctcccacgtcaagaacatgatcaagggagtcaccctcgga 11569 Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||||||||| ||| || || || ||||||||||||| Sbjct: 11568 ttccgctacaagatgcgctccgtatatgcccatttccccatcaacg 11523
>ref|XM_423225.2| PREDICTED: Gallus gallus ribosomal protein L9 (RPL9), mRNA Length = 2920 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 537 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 581
>ref|XM_747184.1| Aspergillus fumigatus Af293 60S ribosomal protein L9 b (Afu1g09100) partial mRNA Length = 579 Score = 65.9 bits (33), Expect = 3e-07 Identities = 63/73 (86%) Strand = Plus / Plus Query: 327 aacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcac 386 ||||| |||| ||| |||||| ||||||| ||||||||||||| ||||||||||||| Sbjct: 229 aacctgatcatcggtgtcacccggggcttcaagtacaagatgcgctacgtctacgctcac 288 Query: 387 ttccccatcaacg 399 || |||||||||| Sbjct: 289 tttcccatcaacg 301
>gb|AY130411.1| Myxine glutinosa ribosomal protein L9 mRNA, partial cds Length = 480 Score = 65.9 bits (33), Expect = 3e-07 Identities = 66/77 (85%) Strand = Plus / Plus Query: 321 gtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctac 380 ||||||||| | |||| || |||||| ||||||||||||||||||||||| ||| || Sbjct: 151 gtccagaacatgatcaagggtgtcaccttgggcttccgctacaagatgcgctccgtgtat 210 Query: 381 gctcacttccccatcaa 397 || |||||||||||||| Sbjct: 211 gcccacttccccatcaa 227 Score = 42.1 bits (21), Expect = 3.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 528 ctcgacggcaacgacatcgagctcgtctc 556 ||||| ||||||||||||||||| ||||| Sbjct: 358 ctcgaaggcaacgacatcgagcttgtctc 386
>emb|BX933942.2| Gallus gallus finished cDNA, clone ChEST132n10 Length = 873 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 661 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 705
>emb|CR353791.1| Gallus gallus finished cDNA, clone ChEST920l6 Length = 818 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Minus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 236 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 192
>emb|CR338955.1| Gallus gallus finished cDNA, clone ChEST980p19 Length = 726 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 513 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 557
>emb|BX934426.1| Gallus gallus finished cDNA, clone ChEST973n5 Length = 733 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 516 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 560
>emb|BX933063.1| Gallus gallus finished cDNA, clone ChEST1002b1 Length = 755 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 540 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 584
>emb|BX932602.1| Gallus gallus finished cDNA, clone ChEST123b8 Length = 786 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 574 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 618
>emb|BX929503.1| Gallus gallus finished cDNA, clone ChEST188c12 Length = 710 Score = 65.9 bits (33), Expect = 3e-07 Identities = 42/45 (93%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||| |||||||||||||| |||||||| |||||||||||| Sbjct: 498 gtcaagaataaggatatcaggaaattcttggacggtatctacgtc 542
>emb|X97322.2|PSRPL9PRT Pisum sativum rpL9 gene for ribosomal protein L9 Length = 2641 Score = 63.9 bits (32), Expect = 1e-06 Identities = 47/52 (90%) Strand = Plus / Plus Query: 317 ccacgtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatg 368 ||||||| |||| |||||||| || ||||||||||| ||||||||||||||| Sbjct: 1801 ccacgtcgagaatctcatcactggtgtcaccaagggtttccgctacaagatg 1852 Score = 44.1 bits (22), Expect = 0.93 Identities = 34/38 (89%) Strand = Plus / Plus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagtt 616 ||||||||||| || || || ||||||||||||||||| Sbjct: 2337 cagaaatgccatgttaaaaagaaggatatcaggaagtt 2374
>emb|X65155.1|PSGAMRF P.sativum GA mRNA (clone F) Length = 901 Score = 63.9 bits (32), Expect = 1e-06 Identities = 47/52 (90%) Strand = Plus / Plus Query: 317 ccacgtccagaacctcatcaccggcgtcaccaagggcttccgctacaagatg 368 ||||||| |||| |||||||| || ||||||||||| ||||||||||||||| Sbjct: 291 ccacgtcgagaatctcatcactggtgtcaccaagggtttccgctacaagatg 342 Score = 50.1 bits (25), Expect = 0.015 Identities = 37/41 (90%) Strand = Plus / Plus Query: 576 aaccagaaatgccacgtcaagaacaaggatatcaggaagtt 616 |||||||||||||| || || || ||||||||||||||||| Sbjct: 550 aaccagaaatgccatgttaaaaagaaggatatcaggaagtt 590 Score = 48.1 bits (24), Expect = 0.059 Identities = 39/44 (88%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggtgga 472 |||||||| ||||| ||||| || |||||||||||||| ||||| Sbjct: 403 gagatccgtaactttctcggtgaaaagaaggtgaggaaagtgga 446
>gb|BC069963.1| Mus musculus cDNA clone IMAGE:5039327, partial cds Length = 1505 Score = 61.9 bits (31), Expect = 4e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 244 agggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 294 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 1209 aacaaggatatcaggaagtttttggacggcatcta 1243
>gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome 5, complete sequence Length = 188517 Score = 61.9 bits (31), Expect = 4e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 152410 agggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 152460 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 153375 aacaaggatatcaggaagtttttggacggcatcta 153409
>dbj|AK050296.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length enriched library, clone:C730035F01 product:ribosomal protein L9, full insert sequence Length = 2652 Score = 61.9 bits (31), Expect = 4e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 1405 agggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 1455 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 2370 aacaaggatatcaggaagtttttggacggcatcta 2404
>dbj|AK053431.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130017A20 product:ribosomal protein L9, full insert sequence Length = 2691 Score = 61.9 bits (31), Expect = 4e-06 Identities = 46/51 (90%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 1444 agggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 1494 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 2409 aacaaggatatcaggaagtttttggacggcatcta 2443
>ref|XM_960036.1| Neurospora crassa OR74A hypothetical protein (NCU02744.1) partial mRNA Length = 582 Score = 61.9 bits (31), Expect = 4e-06 Identities = 58/67 (86%) Strand = Plus / Plus Query: 333 atcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttcccc 392 |||| ||| ||||||||||||||| ||||||||||||| |||||| || || |||||| Sbjct: 235 atcatcggtgtcaccaagggcttcaagtacaagatgcgctacgtctatgcccatttcccc 294 Query: 393 atcaacg 399 ||||||| Sbjct: 295 atcaacg 301 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 427 tcgagatccgcaacttcctcggcgagaaga 456 ||||||||||||||||| | |||||||||| Sbjct: 341 tcgagatccgcaacttcattggcgagaaga 370
>gb|AC101221.12| Mus musculus chromosome 13, clone RP23-96E4, complete sequence Length = 258269 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 138751 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 138702 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||| ||||||||||||| |||||||| ||||| Sbjct: 138504 aacaagtatatcaggaagtttttggatggcatcta 138470
>ref|XR_009402.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L9 (LOC287551), mRNA Length = 558 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| |||||||| ||||| Sbjct: 481 aagaacaaggatatcaggaagtttttggatggcatcta 518
>ref|XR_006297.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L9 (LOC287551), mRNA Length = 558 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| |||||||| ||||| Sbjct: 481 aagaacaaggatatcaggaagtttttggatggcatcta 518
>ref|XR_007929.1| PREDICTED: Rattus norvegicus hypothetical gene supported by X51706 (predicted) (RGD1559948_predicted), mRNA Length = 670 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||||||||| |||||||| ||||| Sbjct: 501 aagaacaaggatatcaggaagtttttggatggcatcta 538
>ref|XM_982604.1| PREDICTED: Mus musculus similar to ribosomal protein L9 (LOC637379), mRNA Length = 762 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 324 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 373 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 571 aacaaggatatcaggaagtttttggacggcatcta 605
>ref|XM_990486.1| PREDICTED: Mus musculus similar to ribosomal protein L9 (LOC637379), mRNA Length = 653 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 222 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 271 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 469 aacaaggatatcaggaagtttttggacggcatcta 503
>ref|XM_925735.2| PREDICTED: Mus musculus similar to ribosomal protein L9, transcript variant 2 (LOC637379), mRNA Length = 660 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 222 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 271 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 469 aacaaggatatcaggaagtttttggacggcatcta 503
