>gb|AC129333.4| Mus musculus BAC clone RP23-104F23 from 6, complete sequence
          Length = 216849
 Score = 52.0 bits (26), Expect = 0.003
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                       
Query: 678   ctactccccccttctcctcttcctcc 703
             ||||||||||||||||||||||||||
Sbjct: 99255 ctactccccccttctcctcttcctcc 99280

>gb|AC107671.7| Mus musculus chromosome 7, clone RP23-112C18, complete sequence
          Length = 202894

 Score = 48.1 bits (24), Expect = 0.050
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 676   ccctactccccccttctcctcttcctcc 703
             |||||||||||||||||||||| |||||
Sbjct: 66566 ccctactccccccttctcctctccctcc 66539

>gb|AC124397.5| Mus musculus BAC clone RP24-348J16 from chromosome 13, complete
             sequence
          Length = 191713

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 673   tctccctactccccccttctcctcttcctcc 703
             ||||||| |||||||||||||||| ||||||
Sbjct: 40191 tctccctcctccccccttctcctcctcctcc 40221

>gb|AF247728.1|AF247728 Oncorhynchus mykiss glucose transporter 1A mRNA, complete cds
          Length = 2766

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 110  gcttgtccagcagagccagagcg 132
            |||||||||||||||||||||||
Sbjct: 1412 gcttgtccagcagagccagagcg 1390

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 546     cacctcatcgccgagctcaccga 568
               |||||||||||||||||||||||
Sbjct: 1086086 cacctcatcgccgagctcaccga 1086064

>ref|XM_001217449.1| Aspergillus terreus NIH2624 DNA-repair protein rad2 (ATEG_08864)
            mRNA, complete cds
          Length = 1209

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 269  gaagaagcgcaagaaggaggacgcca 294
            ||||||||||||||||||||| ||||
Sbjct: 1140 gaagaagcgcaagaaggaggaggcca 1165

>gb|AC102606.12| Mus musculus chromosome 7, clone RP23-390N24, complete sequence
          Length = 188836

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 675   tccctactccccccttctcctc 696
             ||||||||||||||||||||||
Sbjct: 40287 tccctactccccccttctcctc 40308

>gb|DQ396686.1| Rhodeus sericeus haplotype 14 cytochrome b gene, partial cds;
           mitochondrial
          Length = 1113

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 779 ctgccacgatgtaaattatggttga 803
           ||||| |||||||||||||||||||
Sbjct: 186 ctgccgcgatgtaaattatggttga 210

>gb|DQ396685.1| Rhodeus sericeus haplotype 6 cytochrome b gene, partial cds;
           mitochondrial
          Length = 1113

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 779 ctgccacgatgtaaattatggttga 803
           ||||| |||||||||||||||||||
Sbjct: 186 ctgccgcgatgtaaattatggttga 210

>gb|DQ396684.1| Rhodeus sericeus haplotype 3 cytochrome b gene, partial cds;
           mitochondrial
          Length = 1113

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 779 ctgccacgatgtaaattatggttga 803
           ||||| |||||||||||||||||||
Sbjct: 186 ctgccgcgatgtaaattatggttga 210

>gb|DQ396683.1| Rhodeus sericeus haplotype 1 cytochrome b gene, partial cds;
           mitochondrial
          Length = 1113

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 779 ctgccacgatgtaaattatggttga 803
           ||||| |||||||||||||||||||
Sbjct: 186 ctgccgcgatgtaaattatggttga 210

>gb|AC175741.5| Mus musculus chromosome 1, clone wi1-1093I15, complete sequence
          Length = 39340

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 676   ccctactccccccttctcctcttcc 700
             |||||||||||||||||||| ||||
Sbjct: 33224 ccctactccccccttctccttttcc 33200

>gb|AC166746.7| Mus musculus chromosome 19, clone RP24-248H10, complete sequence
          Length = 156084

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 676    ccctactccccccttctcctcttcc 700
              |||||||||||||||||||| ||||
Sbjct: 104295 ccctactccccccttctccttttcc 104271

