ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf42g13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_001048609.1| Oryza sativa (japonica cultivar-group) Os01g... 159 2e-35
2dbj|AK103127.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 2e-35
3dbj|AK058679.1| Oryza sativa (japonica cultivar-group) cDNA clon... 159 2e-35
4dbj|D78504.1| Oryza sativa (japonica cultivar-group) mRNA, simil... 159 2e-35
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 151 4e-33
6dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic D... 151 4e-33
7dbj|AB006788.1| Oryza sativa (japonica cultivar-group) gene for ... 151 4e-33
8dbj|AP002539.2| Oryza sativa (japonica cultivar-group) genomic D... 151 4e-33
9emb|CT830852.1| Oryza sativa (indica cultivar-group) cDNA clone:... 46 0.16
10gb|DQ508375.1| Synthetic construct codon-optimized L1 protein ge... 44 0.64
11gb|AC163238.3| Colobus guereza clone CH272-90I19, complete sequence 44 0.64
12ref|XM_420315.2| PREDICTED: Gallus gallus similar to Alport synd... 42 2.5
13ref|XM_001234034.1| PREDICTED: Gallus gallus similar to Alport s... 42 2.5
14ref|XM_513285.2| PREDICTED: Pan troglodytes similar to zinc fing... 42 2.5
15ref|XM_001163251.1| PREDICTED: Pan troglodytes similar to zinc f... 42 2.5
16ref|XM_001163534.1| PREDICTED: Pan troglodytes similar to zinc f... 42 2.5
17ref|XM_001163312.1| PREDICTED: Pan troglodytes similar to zinc f... 42 2.5
18ref|XM_001163575.1| PREDICTED: Pan troglodytes similar to zinc f... 42 2.5
19ref|XM_001103742.1| PREDICTED: Macaca mulatta similar to zinc fi... 42 2.5
20ref|XM_001103658.1| PREDICTED: Macaca mulatta similar to zinc fi... 42 2.5
21emb|BX663521.11| Zebrafish DNA sequence from clone DKEYP-50F5 in... 42 2.5
22gb|AE002152.1| Ureaplasma parvum serovar 3 str. ATCC 700970 sect... 42 2.5
23ref|XM_859438.1| PREDICTED: Canis familiaris similar to zinc fin... 42 2.5
24ref|XM_535326.2| PREDICTED: Canis familiaris similar to zinc fin... 42 2.5
25ref|XM_859402.1| PREDICTED: Canis familiaris similar to zinc fin... 42 2.5
26ref|XM_859386.1| PREDICTED: Canis familiaris similar to zinc fin... 42 2.5
27ref|XM_859370.1| PREDICTED: Canis familiaris similar to zinc fin... 42 2.5
28gb|AY099494.1| Homo sapiens archease-like protein mRNA, partial cds 42 2.5
29emb|AL160412.14| Human DNA sequence from clone RP5-827E24 on chr... 42 2.5
30emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I... 42 2.5
31emb|AL033529.25|HS27O5 Human DNA sequence from clone RP1-27O5 on... 42 2.5
32emb|CR932804.1| Mus musculus chromosome 2, clone ResGen-475I1 st... 42 2.5
33gb|BC058843.1| Homo sapiens zinc finger and BTB domain containin... 42 2.5
34ref|NM_178547.2| Homo sapiens zinc finger and BTB domain contain... 42 2.5
35emb|AL929034.17| Mouse DNA sequence from clone RP23-90F9 on chro... 42 2.5 
>ref|NM_001048609.1| Oryza sativa (japonica cultivar-group) Os01g0158000 (Os01g0158000)
           mRNA, complete cds
          Length = 1864
 Score =  159 bits (80), Expect = 2e-35
 Identities = 208/250 (83%), Gaps = 3/250 (1%)
 Strand = Plus / Plus

                                                                       
Query: 177 ccaccgctacgccatcaagtcctcagtgcacaatacggcagctagccggaggcgtgaaca 236
           ||||||| | ||| ||||||| ||||||| ||| |||||||||||||||||||| |||||
Sbjct: 126 ccaccgcgaagccctcaagtcgtcagtgcgcaacacggcagctagccggaggcgggaaca 185

                                                                       
Query: 237 ggctatagcaatagggaaggaaagaagggaagccttaatgcgtgcaaagcgtgtgtgccg 296
            ||||| || || |||||||||||| |||||||||| || ||||||||||||||||| ||
Sbjct: 186 agctattgcgattgggaaggaaagacgggaagccttgatccgtgcaaagcgtgtgtgtcg 245