>ref|XM_484272.3| PREDICTED: Mus musculus similar to ribosomal protein L9 (LOC432768), mRNA Length = 724 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 284 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 333 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||| ||||||||||||| |||||||| ||||| Sbjct: 531 aacaagtatatcaggaagtttttggatggcatcta 565
>gb|BC083329.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102003 IMAGE:6824346), complete cds Length = 698 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 264 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 313 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 511 aacaaggatatcaggaagtttttggacggcatcta 545
>gb|BC083166.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102393 IMAGE:6397429), complete cds Length = 701 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 266 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 315 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 513 aacaaggatatcaggaagtttttggacggcatcta 547
>gb|BC081435.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102002 IMAGE:6824107), complete cds Length = 688 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 261 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 310 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 508 aacaaggatatcaggaagtttttggacggcatcta 542
>gb|BC013165.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:6543 IMAGE:2655358), complete cds Length = 702 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 275 gggcttccgatacaagatgcgttctgtgtacgctcacttccccatcaacg 324 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 522 aacaaggatatcaggaagtttttggacggcatcta 556
>ref|XM_454360.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E09075g predicted mRNA Length = 576 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgt 634 |||||||||||| | ||||||||||||||||||||||| Sbjct: 505 aacaaggatatccgtaagttcttggatggtatctacgt 542
>gb|AC107711.13| Mus musculus chromosome 14, clone RP23-291I12, complete sequence Length = 228302 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 216106 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 216155 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 216353 aacaaggatatcaggaagtttttggacggcatcta 216387
>ref|XM_381330.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01154.1) partial mRNA Length = 753 Score = 60.0 bits (30), Expect = 2e-05 Identities = 51/58 (87%) Strand = Plus / Plus Query: 342 gtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||||| ||||||||||| | ||||||||| || ||||||||||||| Sbjct: 415 gtcaccaagggcttcaagtacaagatgcgatacgtctacgcccatttccccatcaacg 472
>gb|BC089319.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102001 IMAGE:6823996), complete cds Length = 765 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 264 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 313 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 511 aacaaggatatcaggaagtttttggacggcatcta 545
>gb|AC097273.3| Genomic sequence for Mus musculus, clone RP23-118N13, complete sequence Length = 211657 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 188384 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 188335 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 188137 aacaaggatatcaggaagtttttggacggcatcta 188103
>dbj|AK153562.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched library, clone:I830175N05 product:ribosomal protein L9, full insert sequence Length = 694 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>dbj|AK159980.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420041N04 product:ribosomal protein L9, full insert sequence Length = 694 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>dbj|AK168326.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730090P04 product:ribosomal protein L9, full insert sequence Length = 692 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 283 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 332 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 530 aacaaggatatcaggaagtttttggacggcatcta 564
>dbj|AK169217.1| Mus musculus 17 days embryo stomach cDNA, RIKEN full-length enriched library, clone:I920091H01 product:ribosomal protein L9, full insert sequence Length = 692 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 283 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 332 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 530 aacaaggatatcaggaagtttttggacggcatcta 564
>dbj|AK088166.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430005G08 product:ribosomal protein L9, full insert sequence Length = 694 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>dbj|AK084278.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length enriched library, clone:D230017F17 product:ribosomal protein L9, full insert sequence Length = 695 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 286 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 335 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 533 aacaaggatatcaggaagtttttggacggcatcta 567
>dbj|AK012445.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700056G17 product:ribosomal protein L9, full insert sequence Length = 694 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>dbj|AK012331.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length enriched library, clone:2700038F06 product:ribosomal protein L9, full insert sequence Length = 693 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>dbj|AK017427.1| Mus musculus 10 days neonate head cDNA, RIKEN full-length enriched library, clone:5530400L19 product:ribosomal protein L9, full insert sequence Length = 694 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>dbj|AK017388.1| Mus musculus 6 days neonate head cDNA, RIKEN full-length enriched library, clone:5430433M11 product:ribosomal protein L9, full insert sequence Length = 694 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV, complete sequence Length = 1466886 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgt 634 |||||||||||||| ||||||||||| ||||||||||| Sbjct: 192050 aacaaggatatcagaaagttcttggacggtatctacgt 192087
>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2234072 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgt 634 |||||||||||| | ||||||||||||||||||||||| Sbjct: 814547 aacaaggatatccgtaagttcttggatggtatctacgt 814510
>emb|CR380951.1| Candida glabrata strain CBS138 chromosome E complete sequence Length = 687501 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgt 634 |||||||||||| | ||||||||||||||||||||||| Sbjct: 484694 aacaaggatatccgtaagttcttggatggtatctacgt 484731
>gb|AC027035.5|AC027035 Arabidopsis thaliana chromosome 1 BAC T16O9 genomic sequence, complete sequence Length = 81609 Score = 60.0 bits (30), Expect = 2e-05 Identities = 54/62 (87%) Strand = Plus / Plus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 |||||||| ||||| ||||| ||||||||||||||||| | ||||||||||| || ||| Sbjct: 958 cagaaatgtcacgtgaagaagaaggatatcaggaagtttcttgatggtatctatgttagc 1017 Query: 639 ga 640 || Sbjct: 1018 ga 1019 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggt 460 ||||||||||| |||||||| |||||||||||||| Sbjct: 247 atcgagatccgtaacttccttggcgagaagaaggt 281 Score = 54.0 bits (27), Expect = 0.001 Identities = 42/47 (89%) Strand = Plus / Plus Query: 504 gagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagct 550 |||||||| ||||||||||| || || ||||| |||||||||||||| Sbjct: 490 gagaaggtgaaggatgagattgttcttgacggtaacgacatcgagct 536 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 175 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 228 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 16 ttcaagcatctcaacctcgatttccagctg 45
>gb|BC093526.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:102392 IMAGE:5150493), complete cds Length = 744 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 264 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 313 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 511 aacaaggatatcaggaagtttttggacggcatcta 545
