ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf47o09 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z17327.1|HVBARE1 H.vulgare DNA for BARE-1 copia-like retroelement Length = 13271 Score = 418 bits (211), Expect = e-113 Identities = 301/328 (91%), Gaps = 6/328 (1%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||| ||||||||| ||||| ||||||| |||||||||||||||||||| Sbjct: 10307 cagttgcaggtacatgtaaaggttatttgacacgagcgcattgattgttcatttggagtt 10366 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||| Sbjct: 10367 gcttcttcttcttcttcttcatcgatctaggatgggttccaggccggcagcctgggatag 10426 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||| Sbjct: 10427 caaggatggacgtcgttcttcttttgtcgtttgttttcgtccgtagtcggaccctgctct 10486 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||||||||||| |||| |||| |||||||||||||||||||||||||||||| Sbjct: 10487 tactcttgatgtttatgtaatgtattgatgtgactctgatgtagcttgtggcgagtgtaa 10546 Query: 626 gcaaattc----tttatatctcaccttttcagtacatgtacttgtaacgatatccattct 681 || ||||| | ||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 10547 gccaattcaatatatatatctcatcttttcagtacatgtacttgtaacgatatccattct 10606 Query: 682 tgtgaaacgacgagatacgcttctatcc 709 || || |||||||||| ||||||||||| Sbjct: 10607 tgcgacacgacgagatgcgcttctatcc 10634
>dbj|AB014756.1| Hordeum vulgare insertion sequence in a copia-like retroelement BARE-1, gypsy-type retrotransposon BARE-100 DNA, solo-LTR sequence Length = 3130 Score = 418 bits (211), Expect = e-113 Identities = 301/328 (91%), Gaps = 6/328 (1%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||| ||||||||| ||||| ||||||| |||||||||||||||||||| Sbjct: 2750 cagttgcaggtacatgtaaaggttatttgacacgagcgcattgattgttcatttggagtt 2809 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||| Sbjct: 2810 gcttcttcttcttcttcttcatcgatctaggatgggttccaggccggcagcctgggatag 2869 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||| Sbjct: 2870 caaggatggacgtcgttcttcttttgtcgtttgttttcgtccgtagtcggaccctgctct 2929 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||||||||||| |||| |||| |||||||||||||||||||||||||||||| Sbjct: 2930 tactcttgatgtttatgtaatgtattgatgtgactctgatgtagcttgtggcgagtgtaa 2989 Query: 626 gcaaattc----tttatatctcaccttttcagtacatgtacttgtaacgatatccattct 681 || ||||| | ||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 2990 gccaattcaatatatatatctcatcttttcagtacatgtacttgtaacgatatccattct 3049 Query: 682 tgtgaaacgacgagatacgcttctatcc 709 || || |||||||||| ||||||||||| Sbjct: 3050 tgcgacacgacgagatgcgcttctatcc 3077
>gb|AF453665.1| Hordeum vulgare isolate HV Sukkula retrotransposon, partial sequence Length = 7674 Score = 416 bits (210), Expect = e-113 Identities = 299/327 (91%), Gaps = 10/327 (3%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| Sbjct: 3947 cagttgcaggtacaggtaaaggttacttgacgcgagcgcgttgattgttcttttggagtt 4006 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcctgg-atag 506 || |||||||||||||| |||||||||||||||||||||| |||||||||||||| |||| Sbjct: 4007 gcctcttcttcttcttcttcatcgatctaggatgggttccaggccggcagcctgggatag 4066 Query: 507 caaggatggacgtcgttctcttttctcgtttgttttcgtccgtagtcggaccatgctctt 566 ||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| Sbjct: 4067 caaggatggacgtcgtt-----ttctcgtttgttttcgtccgtagtcggaccctgctctt 4121 Query: 567 cttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaag 626 || ||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||| Sbjct: 4122 actcttgatgattatgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaag 4181 Query: 627 caaattctttatat----ctcaccttttcagtacatgtacttgtaacgatatccattctt 682 | |||||||||||| ||| ||||||||||||||||||||||||||||||||||||| Sbjct: 4182 ccaattctttatatatatctcttcttttcagtacatgtacttgtaacgatatccattctt 4241 Query: 683 gtgaaacgacgagatacgcttctatcc 709 | || |||||||||| ||||||||||| Sbjct: 4242 gcgacacgacgagatgcgcttctatcc 4268 Score = 127 bits (64), Expect = 6e-26 Identities = 85/92 (92%) Strand = Plus / Plus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 ||||||||||||||| |||| ||| ||||| ||| ||||||||||||||||||||||||| Sbjct: 2564 agttccgcaagcgtgccggattgtgaggactcgttcgactacgtcggttcgtctgcttca 2623 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| ||||||||||||||||||||| Sbjct: 2624 cggaggcattcttcttccaagcgggatctcag 2655
>gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complete sequence Length = 114996 Score = 410 bits (207), Expect = e-111 Identities = 290/314 (92%), Gaps = 4/314 (1%) Strand = Plus / Minus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| |||||| |||||||||||||||||||||| |||| Sbjct: 103025 cagttgcaggtacaggtaaaggttatttgacgtgagcgcgttgattgttcatttgaagtt 102966 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 |||||||||||||| ||||||||||||||||||||||||| |||||||||||| |||||| Sbjct: 102965 gcttcttcttcttcatcatcatcgatctaggatgggttccaggccggcagcctgggatag 102906 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||| Sbjct: 102905 caaggatggacgtcgttcttcttttgtcgtttgttttcgtccgtagtcggaccctgctct 102846 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||| ||||||| ||||||||| |||||||||||||||||||||||||||||| Sbjct: 102845 tactcttgatgattatgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaa 102786 Query: 626 gcaaattctt--tatatctcaccttttcagtacatgtacttgtaacgatatccattcttg 683 || || |||| ||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 102785 gccaactcttgatatatctcatcttttcagtacatgtacttgtaacgatatccattcttg 102726 Query: 684 tgaaacgacgagat 697 || || ||||||| Sbjct: 102725 cgacaccacgagat 102712 Score = 103 bits (52), Expect = 9e-19 Identities = 83/92 (90%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 ||||||||| ||||| |||| ||| ||||||||| ||||||||||||||||||||||||| Sbjct: 104430 agttccgca-gcgtgccggattgtgaggacccgttcgactacgtcggttcgtctgcttca 104372 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 |||||| || |||||||| |||||||||||| Sbjct: 104371 cggagttgttcttcttccaggcgggatctcag 104340
>gb|AF474072.1| Hordeum vulgare sp. vulgare cultivar Morex BAC clone 773k14, complete sequence Length = 113510 Score = 410 bits (207), Expect = e-111 Identities = 299/326 (91%), Gaps = 4/326 (1%) Strand = Plus / Minus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 16623 cagttgcaggtacaggtaaaggttacttgacgcgagcgcgttgattgttcatttggagtt 16564 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||| Sbjct: 16563 gcttcttcttcttcttcttcatcgatctaggatgggttccaggccggcagcctgggatag 16504 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||||||||||| |||||| ||||||||||||||| ||||||||||| |||||| Sbjct: 16503 caaggatggacgtcgttcttcttttgtcgtttgttttcgtctgtagtcggaccctgctct 16444 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || | ||||||||||| |||||||| |||||||||||||||| |||||||||||| Sbjct: 16443 tactcttcatgtttatgtaatgtactgaagcgactctgatgtagcttttggcgagtgtaa 16384 Query: 626 gcaaattctt--tatatctcaccttttcagtacatgtacttgtaacgatatccattcttg 683 || || |||| |||||||| ||||||||||||||||||| |||||||||||||||||| Sbjct: 16383 gccaactctttatatatctcctcttttcagtacatgtacttataacgatatccattcttg 16324 Query: 684 tgaaacgacgagatacgcttctatcc 709 || |||||||||| ||||||||||| Sbjct: 16323 cgacacgacgagatgcgcttctatcc 16298 Score = 101 bits (51), Expect = 4e-18 Identities = 75/83 (90%) Strand = Plus / Minus Query: 308 agcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttcacggagtcat 367 |||||| |||| ||| ||||||||| |||||||||||||||||| |||||||| || ||| Sbjct: 18000 agcgtgccggattgtgaggacccgttcgactacgtcggttcgtcagcttcacgcaggcat 17941 Query: 368 ttttcttccaagcgggatctcag 390 | ||||||||||||||||||||| Sbjct: 17940 tcttcttccaagcgggatctcag 17918