                                                                       
Query: 297 tgccccactttctggcaacgatgaggctacaattgaagatggagatatggttat---tga 353
            || ||| |||||||||  ||||| |||  ||| ||||| || ||||||||  |   |||
Sbjct: 246 agctccaatttctggcagtgatgaagctgaaatggaagagggtgatatggtggtcgatga 305

                                                                       
Query: 354 tgagaaagcagatattgaaacaagaactgctcaagctgttgaagaattgaaatcagcttt 413
            |||||||||  | ||||  |||  |||||||| |||||||||||||||||||| |||||
Sbjct: 306 ggagaaagcatgtcttgaggcaaagactgctcatgctgttgaagaattgaaatctgcttt 365

                     
Query: 414 gtcaagccag 423
           ||||| ||||
Sbjct: 366 gtcaatccag 375



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 97  cctcgcagccgtcgagctccgccgccg 123
           |||||| ||||||||||||||||||||
Sbjct: 37  cctcgcggccgtcgagctccgccgccg 63
to top
>dbj|AK103127.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033119N19, full
           insert sequence
          Length = 1867

 Score =  159 bits (80), Expect = 2e-35
 Identities = 208/250 (83%), Gaps = 3/250 (1%)
 Strand = Plus / Plus

                                                                       
Query: 177 ccaccgctacgccatcaagtcctcagtgcacaatacggcagctagccggaggcgtgaaca 236
           ||||||| | ||| ||||||| ||||||| ||| |||||||||||||||||||| |||||
Sbjct: 129 ccaccgcgaagccctcaagtcgtcagtgcgcaacacggcagctagccggaggcgggaaca 188

                                                                       
Query: 237 ggctatagcaatagggaaggaaagaagggaagccttaatgcgtgcaaagcgtgtgtgccg 296
            ||||| || || |||||||||||| |||||||||| || ||||||||||||||||| ||
Sbjct: 189 agctattgcgattgggaaggaaagacgggaagccttgatccgtgcaaagcgtgtgtgtcg 248

                                                                       
Query: 297 tgccccactttctggcaacgatgaggctacaattgaagatggagatatggttat---tga 353
            || ||| |||||||||  ||||| |||  ||| ||||| || ||||||||  |   |||
Sbjct: 249 agctccaatttctggcagtgatgaagctgaaatggaagagggtgatatggtggtcgatga 308

                                                                       
Query: 354 tgagaaagcagatattgaaacaagaactgctcaagctgttgaagaattgaaatcagcttt 413
            |||||||||  | ||||  |||  |||||||| |||||||||||||||||||| |||||
Sbjct: 309 ggagaaagcatgtcttgaggcaaagactgctcatgctgttgaagaattgaaatctgcttt 368

                     
Query: 414 gtcaagccag 423
           ||||| ||||
Sbjct: 369 gtcaatccag 378



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 97  cctcgcagccgtcgagctccgccgccg 123
           |||||| ||||||||||||||||||||
Sbjct: 40  cctcgcggccgtcgagctccgccgccg 66
to top
>dbj|AK058679.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-H12, full
           insert sequence
          Length = 1766

 Score =  159 bits (80), Expect = 2e-35
 Identities = 208/250 (83%), Gaps = 3/250 (1%)
 Strand = Plus / Plus

                                                                       
Query: 177 ccaccgctacgccatcaagtcctcagtgcacaatacggcagctagccggaggcgtgaaca 236
           ||||||| | ||| ||||||| ||||||| ||| |||||||||||||||||||| |||||
Sbjct: 102 ccaccgcgaagccctcaagtcgtcagtgcgcaacacggcagctagccggaggcgggaaca 161

                                                                       
Query: 237 ggctatagcaatagggaaggaaagaagggaagccttaatgcgtgcaaagcgtgtgtgccg 296
            ||||| || || |||||||||||| |||||||||| || ||||||||||||||||| ||
Sbjct: 162 agctattgcgattgggaaggaaagacgggaagccttgatccgtgcaaagcgtgtgtgtcg 221

                                                                       
Query: 297 tgccccactttctggcaacgatgaggctacaattgaagatggagatatggttat---tga 353
            || ||| |||||||||  ||||| |||  ||| ||||| || ||||||||  |   |||
Sbjct: 222 agctccaatttctggcagtgatgaagctgaaatggaagagggtgatatggtggtcgatga 281