>gb|AC021045.2|AC021045 Arabidopsis thaliana chromosome I BAC T9L6 genomic sequence, complete sequence Length = 90632 Score = 60.0 bits (30), Expect = 2e-05 Identities = 54/62 (87%) Strand = Plus / Plus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 |||||||| ||||| ||||| |||||||||||||||||| | || |||||||| || ||| Sbjct: 44943 cagaaatgtcacgtgaagaagaaggatatcaggaagttccttgacggtatctatgttagc 45002 Query: 639 ga 640 || Sbjct: 45003 ga 45004 Score = 60.0 bits (30), Expect = 2e-05 Identities = 54/62 (87%) Strand = Plus / Plus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 |||||||| ||||| ||||| ||||||||||||||||| | ||||||||||| || ||| Sbjct: 57222 cagaaatgtcacgtgaagaagaaggatatcaggaagtttcttgatggtatctatgttagc 57281 Query: 639 ga 640 || Sbjct: 57282 ga 57283 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggt 460 ||||||||||| |||||||| |||||||||||||| Sbjct: 44137 atcgagatccgtaacttccttggcgagaagaaggt 44171 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggt 460 ||||||||||| |||||||| |||||||||||||| Sbjct: 56511 atcgagatccgtaacttccttggcgagaagaaggt 56545 Score = 54.0 bits (27), Expect = 0.001 Identities = 42/47 (89%) Strand = Plus / Plus Query: 504 gagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagct 550 |||||||| ||||||||||| || || ||||| |||||||||||||| Sbjct: 56754 gagaaggtgaaggatgagattgttcttgacggtaacgacatcgagct 56800 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 44065 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 44118 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcctccatc 407 ||||| ||||||||| | ||||| ||||| || || |||||||||||||||||| Sbjct: 56439 ttccgttacaagatgaggttcgtgtacgcccattttcccatcaacgcctccatc 56492 Score = 46.1 bits (23), Expect = 0.23 Identities = 41/47 (87%) Strand = Plus / Plus Query: 504 gagaaggtcaaggatgagatcgtcctcgacggcaacgacatcgagct 550 |||||||| ||||||||||| || || ||||| ||||| |||||||| Sbjct: 44380 gagaaggtgaaggatgagattgttcttgacggtaacgatatcgagct 44426 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 43906 ttcaagcatctcaacctcgatttccagctg 43935 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 207 ttcaagcacctcaacctcgacttccagctg 236 |||||||| ||||||||||| ||||||||| Sbjct: 56280 ttcaagcatctcaacctcgatttccagctg 56309
>ref|NM_011292.1| Mus musculus ribosomal protein L9 (Rpl9), mRNA gb|AF260271.1|AF260271 Mus musculus 60S ribosomal Protein L9 mRNA, complete cds Length = 694 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 285 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 334 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 532 aacaaggatatcaggaagtttttggacggcatcta 566
>ref|XM_445905.1| Candida glabrata CBS138, CAGL0E04994g partial mRNA Length = 576 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgt 634 |||||||||||| | ||||||||||||||||||||||| Sbjct: 505 aacaaggatatccgtaagttcttggatggtatctacgt 542
>gb|BC086937.1| Mus musculus ribosomal protein L9, mRNA (cDNA clone MGC:107692 IMAGE:6787671), complete cds Length = 709 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 282 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 331 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 529 aacaaggatatcaggaagtttttggacggcatcta 563
>emb|AL671898.7| Mouse DNA sequence from clone RP23-194K1 on chromosome X, complete sequence Length = 212406 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 102903 gggcttccgatacaagatgcgatctgtgtacgctcacttccccatcaacg 102952
>gb|AC154199.2| Mus musculus BAC clone RP24-396N5 from 13, complete sequence Length = 120685 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 50534 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 50485 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 50287 aacaaggatatcaggaagtttttggacggcatcta 50253
>ref|NM_209159.1| Eremothecium gossypii ADL290Wp (ADL290W), mRNA Length = 576 Score = 60.0 bits (30), Expect = 2e-05 Identities = 36/38 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgt 634 |||||||||||||| ||||||||||| ||||||||||| Sbjct: 505 aacaaggatatcagaaagttcttggacggtatctacgt 542
>gb|AC154506.4| Mus musculus BAC clone RP24-94N16 from chromosome 13, complete sequence Length = 164500 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 13491 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 13442 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||| ||||||||||||| |||||||| ||||| Sbjct: 13244 aacaagtatatcaggaagtttttggatggcatcta 13210
>emb|CT025645.16| Mouse DNA sequence from clone RP23-233D21 on chromosome 13, complete sequence Length = 225179 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 50319 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 50368 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 50566 aacaaggatatcaggaagtttttggacggcatcta 50600
>gb|AC164120.2| Mus musculus BAC clone RP24-289J17 from chromosome 14, complete sequence Length = 147050 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 8717 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 8766 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 8964 aacaaggatatcaggaagtttttggacggcatcta 8998
>gb|U17332.1|MMU17332 Mus musculus ribosomal protein L9 (musl9) mRNA, partial cds Length = 519 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 221 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 270 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 468 aacaaggatatcaggaagtttttggacggcatcta 502
>gb|U17331.1|MMU17331 Mus musculus mutant ribosomal protein L9 (musl9mu) mRNA, partial cds Length = 519 Score = 60.0 bits (30), Expect = 2e-05 Identities = 45/50 (90%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 221 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaacg 270 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 468 aacaaggatatcaggaagtttttggacggcatcta 502
>ref|XR_003890.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9 (LOC672532), mRNA Length = 718 Score = 58.0 bits (29), Expect = 6e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaac 398 ||||||||| ||||||||||| | || ||||||||||||||||||||| Sbjct: 292 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaac 340 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 539 aacaaggatatcaggaagtttttggacggcatcta 573
>ref|XR_002003.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L9 (LOC667290), mRNA Length = 718 Score = 58.0 bits (29), Expect = 6e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaac 398 ||||||||| ||||||||||| | || ||||||||||||||||||||| Sbjct: 292 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaac 340 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 539 aacaaggatatcaggaagtttttggacggcatcta 573
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence Length = 2300533 Score = 58.0 bits (29), Expect = 6e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacgcc 401 ||||||||| |||||||||||| | |||||||| || ||||||||||||||| Sbjct: 76408 agggcttcctctacaagatgcgacttgtctacgcgcatttccccatcaacgcc 76460
>gb|BC077675.1| Xenopus tropicalis cDNA clone IMAGE:7028838, containing frame-shift errors Length = 674 Score = 58.0 bits (29), Expect = 6e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatctacgt 634 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 527 aagaataaggatatcagaaaattcttggatggtatctacgt 567
>gb|AC129539.11| Mus musculus chromosome 16, clone RP23-246B24, complete sequence Length = 238585 Score = 58.0 bits (29), Expect = 6e-05 Identities = 44/49 (89%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaac 398 ||||||||| ||||||||||| | || ||||||||||||||||||||| Sbjct: 140977 gggcttccgatacaagatgcggtctgtgtacgctcacttccccatcaac 141025 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 141224 aacaaggatatcaggaagtttttggacggcatcta 141258
>gb|AF526225.1| Argopecten irradians isolate iolsaicl305ct342cn364 ribosomal protein L9 mRNA, complete cds Length = 645 Score = 58.0 bits (29), Expect = 6e-05 Identities = 35/37 (94%) Strand = Plus / Plus Query: 598 acaaggatatcaggaagttcttggatggtatctacgt 634 ||||||||||||| |||||||||||||| |||||||| Sbjct: 530 acaaggatatcagaaagttcttggatggaatctacgt 566
>emb|CT025295.2| Xenopus tropicalis finished cDNA, clone TNeu059k22 Length = 678 Score = 58.0 bits (29), Expect = 6e-05 Identities = 38/41 (92%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatctacgt 634 ||||| ||||||||||| || |||||||||||||||||||| Sbjct: 505 aagaataaggatatcagaaaattcttggatggtatctacgt 545
>emb|AJ843878.1| Platichthys flesus mRNA for 60S ribosomal protein L9 (rpl9 gene) Length = 769 Score = 58.0 bits (29), Expect = 6e-05 Identities = 41/45 (91%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 ||||| || |||||||| || |||||||||||||||||||||||| Sbjct: 510 gtcaaaaataaggatattagaaagttcttggatggtatctacgtc 554
>ref|XM_001229309.1| Chaetomium globosum CBS 148.51 conserved hypothetical protein (CHGG_02794) mRNA, complete cds Length = 579 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 596 gaacaaggatatcaggaagttcttggatggtatctacgtc 635 ||||||||||||| ||||||||||||| || ||||||||| Sbjct: 510 gaacaaggatatccggaagttcttggacggcatctacgtc 549 Score = 54.0 bits (27), Expect = 0.001 Identities = 57/67 (85%) Strand = Plus / Plus Query: 333 atcaccggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttcccc 392 |||| |||||| |||||||||||| ||||||||||| | ||||||||| || || ||| Sbjct: 235 atcatcggcgtgaccaagggcttcaagtacaagatgcgttacgtctacgcccattttccc 294 Query: 393 atcaacg 399 ||||||| Sbjct: 295 atcaacg 301 Score = 44.1 bits (22), Expect = 0.93 Identities = 28/30 (93%) Strand = Plus / Plus Query: 427 tcgagatccgcaacttcctcggcgagaaga 456 |||||||||| |||||| |||||||||||| Sbjct: 341 tcgagatccgtaacttcatcggcgagaaga 370