>gb|AC133156.7| Mus musculus chromosome 15, clone RP24-291M22, complete sequence
          Length = 151577

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 684    cccccttctcctcttcctccc 704
              |||||||||||||||||||||
Sbjct: 104457 cccccttctcctcttcctccc 104477

>ref|XM_503335.1| Yarrowia lipolytica CLIB122, YALI0D26840g predicted mRNA
          Length = 1398

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 682 tccccccttctcctcttcctc 702
           |||||||||||||||||||||
Sbjct: 936 tccccccttctcctcttcctc 916

>gb|AC152394.11| Mus musculus chromosome 15, clone RP23-100K19, complete sequence
          Length = 203260

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 684    cccccttctcctcttcctccc 704
              |||||||||||||||||||||
Sbjct: 152641 cccccttctcctcttcctccc 152661

>gb|AC102000.14| Mus musculus chromosome 15, clone RP24-467P24, complete sequence
          Length = 171400

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 684  cccccttctcctcttcctccc 704
            |||||||||||||||||||||
Sbjct: 7565 cccccttctcctcttcctccc 7585

>gb|AC123954.4| Mus musculus BAC clone RP23-249L6 from 13, complete sequence
          Length = 200727

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 676    ccctactccccccttctcctc 696
              |||||||||||||||||||||
Sbjct: 134901 ccctactccccccttctcctc 134921

>gb|AY236772.1| Pelobates fuscus MVZ233601 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 385

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 779 ctgccacgatgtaaattatggttga 803
           ||||| |||||||||||||||||||
Sbjct: 190 ctgccgcgatgtaaattatggttga 214

>gb|AY236771.1| Pelobates fuscus MVZ233602 cytochrome b gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 385

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 779 ctgccacgatgtaaattatggttga 803
           ||||| |||||||||||||||||||
Sbjct: 190 ctgccgcgatgtaaattatggttga 214

>dbj|AK048379.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched
            library, clone:C130054F14 product:unclassifiable, full
            insert sequence
          Length = 2275

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 676  ccctactccccccttctcctc 696
            |||||||||||||||||||||
Sbjct: 1035 ccctactccccccttctcctc 1055

>gb|AC157021.6| Mus musculus 10 BAC RP24-328K10 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 175825

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 676    ccctactccccccttctcctc 696
              |||||||||||||||||||||
Sbjct: 148197 ccctactccccccttctcctc 148177

>gb|AC152977.1| Mus musculus 10 BAC RP23-251I19 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 192515

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                           
Query: 676    ccctactccccccttctcctcttcctccc 704
              |||||||||||||||||||| ||||||||
Sbjct: 151564 ccctactccccccttctcct-ttcctccc 151591

>gb|AC159473.7| Mus musculus 10 BAC RP23-215E23 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 190387

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                          
Query: 676   ccctactccccccttctcctcttcctccc 704
             |||||||||||||||||||| ||||||||
Sbjct: 21028 ccctactccccccttctcct-ttcctccc 21055

>gb|AF333038.2| Streptomyces viridochromogenes Avilamycin A biosynthetic gene cluster,
             complete sequence
          Length = 59816

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 590   ccaccaccagcagctcgccgg 610
             |||||||||||||||||||||
Sbjct: 41490 ccaccaccagcagctcgccgg 41470

>gb|AC154209.2| Mus musculus BAC clone RP24-378F12 from 12, complete sequence
          Length = 155916

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 676   ccctactccccccttctcctc 696
             |||||||||||||||||||||
Sbjct: 51971 ccctactccccccttctcctc 51991

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 682     tccccccttctcctcttcctc 702
               |||||||||||||||||||||
Sbjct: 3573531 tccccccttctcctcttcctc 3573551


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 112,337,535
Number of extensions: 6100787
Number of successful extensions: 158165
Number of sequences better than 10.0: 27
Number of HSP's gapped: 158165
Number of HSP's successfully gapped: 27
Length of query: 826
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 804
Effective length of database: 18,508,616,841
Effective search space: 14880927940164
Effective search space used: 14880927940164
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)