                                                                       
Query: 354 tgagaaagcagatattgaaacaagaactgctcaagctgttgaagaattgaaatcagcttt 413
            |||||||||  | ||||  |||  |||||||| |||||||||||||||||||| |||||
Sbjct: 282 ggagaaagcatgtcttgaggcaaagactgctcatgctgttgaagaattgaaatctgcttt 341

                     
Query: 414 gtcaagccag 423
           ||||| ||||
Sbjct: 342 gtcaatccag 351



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 97  cctcgcagccgtcgagctccgccgccg 123
           |||||| ||||||||||||||||||||
Sbjct: 13  cctcgcggccgtcgagctccgccgccg 39
to top
>dbj|D78504.1| Oryza sativa (japonica cultivar-group) mRNA, similar to yeast SRP1,
           complete cds
          Length = 1751

 Score =  159 bits (80), Expect = 2e-35
 Identities = 208/250 (83%), Gaps = 3/250 (1%)
 Strand = Plus / Plus

                                                                       
Query: 177 ccaccgctacgccatcaagtcctcagtgcacaatacggcagctagccggaggcgtgaaca 236
           ||||||| | ||| ||||||| ||||||| ||| |||||||||||||||||||| |||||
Sbjct: 77  ccaccgcgaagccctcaagtcgtcagtgcgcaacacggcagctagccggaggcgggaaca 136

                                                                       
Query: 237 ggctatagcaatagggaaggaaagaagggaagccttaatgcgtgcaaagcgtgtgtgccg 296
            ||||| || || |||||||||||| |||||||||| || ||||||||||||||||| ||
Sbjct: 137 agctattgcgattgggaaggaaagacgggaagccttgatccgtgcaaagcgtgtgtgtcg 196

                                                                       
Query: 297 tgccccactttctggcaacgatgaggctacaattgaagatggagatatggttat---tga 353
            || ||| |||||||||  ||||| |||  ||| ||||| || ||||||||  |   |||
Sbjct: 197 agctccaatttctggcagtgatgaagctgaaatggaagagggtgatatggtggtcgatga 256

                                                                       
Query: 354 tgagaaagcagatattgaaacaagaactgctcaagctgttgaagaattgaaatcagcttt 413
            |||||||||  | ||||  |||  |||||||| |||||||||||||||||||| |||||
Sbjct: 257 ggagaaagcatgtcttgaggcaaagactgctcatgctgttgaagaattgaaatctgcttt 316

                     
Query: 414 gtcaagccag 423
           ||||| ||||
Sbjct: 317 gtcaatccag 326
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  151 bits (76), Expect = 4e-33
 Identities = 192/230 (83%), Gaps = 3/230 (1%)
 Strand = Plus / Plus

                                                                           
Query: 201     agtgcacaatacggcagctagccggaggcgtgaacaggctatagcaatagggaaggaaag 260
               ||||| ||| |||||||||||||||||||| ||||| ||||| || || |||||||||||
Sbjct: 3047263 agtgcgcaacacggcagctagccggaggcgggaacaagctattgcgattgggaaggaaag 3047322

                                                                           
Query: 261     aagggaagccttaatgcgtgcaaagcgtgtgtgccgtgccccactttctggcaacgatga 320
               | |||||||||| || ||||||||||||||||| || || ||| |||||||||  |||||
Sbjct: 3047323 acgggaagccttgatccgtgcaaagcgtgtgtgtcgagctccaatttctggcagtgatga 3047382

                                                                           
Query: 321     ggctacaattgaagatggagatatggttat---tgatgagaaagcagatattgaaacaag 377
                |||  ||| ||||| || ||||||||  |   ||| |||||||||  | ||||  ||| 
Sbjct: 3047383 agctgaaatggaagagggtgatatggtggtcgatgaggagaaagcatgtcttgaggcaaa 3047442

                                                                 
Query: 378     aactgctcaagctgttgaagaattgaaatcagctttgtcaagccagtatg 427
                |||||||| |||||||||||||||||||| |||||||||| ||||||||
Sbjct: 3047443 gactgctcatgctgttgaagaattgaaatctgctttgtcaatccagtatg 3047492



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 97      cctcgcagccgtcgagctccgccgccg 123
               |||||| ||||||||||||||||||||
Sbjct: 3046468 cctcgcggccgtcgagctccgccgccg 3046494
to top
>dbj|AP003225.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0011G08
          Length = 139490