>ref|XM_001217120.1| Aspergillus terreus NIH2624 60S ribosomal protein L9-B (ATEG_08535) mRNA, complete cds Length = 579 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 360 tacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||| ||| ||||||||||| |||||||||| Sbjct: 262 tacaagatgcgctacgtgtacgctcactttcccatcaacg 301
>gb|BT026790.1| Gasterosteus aculeatus clone CFW45-F03 mRNA sequence Length = 745 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgt 634 ||||| || ||||||||| | ||||||||||||||||||||||| Sbjct: 504 gtcaaaaataaggatatccgaaagttcttggatggtatctacgt 547
>ref|XM_362383.1| Magnaporthe grisea 70-15 hypothetical protein (MG04829.4) partial mRNA Length = 585 Score = 56.0 bits (28), Expect = 2e-04 Identities = 37/40 (92%) Strand = Plus / Plus Query: 596 gaacaaggatatcaggaagttcttggatggtatctacgtc 635 ||||||||||||| | ||||||||||||||||| |||||| Sbjct: 510 gaacaaggatatccgtaagttcttggatggtatgtacgtc 549 Score = 52.0 bits (26), Expect = 0.004 Identities = 50/58 (86%) Strand = Plus / Plus Query: 342 gtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||| | ||||||||||| | ||||||||| || ||||||||||||| Sbjct: 244 gtcaccaagggctacaagtacaagatgcgttacgtctacgcccatttccccatcaacg 301 Score = 42.1 bits (21), Expect = 3.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 427 tcgagatccgcaacttcctcggcgagaag 455 |||||||||| |||||| ||||||||||| Sbjct: 341 tcgagatccgaaacttcatcggcgagaag 369
>ref|NM_117113.2| Arabidopsis thaliana structural constituent of ribosome (AT4G10450) mRNA, complete cds Length = 900 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||| |||||||| || || ||||| ||||||||||||||||| | ||||||||||| Sbjct: 557 atcaatcagaaatgtcatgtgaagaagaaggatatcaggaagtttcttgatggtatctat 616 Query: 633 gtcagcga 640 || ||||| Sbjct: 617 gtgagcga 624 Score = 50.1 bits (25), Expect = 0.015 Identities = 37/41 (90%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggt 469 ||||| || |||||||| || |||||||||||||||||||| Sbjct: 413 gagattcgtaacttccttggtgagaagaaggtgaggaaggt 453
>gb|AY020397.1| Oryza sativa microsatellite MRG2722 containing (GA)X16, genomic sequence Length = 232 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 94 agatgaagaccatcctggcgtcggagacgatggacatcccggaggaggtgacggtg 149 |||||||||| ||| |||| |||||||||||||| |||||| || |||||||||| Sbjct: 138 agatgaagacgatcttggcttcggagacgatggagatcccgtcgggggtgacggtg 193
>ref|NM_001043679.1| Bombyx mori ribosomal protein L9 (Rpl9), mRNA gb|AY769277.1| Bombyx mori ribosomal protein L9 (RpL9) mRNA, complete cds Length = 665 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggt 626 |||||||| ||||||||||| ||||||||||||||| Sbjct: 541 gtcaagaataaggatatcagaaagttcttggatggt 576
>gb|AY117346.1| Arabidopsis thaliana putative ribosomal protein L9 (At4g10450) mRNA, complete cds Length = 616 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||| |||||||| || || ||||| ||||||||||||||||| | ||||||||||| Sbjct: 490 atcaatcagaaatgtcatgtgaagaagaaggatatcaggaagtttcttgatggtatctat 549 Query: 633 gtcagcga 640 || ||||| Sbjct: 550 gtgagcga 557 Score = 50.1 bits (25), Expect = 0.015 Identities = 37/41 (90%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggt 469 ||||| || |||||||| || |||||||||||||||||||| Sbjct: 346 gagattcgtaacttccttggtgagaagaaggtgaggaaggt 386
>gb|AY065259.1| Arabidopsis thaliana putative ribosomal protein L9 (At4g10450) mRNA, complete cds Length = 812 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||| |||||||| || || ||||| ||||||||||||||||| | ||||||||||| Sbjct: 557 atcaatcagaaatgtcatgtgaagaagaaggatatcaggaagtttcttgatggtatctat 616 Query: 633 gtcagcga 640 || ||||| Sbjct: 617 gtgagcga 624 Score = 50.1 bits (25), Expect = 0.015 Identities = 37/41 (90%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggt 469 ||||| || |||||||| || |||||||||||||||||||| Sbjct: 413 gagattcgtaacttccttggtgagaagaaggtgaggaaggt 453
>emb|CR729736.3|CNS0GQ0E Tetraodon nigroviridis full-length cDNA Length = 732 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgt 634 ||||| || ||||||||||| ||||||||||||||||| ||||| Sbjct: 502 gtcaaaaataaggatatcagaaagttcttggatggtatttacgt 545
>gb|AY086090.1| Arabidopsis thaliana clone 21228 mRNA, complete sequence Length = 797 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||| |||||||| || || ||||| ||||||||||||||||| | ||||||||||| Sbjct: 558 atcaatcagaaatgtcatgtgaagaagaaggatatcaggaagtttcttgatggtatctat 617 Query: 633 gtcagcga 640 || ||||| Sbjct: 618 gtgagcga 625 Score = 50.1 bits (25), Expect = 0.015 Identities = 37/41 (90%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggt 469 ||||| || |||||||| || |||||||||||||||||||| Sbjct: 414 gagattcgtaacttccttggtgagaagaaggtgaggaaggt 454
>dbj|AK105332.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-118-D01, full insert sequence Length = 649 Score = 56.0 bits (28), Expect = 2e-04 Identities = 52/60 (86%) Strand = Plus / Plus Query: 339 ggcgtcaccaagggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaac 398 ||||||| |||||||| | ||||||||||| |||||||| |||||||| ||||||||| Sbjct: 281 ggcgtcatcaagggctacaagtacaagatgcgattcgtctatgctcactttcccatcaac 340 Score = 42.1 bits (21), Expect = 3.7 Identities = 39/45 (86%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgtc 635 ||||||||||||||||| | || || ||||| |||||||||||| Sbjct: 530 gtcaagaacaaggatattcgtaaatttttggacggtatctacgtc 574
>emb|BX829170.1|CNS0A4I1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL77ZF10 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 834 Score = 56.0 bits (28), Expect = 2e-04 Identities = 58/68 (85%) Strand = Plus / Plus Query: 573 atcaaccagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctac 632 ||||| |||||||| || || ||||| ||||||||||||||||| | ||||||||||| Sbjct: 496 atcaatcagaaatgtcatgtgaagaagaaggatatcaggaagtttcttgatggtatctat 555 Query: 633 gtcagcga 640 || ||||| Sbjct: 556 gtgagcga 563 Score = 50.1 bits (25), Expect = 0.015 Identities = 37/41 (90%) Strand = Plus / Plus Query: 429 gagatccgcaacttcctcggcgagaagaaggtgaggaaggt 469 ||||| || |||||||| || |||||||||||||||||||| Sbjct: 352 gagattcgtaacttccttggtgagaagaaggtgaggaaggt 392
>gb|BC111370.1| Homo sapiens cDNA clone MGC:131531 IMAGE:7470370, complete cds Length = 703 Score = 56.0 bits (28), Expect = 2e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgt 634 ||||| || ||||||||| | ||||||||||||||||||||||| Sbjct: 502 gtcaaaaataaggatatccgaaagttcttggatggtatctacgt 545
>ref|XR_023388.1| PREDICTED: Pan troglodytes similar to Ribosomal protein L9 (LOC465956), mRNA Length = 756 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 549 aacaaggatatcaggaaatttttggatggtatcta 583 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 302 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 351
>ref|XM_001149713.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue, transcript variant 1 (LOC456388), mRNA Length = 599 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 388 aacaaggatatcaggaaatttttggatggtatcta 422
>ref|XM_001149779.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue, transcript variant 2 (LOC456388), mRNA Length = 671 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 460 aacaaggatatcaggaaatttttggatggtatcta 494 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 294 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 343
>ref|XM_001149984.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue, transcript variant 5 (LOC456388), mRNA Length = 761 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 546 aacaaggatatcaggaaatttttggatggtatcta 580 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 299 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 348
>ref|XM_001149922.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue, transcript variant 4 (LOC456388), mRNA Length = 733 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 518 aacaaggatatcaggaaatttttggatggtatcta 552 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 271 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 320
>ref|XM_001149849.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue, transcript variant 3 (LOC456388), mRNA Length = 739 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 524 aacaaggatatcaggaaatttttggatggtatcta 558 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 277 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 326
>ref|XM_001138852.1| PREDICTED: Pan troglodytes similar to 60S ribosomal protein L9, transcript variant 2 (LOC736017), mRNA Length = 747 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 541 aacaaggatatcaggaaatttttggatggtatcta 575
>ref|XM_001138757.1| PREDICTED: Pan troglodytes similar to 60S ribosomal protein L9, transcript variant 1 (LOC736017), mRNA Length = 529 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 339 aacaaggatatcaggaaatttttggatggtatcta 373
>ref|XM_001152896.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue, transcript variant 2 (LOC740485), mRNA Length = 754 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 549 aacaaggatatcaggaaatttttggatggtatcta 583 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 302 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 351
>ref|XR_023757.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue (LOC471575), mRNA Length = 645 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 454 aacaaggatatcaggaaatttttggatggtatcta 488
>ref|XM_001141738.1| PREDICTED: Pan troglodytes similar to rat ribosomal protein L9 homologue (LOC737526), mRNA Length = 2372 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 571 aacaaggatatcaggaaatttttggatggtatcta 605 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 324 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 373
>gb|DQ895974.1| Homo sapiens clone FLH189149.01L; RZPDo839C0264D RPL9 mRNA, partial sequence Length = 579 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 505 aacaaggatatcaggaaatttttggatggtatcta 539 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 258 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 307
>gb|DQ892959.1| Synthetic construct Homo sapiens clone FLH191172.01X; RZPDo839A0577D RPL9 mRNA, complete sequence Length = 579 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 505 aacaaggatatcaggaaatttttggatggtatcta 539 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 258 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 307
>gb|DQ892727.1| Synthetic construct Homo sapiens clone FLH189153.01X; RZPDo839C0274D RPL9 mRNA, complete sequence Length = 579 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 505 aacaaggatatcaggaaatttttggatggtatcta 539 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 258 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 307
>ref|XR_015944.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L9 (LOC731681), mRNA Length = 711 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 524 aacaaggatatcaggaaatttttggatggtatcta 558
>ref|XR_015160.1| PREDICTED: Homo sapiens similar to 60S ribosomal protein L9 (LOC727865), mRNA Length = 711 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 524 aacaaggatatcaggaaatttttggatggtatcta 558
>ref|XR_015393.1| PREDICTED: Homo sapiens similar to ribosomal protein L9 (LOC728523), mRNA Length = 576 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 504 aacaaggatatcaggaaatttttggatggtatcta 538
>gb|BC007261.1| Homo sapiens cDNA clone IMAGE:3050745, **** WARNING: chimeric clone **** Length = 1740 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 1550 aacaaggatatcaggaaatttttggatggtatcta 1584 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 1303 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 1352
>ref|XM_001056263.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9 (predicted) (RGD1559566_predicted), mRNA Length = 706 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 536 aacaaggatatcaggaagtttttggatggcatcta 570
>ref|XM_234521.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9 (predicted) (RGD1559566_predicted), mRNA Length = 706 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 536 aacaaggatatcaggaagtttttggatggcatcta 570
>ref|XR_008195.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9 (predicted) (RGD1562134_predicted), mRNA Length = 667 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 501 aacaaggatatcaggaagtttttggatggcatcta 535
>ref|XR_008557.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9 (predicted) (RGD1562204_predicted), mRNA Length = 701 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 533 aacaaggatatcaggaagtttttggatggcatcta 567
>ref|XM_001074676.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9 (predicted) (RGD1561789_predicted), mRNA Length = 707 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 533 aacaaggatatcaggaagtttttggatggcatcta 567
>ref|XM_345600.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L9 (predicted) (RGD1561789_predicted), mRNA Length = 707 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 533 aacaaggatatcaggaagtttttggatggcatcta 567
>ref|XM_001107304.1| PREDICTED: Macaca mulatta similar to ribosomal protein L9 (LOC716530), mRNA Length = 641 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 455 aacaaggatatcaggaaatttttggatggtatcta 489 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 289 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 338
>ref|XM_001116101.1| PREDICTED: Macaca mulatta similar to ribosomal protein L9, transcript variant 1 (LOC718478), mRNA Length = 634 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 461 aacaaggatatcaggaaatttttggatggtatcta 495
>ref|XM_001116116.1| PREDICTED: Macaca mulatta similar to ribosomal protein L9, transcript variant 2 (LOC718478), mRNA Length = 764 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 553 aacaaggatatcaggaaatttttggatggtatcta 587
>ref|XM_001094980.1| PREDICTED: Macaca mulatta similar to ribosomal protein L9 (LOC706496), mRNA Length = 753 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 547 aacaaggatatcaggaaatttttggatggtatcta 581
>ref|XR_009927.1| PREDICTED: Macaca mulatta similar to 60S ribosomal protein L9 (LOC694093), mRNA Length = 645 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 467 aacaaggatatcaggaaatttttggatggtatcta 501 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 301 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 350
>ref|XR_010397.1| PREDICTED: Macaca mulatta similar to 60S ribosomal protein L9 (LOC696265), mRNA Length = 730 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 536 aacaaggatatcaggaaatttttggatggtatcta 570
>ref|XM_001092114.1| PREDICTED: Macaca mulatta similar to ribosomal protein L9 (LOC699362), mRNA Length = 752 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 564 aacaaggatatcaggaaatttttggatggtatcta 598 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 317 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 366
>gb|BC082260.1| Homo sapiens cDNA clone IMAGE:6427299, **** WARNING: chimeric clone **** Length = 1715 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 1523 aacaaggatatcaggaaatttttggatggtatcta 1557 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 1276 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 1325
>gb|BC071935.1| Homo sapiens cDNA clone IMAGE:4637729, **** WARNING: chimeric clone **** Length = 1190 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 1000 aacaaggatatcaggaaatttttggatggtatcta 1034 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 753 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 802
>gb|BC008758.2| Homo sapiens cDNA clone IMAGE:3344121, **** WARNING: chimeric clone **** Length = 2357 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 2166 aacaaggatatcaggaaatttttggatggtatcta 2200 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 1919 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 1968
>gb|BC086561.1| Rattus norvegicus ribosomal protein L9, mRNA (cDNA clone MGC:105798 IMAGE:7304371), complete cds Length = 705 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 511 aacaaggatatcaggaagtttttggatggcatcta 545
>gb|AY597415.1| Homo sapiens chromosome 15 carcinoma associated antigen CRC-L-10 mRNA sequence Length = 840 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 538 aacaaggatatcaggaaatttttggatggtatcta 572 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 291 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 340
>gb|BC004156.2| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:2418 IMAGE:2961026), complete cds Length = 730 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 510 aacaaggatatcaggaaatttttggatggtatcta 544 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 263 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 312
>gb|BC000483.2| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:8704 IMAGE:2964733), complete cds Length = 718 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 516 aacaaggatatcaggaaatttttggatggtatcta 550 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 269 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 318