 Score =  151 bits (76), Expect = 4e-33
 Identities = 192/230 (83%), Gaps = 3/230 (1%)
 Strand = Plus / Plus

                                                                          
Query: 201    agtgcacaatacggcagctagccggaggcgtgaacaggctatagcaatagggaaggaaag 260
              ||||| ||| |||||||||||||||||||| ||||| ||||| || || |||||||||||
Sbjct: 128780 agtgcgcaacacggcagctagccggaggcgggaacaagctattgcgattgggaaggaaag 128839

                                                                          
Query: 261    aagggaagccttaatgcgtgcaaagcgtgtgtgccgtgccccactttctggcaacgatga 320
              | |||||||||| || ||||||||||||||||| || || ||| |||||||||  |||||
Sbjct: 128840 acgggaagccttgatccgtgcaaagcgtgtgtgtcgagctccaatttctggcagtgatga 128899

                                                                          
Query: 321    ggctacaattgaagatggagatatggttat---tgatgagaaagcagatattgaaacaag 377
               |||  ||| ||||| || ||||||||  |   ||| |||||||||  | ||||  ||| 
Sbjct: 128900 agctgaaatggaagagggtgatatggtggtcgatgaggagaaagcatgtcttgaggcaaa 128959

                                                                
Query: 378    aactgctcaagctgttgaagaattgaaatcagctttgtcaagccagtatg 427
               |||||||| |||||||||||||||||||| |||||||||| ||||||||
Sbjct: 128960 gactgctcatgctgttgaagaattgaaatctgctttgtcaatccagtatg 129009



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 97     cctcgcagccgtcgagctccgccgccg 123
              |||||| ||||||||||||||||||||
Sbjct: 127985 cctcgcggccgtcgagctccgccgccg 128011
to top
>dbj|AB006788.1| Oryza sativa (japonica cultivar-group) gene for importin alpha,
            complete cds
          Length = 5125

 Score =  151 bits (76), Expect = 4e-33
 Identities = 192/230 (83%), Gaps = 3/230 (1%)
 Strand = Plus / Plus

                                                                        
Query: 201  agtgcacaatacggcagctagccggaggcgtgaacaggctatagcaatagggaaggaaag 260
            ||||| ||| |||||||||||||||||||| ||||| ||||| || || |||||||||||
Sbjct: 1266 agtgcgcaacacggcagctagccggaggcgggaacaagctattgcgattgggaaggaaag 1325

                                                                        
Query: 261  aagggaagccttaatgcgtgcaaagcgtgtgtgccgtgccccactttctggcaacgatga 320
            | |||||||||| || ||||||||||||||||| || || ||| |||||||||  |||||
Sbjct: 1326 acgggaagccttgatccgtgcaaagcgtgtgtgtcgagctccaatttctggcagtgatga 1385

                                                                        
Query: 321  ggctacaattgaagatggagatatggttat---tgatgagaaagcagatattgaaacaag 377
             |||  ||| ||||| || ||||||||  |   ||| |||||||||  | ||||  ||| 
Sbjct: 1386 agctgaaatggaagagggtgatatggtggtcgatgaggagaaagcatgtcttgaggcaaa 1445

                                                              
Query: 378  aactgctcaagctgttgaagaattgaaatcagctttgtcaagccagtatg 427
             |||||||| |||||||||||||||||||| |||||||||| ||||||||
Sbjct: 1446 gactgctcatgctgttgaagaattgaaatctgctttgtcaatccagtatg 1495



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 97  cctcgcagccgtcgagctccgccgccg 123
           |||||| ||||||||||||||||||||
Sbjct: 471 cctcgcggccgtcgagctccgccgccg 497
to top
>dbj|AP002539.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0433F09
          Length = 150150

 Score =  151 bits (76), Expect = 4e-33
 Identities = 192/230 (83%), Gaps = 3/230 (1%)
 Strand = Plus / Plus

                                                                         
Query: 201   agtgcacaatacggcagctagccggaggcgtgaacaggctatagcaatagggaaggaaag 260
             ||||| ||| |||||||||||||||||||| ||||| ||||| || || |||||||||||
Sbjct: 15303 agtgcgcaacacggcagctagccggaggcgggaacaagctattgcgattgggaaggaaag 15362

                                                                         
Query: 261   aagggaagccttaatgcgtgcaaagcgtgtgtgccgtgccccactttctggcaacgatga 320
             | |||||||||| || ||||||||||||||||| || || ||| |||||||||  |||||
Sbjct: 15363 acgggaagccttgatccgtgcaaagcgtgtgtgtcgagctccaatttctggcagtgatga 15422