>gb|BC031906.1| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:29903 IMAGE:4996986), complete cds Length = 765 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 511 aacaaggatatcaggaaatttttggatggtatcta 545 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 264 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 313
>gb|BC004206.2| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:4066 IMAGE:2961026), complete cds Length = 730 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 510 aacaaggatatcaggaaatttttggatggtatcta 544 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 263 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 312
>gb|AC149298.1| Populus trichocarpa clone Pop1-021H24, complete sequence Length = 146635 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggt 460 ||||||||||| ||||| ||||||||||||||||| Sbjct: 91713 atcgagatccggaactttctcggcgagaagaaggt 91679 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggt 460 ||||||||||| ||||| ||||||||||||||||| Sbjct: 96188 atcgagatccggaactttctcggcgagaagaaggt 96154 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 426 atcgagatccgcaacttcctcggcgagaagaaggt 460 ||||||||||| ||||| ||||||||||||||||| Sbjct: 103907 atcgagatccggaactttctcggcgagaagaaggt 103873 Score = 50.1 bits (25), Expect = 0.015 Identities = 58/69 (84%) Strand = Plus / Minus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 |||||||| || |||||||||||||||||| | || || | |||||||||||||| || Sbjct: 90273 cagaaatgtcatgtcaagaacaaggatatccgaaaatttcttgatggtatctacgtgagt 90214 Query: 639 gacaagggc 647 || |||||| Sbjct: 90213 gagaagggc 90205 Score = 50.1 bits (25), Expect = 0.015 Identities = 58/69 (84%) Strand = Plus / Minus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 |||||||| || |||||||||||||||||| | || || | |||||||||||||| || Sbjct: 95053 cagaaatgtcatgtcaagaacaaggatatccgaaaatttcttgatggtatctacgtgagt 94994 Query: 639 gacaagggc 647 || |||||| Sbjct: 94993 gagaagggc 94985 Score = 50.1 bits (25), Expect = 0.015 Identities = 58/69 (84%) Strand = Plus / Minus Query: 579 cagaaatgccacgtcaagaacaaggatatcaggaagttcttggatggtatctacgtcagc 638 |||||||| || |||||||||||||||||| | || || | |||||||||||||| || Sbjct: 102762 cagaaatgtcatgtcaagaacaaggatatccgaaaatttcttgatggtatctacgtaagt 102703 Query: 639 gacaagggc 647 || |||||| Sbjct: 102702 gagaagggc 102694
>gb|AC112147.5| Mus musculus BAC clone RP23-175E16 from 9, complete sequence Length = 202928 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||| |||||||||||||| ||||| Sbjct: 97319 aacaaggatatcagtaagttcttggatggcatcta 97353
>gb|AY376242.1| Homo sapiens ribosomal protein L9 isoform mRNA, complete cds Length = 884 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 681 aacaaggatatcaggaaatttttggatggtatcta 715 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 434 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 483
>dbj|AK126371.1| Homo sapiens cDNA FLJ44407 fis, clone TUTER2002228, highly similar to Homo sapiens ribosomal protein L9 (RPL9) Length = 1813 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 1641 aacaaggatatcaggaaatttttggatggtatcta 1675 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 1394 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 1443
>gb|AY320412.1| Homo sapiens nasopharyngeal carcinoma-associated antigen NPC-A-16 mRNA, complete cds Length = 719 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 547 aacaaggatatcaggaaatttttggatggtatcta 581 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 300 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 349
>gb|BC100285.1| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:117341 IMAGE:6022858), complete cds Length = 877 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 671 aacaaggatatcaggaaatttttggatggtatcta 705 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 424 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 473
>gb|BC066318.1| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:87207 IMAGE:5277491), complete cds Length = 719 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 531 aacaaggatatcaggaaatttttggatggtatcta 565 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 284 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 333
>ref|XM_461133.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F19195g) partial mRNA Length = 576 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||| | |||||||||||||||||||| Sbjct: 505 aacaaggatatccgtaagttcttggatggtatcta 539
>dbj|AB169592.1| Macaca fascicularis brain cDNA, clone: QnpA-15262, similar to human ribosomal protein L9; 60S ribosomal proteinL9 (LOC388147), mRNA, RefSeq: XM_370882.2 Length = 725 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 535 aacaaggatatcaggaaatttttggatggtatcta 569 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 288 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 337
>gb|AC108000.5| Homo sapiens chromosome 15, clone CTD-2116G1, complete sequence Length = 167587 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 146673 aacaaggatatcaggaaatttttggatggtatcta 146639 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 146920 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 146871
>gb|AC021148.8| Homo sapiens BAC clone RP11-472B18 from 4, complete sequence Length = 124102 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 20434 aacaaggatatcaggaaatttttggatggtatcta 20400 Score = 46.1 bits (23), Expect = 0.23 Identities = 44/51 (86%) Strand = Plus / Minus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 22357 agggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 22307
>gb|AC011295.3| Homo sapiens BAC clone RP11-96J23 from 15, complete sequence Length = 148698 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 48991 aacaaggatatcaggaaatttttggatggtatcta 49025 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 48744 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 48793
>gb|BC070214.1| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:88195 IMAGE:6605055), complete cds Length = 817 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 570 aacaaggatatcaggaaatttttggatggtatcta 604 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 323 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 372
>gb|BC012149.1| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:20365 IMAGE:4554838), complete cds Length = 767 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 566 aacaaggatatcaggaaatttttggatggtatcta 600 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 319 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 368
>gb|BC007967.2| Homo sapiens ribosomal protein L9, mRNA (cDNA clone MGC:14460 IMAGE:4304670), complete cds Length = 766 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 566 aacaaggatatcaggaaatttttggatggtatcta 600 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 319 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 368
>ref|NM_001022689.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPCC613.06), partial mRNA Length = 570 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||| | |||||||||||||||||||| Sbjct: 499 aacaaggatatccgtaagttcttggatggtatcta 533 Score = 50.1 bits (25), Expect = 0.015 Identities = 40/45 (88%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaac 398 ||||||||||||||||| | ||||| |||||||| ||||||||| Sbjct: 256 ttccgctacaagatgcgtcttgtctatgctcactttcccatcaac 300
>emb|X51706.1|RRRPL9 Rat mRNA for ribosomal protein L9 Length = 671 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 511 aacaaggatatcaggaagtttttggatggcatcta 545
>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces hansenii Length = 2336804 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||| | |||||||||||||||||||| Sbjct: 1533840 aacaaggatatccgtaagttcttggatggtatcta 1533874
>gb|AC010469.7|AC010469 Homo sapiens chromosome 5 clone CTD-2290C23, complete sequence Length = 120825 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 83906 aacaaggatatcaggaaatttttggatggtatcta 83872
>emb|AL031644.1|SPCC613 S.pombe chromosome III cosmid c613 Length = 28999 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||| | |||||||||||||||||||| Sbjct: 10478 aacaaggatatccgtaagttcttggatggtatcta 10512 Score = 50.1 bits (25), Expect = 0.015 Identities = 40/45 (88%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaac 398 ||||||||||||||||| | ||||| |||||||| ||||||||| Sbjct: 10235 ttccgctacaagatgcgtcttgtctatgctcactttcccatcaac 10279
>emb|AJ421478.1| Mus musculus X-inactivation center region; segment 1/3 Length = 247850 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 238869 aacaaggatatcaggaagtttttggatggcatcta 238835 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 239116 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 239067
>gb|DQ000524.1| Synthetic construct clone PSF:106517 RPL9 gene, complete cds Length = 651 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 577 aacaaggatatcaggaaatttttggatggtatcta 611 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 330 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 379
>gb|AC008507.11| Homo sapiens chromosome 19 clone CTC-448F2, complete sequence Length = 179005 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 53441 aacaaggatatcaggaaatttttggatggtatcta 53407
>emb|CR859325.1| Pongo pygmaeus mRNA; cDNA DKFZp468P184 (from clone DKFZp468P184) Length = 721 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 533 aacaaggatatcaggaaatttttggatggtatcta 567 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 286 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 335
>emb|AL832047.1|HSM803354 Homo sapiens mRNA; cDNA DKFZp313J1510 (from clone DKFZp313J1510) Length = 4333 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 3813 aacaaggatatcaggaaatttttggatggtatcta 3847 Score = 46.1 bits (23), Expect = 0.23 Identities = 44/51 (86%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 1889 agggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 1939
>emb|CR625200.1| full-length cDNA clone CS0DI028YK02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 704 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 531 aacaaggatatcaggaaatttttggatggtatcta 565 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 284 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 333
>emb|CR620053.1| full-length cDNA clone CS0DC018YI17 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 826 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 653 aacaaggatatcaggaaatttttggatggtatcta 687 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 406 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 455
>gb|AY130413.1| Scyliorhinus canicula ribosomal protein L9-like mRNA, partial sequence Length = 501 Score = 54.0 bits (27), Expect = 0.001 Identities = 36/39 (92%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgtc 635 |||||||||||| | ||||||||||||||||| |||||| Sbjct: 463 aacaaggatatccgaaagttcttggatggtatttacgtc 501
>emb|CR608917.1| full-length cDNA clone CS0DF030YI08 of Fetal brain of Homo sapiens (human) Length = 748 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 562 aacaaggatatcaggaaatttttggatggtatcta 596 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 315 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 364
>emb|CR605562.1| full-length cDNA clone CS0DJ005YC21 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 700 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 510 aacaaggatatcaggaaatttttggatggtatcta 544 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 263 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 312
>emb|CR605134.1| full-length cDNA clone CS0DK007YG19 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1665 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 508 aacaaggatatcaggaaatttttggatggtatcta 542 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 261 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 310
>emb|CR604940.1| full-length cDNA clone CS0DE007YC10 of Placenta of Homo sapiens (human) Length = 665 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 513 aacaaggatatcaggaaatttttggatggtatcta 547 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 266 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 315
>emb|CR604645.1| full-length cDNA clone CS0DB001YG03 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 655 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 512 aacaaggatatcaggaaatttttggatggtatcta 546 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 265 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 314
>emb|CR596023.1| full-length cDNA clone CS0CAP008YF03 of Thymus of Homo sapiens (human) Length = 641 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 500 aacaaggatatcaggaaatttttggatggtatcta 534 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 253 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 302
>emb|CR595992.1| full-length cDNA clone CS0DI044YL08 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2153 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 2014 aacaaggatatcaggaaatttttggatggtatcta 2048 Score = 46.1 bits (23), Expect = 0.23 Identities = 44/51 (86%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 1766 agggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 1816
>emb|CR593616.1| full-length cDNA clone CS0DC004YK05 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 680 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 507 aacaaggatatcaggaaatttttggatggtatcta 541 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 260 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 309
>emb|CR592704.1| full-length cDNA clone CS0DD004YA24 of Neuroblastoma Cot 50-normalized of Homo sapiens (human) Length = 693 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 512 aacaaggatatcaggaaatttttggatggtatcta 546 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 265 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 314
>gb|AC139425.3| Homo sapiens chromosome 15, clone RP13-996F3, complete sequence Length = 132528 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 102590 aacaaggatatcaggaaatttttggatggtatcta 102556 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 102837 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 102788
>gb|AC131011.5| Homo sapiens X BAC RP13-314C10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 176121 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 47112 aacaaggatatcaggaaatttttggatggtatcta 47146 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 46865 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 46914
>dbj|AK130966.1| Homo sapiens cDNA FLJ27456 fis, clone TST99901, highly similar to 60S ribosomal protein L9 Length = 699 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 527 aacaaggatatcaggaaatttttggatggtatcta 561 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 280 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 329
>dbj|AP004977.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT12A10, TM0160, complete sequence Length = 74313 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 582 aaatgccacgtcaagaacaaggatatcaggaagtt 616 |||||||| || ||||||||||||||||||||||| Sbjct: 400 aaatgccatgttaagaacaaggatatcaggaagtt 434
>ref|NM_000661.4| Homo sapiens ribosomal protein L9 (RPL9), transcript variant 1, mRNA Length = 766 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 564 aacaaggatatcaggaaatttttggatggtatcta 598 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 317 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 366
>ref|NM_001024921.2| Homo sapiens ribosomal protein L9 (RPL9), transcript variant 2, mRNA Length = 842 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 653 aacaaggatatcaggaaatttttggatggtatcta 687 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 406 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 455
>gb|AY892436.1| Synthetic construct Homo sapiens clone FLH028277.01L ribosomal protein L9 (RPL9) mRNA, partial cds Length = 579 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 505 aacaaggatatcaggaaatttttggatggtatcta 539 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 258 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 307
>gb|AY889960.1| Synthetic construct Homo sapiens clone FLH028279.01X ribosomal protein L9 (RPL9) mRNA, complete cds Length = 579 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 505 aacaaggatatcaggaaatttttggatggtatcta 539 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 258 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 307
>dbj|D14531.1|HUMHHRRPL9 Homo sapiens mRNA for rat ribosomal protein L9 homologue, complete cds Length = 689 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 511 aacaaggatatcaggaaatttttggatggtatcta 545 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 264 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 313
>emb|AL121594.6|CNS01DRY Human chromosome 14 DNA sequence BAC R-173D9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 196023 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Minus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 38134 aacaaggatatcaggaaatttttggatggtatcta 38100
>emb|AL683845.15| Mouse DNA sequence from clone RP23-423B1 on chromosome X, complete sequence Length = 134201 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| |||||||| ||||| Sbjct: 64688 aacaaggatatcaggaagtttttggatggcatcta 64722 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 64441 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 64490