                                                                         
Query: 321   ggctacaattgaagatggagatatggttat---tgatgagaaagcagatattgaaacaag 377
              |||  ||| ||||| || ||||||||  |   ||| |||||||||  | ||||  ||| 
Sbjct: 15423 agctgaaatggaagagggtgatatggtggtcgatgaggagaaagcatgtcttgaggcaaa 15482

                                                               
Query: 378   aactgctcaagctgttgaagaattgaaatcagctttgtcaagccagtatg 427
              |||||||| |||||||||||||||||||| |||||||||| ||||||||
Sbjct: 15483 gactgctcatgctgttgaagaattgaaatctgctttgtcaatccagtatg 15532



 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 97    cctcgcagccgtcgagctccgccgccg 123
             |||||| ||||||||||||||||||||
Sbjct: 14508 cctcgcggccgtcgagctccgccgccg 14534
to top
>emb|CT830852.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCFA001O01, full
           insert sequence
          Length = 757

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 97  cctcgcagccgtcgagctccgccgccg 123
           |||||| ||||||||||||||||||||
Sbjct: 36  cctcgcggccgtcgagctccgccgccg 62
to top
>gb|DQ508375.1| Synthetic construct codon-optimized L1 protein gene, complete cds
          Length = 1512

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 323 ctacaattgaagatggagatatggtt 348
           |||||||||||||||| |||||||||
Sbjct: 587 ctacaattgaagatggtgatatggtt 612
to top
>gb|AC163238.3| Colobus guereza clone CH272-90I19, complete sequence
          Length = 201245

 Score = 44.1 bits (22), Expect = 0.64
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 545    aatatttgcctatttggttgtg 566
              ||||||||||||||||||||||
Sbjct: 169341 aatatttgcctatttggttgtg 169320
to top
>ref|XM_420315.2| PREDICTED: Gallus gallus similar to Alport syndrome, mental
           retardation, midface hypoplasia and elliptocytosis
           chromosomal region, gene 1, transcript variant 2
           (LOC422343), mRNA
          Length = 840

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 139 ggcaacgcccccggctcgccg 159
           |||||||||||||||||||||
Sbjct: 140 ggcaacgcccccggctcgccg 120
to top
>ref|XM_001234034.1| PREDICTED: Gallus gallus similar to Alport syndrome, mental
           retardation, midface hypoplasia and elliptocytosis
           chromosomal region, gene 1, transcript variant 1
           (LOC422343), mRNA
          Length = 990

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 139 ggcaacgcccccggctcgccg 159
           |||||||||||||||||||||
Sbjct: 179 ggcaacgcccccggctcgccg 159
to top
>ref|XM_513285.2| PREDICTED: Pan troglodytes similar to zinc finger and BTB domain
            containing 8 opposite strand, transcript variant 5
            (LOC456718), mRNA
          Length = 1508

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 579  gtggggagaagaattttcatt 599
            |||||||||||||||||||||
Sbjct: 991  gtggggagaagaattttcatt 1011
to top
>ref|XM_001163251.1| PREDICTED: Pan troglodytes similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 1
           (LOC456718), mRNA
          Length = 1965

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 596 gtggggagaagaattttcatt 616
to top
>ref|XM_001163534.1| PREDICTED: Pan troglodytes similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 3
           (LOC456718), mRNA
          Length = 1986

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 617 gtggggagaagaattttcatt 637
to top
>ref|XM_001163312.1| PREDICTED: Pan troglodytes similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 2
           (LOC456718), mRNA
          Length = 2018

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 649 gtggggagaagaattttcatt 669
to top
>ref|XM_001163575.1| PREDICTED: Pan troglodytes similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 4
           (LOC456718), mRNA
          Length = 2039

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 670 gtggggagaagaattttcatt 690
to top
>ref|XM_001103742.1| PREDICTED: Macaca mulatta similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 3
           (LOC708590), mRNA
          Length = 1940

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 791 gtggggagaagaattttcatt 811
to top
>ref|XM_001103658.1| PREDICTED: Macaca mulatta similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 2
           (LOC708590), mRNA
          Length = 1566

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 417 gtggggagaagaattttcatt 437
to top
>emb|BX663521.11| Zebrafish DNA sequence from clone DKEYP-50F5 in linkage group 14,
             complete sequence
          Length = 179633