>gb|U09955.1|HSU09955 Human ribosomal protein L9 pseudogene Length = 1688 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 1382 aacaaggatatcaggaaatttttggatggtatcta 1416
>gb|U09954.1|HSU09954 Human ribosomal protein L9 gene, 5' region and complete cds Length = 5542 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 4875 aacaaggatatcaggaaatttttggatggtatcta 4909 Score = 46.1 bits (23), Expect = 0.23 Identities = 44/51 (86%) Strand = Plus / Plus Query: 349 agggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 2952 agggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 3002
>gb|U09953.1|HSU09953 Human ribosomal protein L9 mRNA, complete cds Length = 712 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 534 aacaaggatatcaggaaatttttggatggtatcta 568 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 287 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 336
>gb|U21138.1|HSU21138 Human ribosomal protein L9 mRNA, complete cds Length = 687 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 511 aacaaggatatcaggaaatttttggatggtatcta 545 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 264 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 313
>gb|AY742820.1| Macaca fascicularis RPL9 mRNA, complete cds Length = 579 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 505 aacaaggatatcaggaaatttttggatggtatcta 539 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 258 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 307
>dbj|AB007169.1| Homo sapiens gene for ribosomal protein L9, partial cds Length = 708 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 285 aacaaggatatcaggaaatttttggatggtatcta 319
>dbj|AB062431.1| Homo sapiens OK/SW-cl.103 mRNA for ribosomal protein L9, complete cds Length = 703 Score = 54.0 bits (27), Expect = 0.001 Identities = 33/35 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || |||||||||||||| Sbjct: 511 aacaaggatatcaggaaatttttggatggtatcta 545 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 264 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 313
>ref|XM_001179587.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal protein L9 (LOC591874), mRNA Length = 658 Score = 52.0 bits (26), Expect = 0.004 Identities = 38/42 (90%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatctacgtc 635 ||||||||||| |||||||| ||||||||||| |||||||| Sbjct: 506 aagaacaaggacatcaggaaattcttggatggcgtctacgtc 547 Score = 48.1 bits (24), Expect = 0.059 Identities = 39/44 (88%) Strand = Plus / Plus Query: 356 ccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||| | | || |||||||||||||||||||||| Sbjct: 268 ccgctacaagatgaggtctgtgtacgctcacttccccatcaacg 311 Score = 48.1 bits (24), Expect = 0.059 Identities = 39/44 (88%) Strand = Plus / Plus Query: 513 aaggatgagatcgtcctcgacggcaacgacatcgagctcgtctc 556 |||||||||||| |||| || |||||||| ||||||||||||| Sbjct: 425 aaggatgagatcatccttgatggcaacgatgtcgagctcgtctc 468
>ref|XM_791421.2| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal protein L9 (LOC591874), mRNA Length = 678 Score = 52.0 bits (26), Expect = 0.004 Identities = 38/42 (90%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatctacgtc 635 ||||||||||| |||||||| ||||||||||| |||||||| Sbjct: 526 aagaacaaggacatcaggaaattcttggatggcgtctacgtc 567 Score = 48.1 bits (24), Expect = 0.059 Identities = 39/44 (88%) Strand = Plus / Plus Query: 356 ccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||||| | | || |||||||||||||||||||||| Sbjct: 288 ccgctacaagatgaggtctgtgtacgctcacttccccatcaacg 331 Score = 48.1 bits (24), Expect = 0.059 Identities = 39/44 (88%) Strand = Plus / Plus Query: 513 aaggatgagatcgtcctcgacggcaacgacatcgagctcgtctc 556 |||||||||||| |||| || |||||||| ||||||||||||| Sbjct: 445 aaggatgagatcatccttgatggcaacgatgtcgagctcgtctc 488
>dbj|AK230606.1| Sus scrofa mRNA, clone:AMP010015E09, expressed in alveolar macrophage Length = 730 Score = 52.0 bits (26), Expect = 0.004 Identities = 35/38 (92%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatcta 631 ||||||||||||||||| || || |||||||||||||| Sbjct: 526 aagaacaaggatatcagaaaatttttggatggtatcta 563 Score = 44.1 bits (22), Expect = 0.93 Identities = 43/50 (86%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||| ||||||||| | | || || ||||||||||||||||||| Sbjct: 282 gggcttccgttacaagatgaggtctgtgtatgctcacttccccatcaacg 331
>ref|XR_008914.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L9 (LOC365200), mRNA Length = 831 Score = 52.0 bits (26), Expect = 0.004 Identities = 32/34 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatct 630 |||||||||||||||||||| |||||||| |||| Sbjct: 649 aacaaggatatcaggaagtttttggatggcatct 682
>ref|XR_007208.1| PREDICTED: Rattus norvegicus similar to ribosomal protein L9 (LOC365200), mRNA Length = 819 Score = 52.0 bits (26), Expect = 0.004 Identities = 32/34 (94%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatct 630 |||||||||||||||||||| |||||||| |||| Sbjct: 637 aacaaggatatcaggaagtttttggatggcatct 670
>gb|AC102159.10| Mus musculus chromosome 19, clone RP23-398L11, complete sequence Length = 197134 Score = 52.0 bits (26), Expect = 0.004 Identities = 44/50 (88%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 |||||||| ||||||||||| | || |||||||||||||||||||||| Sbjct: 120791 gggcttccaatacaagatgcggtctgtgtacgctcacttccccatcaacg 120840 Score = 46.1 bits (23), Expect = 0.23 Identities = 32/35 (91%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatcta 631 |||||||||||||||||||| ||||| || ||||| Sbjct: 121038 aacaaggatatcaggaagtttttggacggcatcta 121072
>gb|AY190735.1| Pagrus major ribosomal protein L9 mRNA, complete cds Length = 703 Score = 52.0 bits (26), Expect = 0.004 Identities = 41/46 (89%) Strand = Plus / Plus Query: 354 ttccgctacaagatgcgcttcgtctacgctcacttccccatcaacg 399 ||||||||||| ||||||| ||| ||||| || ||||||||||||| Sbjct: 272 ttccgctacaaaatgcgctccgtgtacgcccatttccccatcaacg 317 Score = 48.1 bits (24), Expect = 0.059 Identities = 39/44 (88%) Strand = Plus / Plus Query: 591 gtcaagaacaaggatatcaggaagttcttggatggtatctacgt 634 ||||| || ||||||||||| ||||||||||| ||||| ||||| Sbjct: 509 gtcaaaaataaggatatcagaaagttcttggacggtatttacgt 552 Score = 42.1 bits (21), Expect = 3.7 Identities = 36/41 (87%) Strand = Plus / Plus Query: 600 aaggatatcaggaagttcttggatggtatctacgtcagcga 640 ||||| |||||||||||| |||| || |||||| ||||||| Sbjct: 650 aaggacatcaggaagttcctggacggcatctacatcagcga 690
>gb|AY693129.1| Saccharomyces cerevisiae clone FLH114064.01X YNL067W gene, complete cds Length = 576 Score = 52.0 bits (26), Expect = 0.004 Identities = 35/38 (92%) Strand = Plus / Plus Query: 597 aacaaggatatcaggaagttcttggatggtatctacgt 634 |||||||||||| | ||||| ||||||||||||||||| Sbjct: 505 aacaaggatatccgtaagtttttggatggtatctacgt 542
>gb|AC158987.3| Mus musculus BAC clone RP23-366K1 from chromosome 9, complete sequence Length = 222125 Score = 52.0 bits (26), Expect = 0.004 Identities = 41/46 (89%) Strand = Plus / Minus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatc 395 ||||||||| ||||||||| | || || |||||||||||||||||| Sbjct: 28801 gggcttccgttacaagatgaggtttgtatacgctcacttccccatc 28756
>gb|AF548328.1| Branchiostoma belcheri ribosomal protein L9 mRNA, complete cds Length = 633 Score = 52.0 bits (26), Expect = 0.004 Identities = 38/42 (90%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatctacgtc 635 ||||||||||| ||| | |||||||||||||| ||||||||| Sbjct: 499 aagaacaaggacatccgcaagttcttggatggaatctacgtc 540 Score = 42.1 bits (21), Expect = 3.7 Identities = 42/49 (85%) Strand = Plus / Plus Query: 350 gggcttccgctacaagatgcgcttcgtctacgctcacttccccatcaac 398 ||||| ||||||||||||| | | ||| ||||| || |||||||||||| Sbjct: 255 gggctaccgctacaagatgaggtccgtgtacgcccatttccccatcaac 303
>gb|BC046581.1| Xenopus laevis ribosomal protein L9, mRNA (cDNA clone MGC:53473 IMAGE:5572192), complete cds Length = 674 Score = 52.0 bits (26), Expect = 0.004 Identities = 35/38 (92%) Strand = Plus / Plus Query: 594 aagaacaaggatatcaggaagttcttggatggtatcta 631 ||||| ||||||||||| || ||||||||||||||||| Sbjct: 511 aagaataaggatatcagaaaattcttggatggtatcta 548 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 148,527,096 Number of extensions: 8219882 Number of successful extensions: 235733 Number of sequences better than 10.0: 724 Number of HSP's gapped: 235684 Number of HSP's successfully gapped: 981 Length of query: 970 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 947 Effective length of database: 18,503,978,556 Effective search space: 17523267692532 Effective search space used: 17523267692532 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