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 528   atcacaattcatcttgtaata 548
             |||||||||||||||||||||
Sbjct: 80270 atcacaattcatcttgtaata 80250
to top
>gb|AE002152.1| Ureaplasma parvum serovar 3 str. ATCC 700970 section 53 of 59 of the
            complete genome
          Length = 11966

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 327  aattgaagatggagatatggt 347
            |||||||||||||||||||||
Sbjct: 3943 aattgaagatggagatatggt 3923
to top
>ref|XM_859438.1| PREDICTED: Canis familiaris similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 5
           (LOC478150), mRNA
          Length = 511

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 377 gtggggagaagaattttcatt 397
to top
>ref|XM_535326.2| PREDICTED: Canis familiaris similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 1
           (LOC478150), mRNA
          Length = 780

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 430 gtggggagaagaattttcatt 450
to top
>ref|XM_859402.1| PREDICTED: Canis familiaris similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 4
           (LOC478150), mRNA
          Length = 783

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 433 gtggggagaagaattttcatt 453
to top
>ref|XM_859386.1| PREDICTED: Canis familiaris similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 3
           (LOC478150), mRNA
          Length = 531

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 397 gtggggagaagaattttcatt 417
to top
>ref|XM_859370.1| PREDICTED: Canis familiaris similar to zinc finger and BTB domain
           containing 8 opposite strand, transcript variant 2
           (LOC478150), mRNA
          Length = 760

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 410 gtggggagaagaattttcatt 430
to top
>gb|AY099494.1| Homo sapiens archease-like protein mRNA, partial cds
          Length = 623

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 342 gtggggagaagaattttcatt 362
to top
>emb|AL160412.14| Human DNA sequence from clone RP5-827E24 on chromosome 20 Contains
             ESTs, STSs and GSSs, complete sequence
          Length = 111824

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 270   cttaatgcgtgcaaagcgtgtgtgc 294
             ||||||||||||||||||| |||||
Sbjct: 40584 cttaatgcgtgcaaagcgtctgtgc 40608
to top
>emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I13 on chromosome Xq23-25 Contains
              an alpha tubulin pseudogene, complete sequence
          Length = 122400

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 469    acccactgccactaactagtt 489
              |||||||||||||||||||||
Sbjct: 101269 acccactgccactaactagtt 101249
to top
>emb|AL033529.25|HS27O5 Human DNA sequence from clone RP1-27O5 on chromosome 1p34.1-35.3 Contains
              the 3' end of the ZBTB8 gene for zinc finger and BTB domain
              containing 8, the 3' end of the gene for archease (ARCH)
              and two CpG islands, complete sequence
          Length = 147167

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 579    gtggggagaagaattttcatt 599
              |||||||||||||||||||||
Sbjct: 138685 gtggggagaagaattttcatt 138665
to top
>emb|CR932804.1| Mus musculus chromosome 2, clone ResGen-475I1 strain 129/Sv, complete
             sequence
          Length = 127135

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 549   tttgcctatttggttgtggtgtgtg 573
             ||||||||||||||| |||||||||
Sbjct: 48561 tttgcctatttggttttggtgtgtg 48585
to top
>gb|BC058843.1| Homo sapiens zinc finger and BTB domain containing 8 opposite
           strand, mRNA (cDNA clone MGC:62007 IMAGE:6745279),
           complete cds
          Length = 600

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 359 gtggggagaagaattttcatt 379
to top
>ref|NM_178547.2| Homo sapiens zinc finger and BTB domain containing 8 opposite
           strand (ZBTB8OS), mRNA
 gb|AY151084.1| Homo sapiens archease (ARCH) mRNA, complete cds; alternatively
           spliced
          Length = 717

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 579 gtggggagaagaattttcatt 599
           |||||||||||||||||||||
Sbjct: 436 gtggggagaagaattttcatt 456
to top
>emb|AL929034.17| Mouse DNA sequence from clone RP23-90F9 on chromosome 2, complete
             sequence
          Length = 161905

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 549   tttgcctatttggttgtggtgtgtg 573
             ||||||||||||||| |||||||||
Sbjct: 93937 tttgcctatttggttttggtgtgtg 93961


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 123,884,973
Number of extensions: 8013383
Number of successful extensions: 284368
Number of sequences better than 10.0: 35
Number of HSP's gapped: 284368
Number of HSP's successfully gapped: 50
Length of query: 679
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 657
Effective length of database: 18,508,616,841
Effective search space: 12160161264537
Effective search space used: 12160161264537
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top