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 410 bits (207), Expect = e-111 Identities = 299/326 (91%), Gaps = 4/326 (1%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||| | | ||| ||| ||||||||||||||||||||||||||| Sbjct: 10826 cagttgcaggtacaggtaaatggtacttcacgtgagcgcgttgattgttcatttggagtt 10885 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||||||||||| |||||||||||||||||||||| |||||||| ||| |||||| Sbjct: 10886 gcttcttcttcttcttcttcatcgatctaggatgggttccaggccggcaccctcggatag 10945 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||||||||||| |||||| ||||||||||||||||||||||||||| |||||| Sbjct: 10946 caaggatggacgtcgttcttcttttgtcgtttgttttcgtccgtagtcggaccctgctct 11005 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||| ||||||| ||||||||| |||||||||||||||||||||||||||||| Sbjct: 11006 tactcttgatgattatgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaa 11065 Query: 626 gcaaattctt--tatatctcaccttttcagtacatgtacttgtaacgatatccattcttg 683 || || |||| |||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 11066 gccaactctttatatatctcttcttttcagtacatgtacttgtaacgatatccattcttg 11125 Query: 684 tgaaacgacgagatacgcttctatcc 709 || |||||||||| ||||||||||| Sbjct: 11126 cgacacgacgagatgcgcttctatcc 11151 Score = 119 bits (60), Expect = 2e-23 Identities = 85/92 (92%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 ||||| |||||||||||||| ||| ||||||||| ||||||||||||||||||||||||| Sbjct: 9448 agttctgcaagcgtgtcgga-tgtgaggacccgttcgactacgtcggttcgtctgcttca 9506 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| |||||||||||||||||||| Sbjct: 9507 cggaggcattcctcttccaagcgggatctcag 9538
>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence Length = 439641 Score = 402 bits (203), Expect = e-109 Identities = 298/326 (91%), Gaps = 4/326 (1%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||||||| Sbjct: 326913 cagttgcaggtacaggtaaaggttacttgatgcgagcgtgttgattgttcatttggagtt 326972 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||| |||||||||||||||||||||||||||||| |||||||||||| |||||| Sbjct: 326973 gcttcttctccttcttcatcatcgatctaggatgggttccaggccggcagcctgggatag 327032 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| Sbjct: 327033 caaggatggacgtcgttcttcttttctcgtttgttttcgtccgtagtcggaccctgctct 327092 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||| ||||||| ||||||||| |||||||||||||||||||||||||||||| Sbjct: 327093 tactcttgatgattatgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaa 327152 Query: 626 gcaaattc--tttatatctcaccttttcagtacatgtacttgtaacgatatccattcttg 683 || || || | ||||||| || |||||||||||||||||| |||||||||||||||| Sbjct: 327153 gccaactctatatatatctgttctgttcagtacatgtacttgtgacgatatccattcttg 327212 Query: 684 tgaaacgacgagatacgcttctatcc 709 || |||| ||||| ||||||||||| Sbjct: 327213 cgacacgatgagatgcgcttctatcc 327238 Score = 355 bits (179), Expect = 2e-94 Identities = 293/326 (89%), Gaps = 10/326 (3%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||||| Sbjct: 131316 cagttgcaggtacatgtaaaggtcacttgacgtgagcgcgttgattgttcatttggagtt 131375 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 |||||||||||| || |||||||||||||||||||||| || ||||||||| |||||| Sbjct: 131376 gcttcttcttctcct---tcatcgatctaggatgggttccagggcggcagcctgggatag 131432 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||| Sbjct: 131433 caaggatggacgtcgttcttcttttctcgtttgttttcttccgtagtcggaccctgctct 131492 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||| ||||| ||||||||| |||||||||||||||||||||||||||||| Sbjct: 131493 tactcttgatg---atgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaa 131549 Query: 626 gcaaattc--tttatatctcaccttttcagtacatgtacttgtaacgatatccattcttg 683 || || || | |||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 131550 gccaactctatatatatctcttcttttcagtacatgtacttgtaacgatatccattcttg 131609 Query: 684 tgaaacgacgagatacgcttctatcc 709 || |||||||||| ||| ||||||| Sbjct: 131610 cgacacgacgagatgcgcatctatcc 131635 Score = 121 bits (61), Expect = 4e-24 Identities = 83/89 (93%), Gaps = 1/89 (1%) Strand = Plus / Plus Query: 302 tccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttcacgg 361 ||||||||||||||||| ||| ||||||||| ||||||||||||||||| |||||||||| Sbjct: 129957 tccgcaagcgtgtcgga-tgtgaggacccgttcgactacgtcggttcgtgtgcttcacgg 130015 Query: 362 agtcatttttcttccaagcgggatctcag 390 || |||| ||||||||||||||||||||| Sbjct: 130016 agacattcttcttccaagcgggatctcag 130044 Score = 111 bits (56), Expect = 4e-21 Identities = 83/92 (90%) Strand = Plus / Plus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 |||| ||||||||||||||||||| ||||||||| ||||||||| ||||||||| ||||| Sbjct: 325508 agtttcgcaagcgtgtcggaatgtgaggacccgttcgactacgttggttcgtctacttca 325567 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 |||||| || |||||||||| |||||||||| Sbjct: 325568 cggagttgttcttcttccaagtgggatctcag 325599 Score = 105 bits (53), Expect = 2e-19 Identities = 81/89 (91%), Gaps = 1/89 (1%) Strand = Plus / Plus Query: 302 tccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttcacgg 361 ||||||||||||||||| ||| ||||||| | ||||||||||||||||| | |||||||| Sbjct: 177290 tccgcaagcgtgtcgga-tgtgaggacccattcgactacgtcggttcgtgttcttcacgg 177348 Query: 362 agtcatttttcttccaagcgggatctcag 390 || |||| ||||||||||||||||||||| Sbjct: 177349 agacattcttcttccaagcgggatctcag 177377
>gb|AY054376.1| Hordeum vulgare Sukkula retrotransposon long terminal repeat, partial and complete sequences Length = 11820 Score = 398 bits (201), Expect = e-107 Identities = 299/328 (91%), Gaps = 9/328 (2%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 11487 cagttgcaggtacaggtaaaggttacttgacgcgagcgcgttgattgttcatttggagtt 11546 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||||||||| |||||||||||||||||||||| |||||||||||| |||||| Sbjct: 11547 gcttcttcttcttct---tcatcgatctaggatgggttccaggccggcagcctgggatag 11603 Query: 507 caaggatggacgtcgttct--cttttctcgtttgttttcgtccgtagtcggaccatgctc 564 ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 11604 caaggatggacgtcgttcttatttttctcgtttgttttcgtccgtagtcggaccctgctc 11663 Query: 565 ttcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgta 624 || || ||||| ||||||| ||||||||| ||||||||||||| ||||||||||||||| Sbjct: 11664 ttactcttgatgattatgtaatgtactgatgtgactctgatgtaacttgtggcgagtgta 11723 Query: 625 agcaaa---ttctttatatctcaccttttcagtacatgtacttgtaacgatatccattct 681 ||| || |||| |||||||| |||||||||||||||||||||||| ||||||||||| Sbjct: 11724 agccaactcttctatatatctcttcttttcagtacatgtacttgtaacaatatccattct 11783 Query: 682 tgtgaaacgacgagatacgcttctatcc 709 || || | |||||||| ||||||||||| Sbjct: 11784 tgcgacaggacgagatgcgcttctatcc 11811 Score = 394 bits (199), Expect = e-106 Identities = 298/328 (90%), Gaps = 6/328 (1%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| Sbjct: 3947 cagttgcaggtacaggtaaaggttacttgacgcgagcgcgttgattgttcttttggagtt 4006 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 || |||||||||||||| |||||||||||||||||||||| |||||||||||| |||||| Sbjct: 4007 gcctcttcttcttcttcttcatcgatctaggatgggttccaggccggcagcctgggatag 4066 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||| ||||||| |||||| ||||||||||||||||||||||||||| |||||| Sbjct: 4067 caaggatggatgtcgttcttcttttgtcgtttgttttcgtccgtagtcggaccctgctct 4126 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||| | ||||| ||||||||| |||||||||||||||||||||||||||||| Sbjct: 4127 tactcttgatgatgatgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaa 4186 Query: 626 gcaaattc----tttatatctcaccttttcagtacatgtacttgtaacgatatccattct 681 || || || | |||||||| |||||||||| ||||||||||||||||||||||||| Sbjct: 4187 gccaactctgtatatatatctcttcttttcagtagatgtacttgtaacgatatccattct 4246 Query: 682 tgtgaaacgacgagatacgcttctatcc 709 || || |||||||||| ||||||||||| Sbjct: 4247 tgcgacacgacgagatgcgcttctatcc 4274 Score = 127 bits (64), Expect = 6e-26 Identities = 85/92 (92%) Strand = Plus / Plus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 ||||||||||||||| |||| ||| ||||| ||| ||||||||||||||||||||||||| Sbjct: 2564 agttccgcaagcgtgccggattgtgaggactcgttcgactacgtcggttcgtctgcttca 2623 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| ||||||||||||||||||||| Sbjct: 2624 cggaggcattcttcttccaagcgggatctcag 2655 Score = 61.9 bits (31), Expect = 3e-06 Identities = 77/91 (84%), Gaps = 1/91 (1%) Strand = Plus / Plus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 ||||||||||||||||||||| || ||||||||| |||||||| |||| | | || || Sbjct: 10096 agttccgcaagcgtgtcggaa-gtgaggacccgttcgactacgatggtttgccgactcca 10154 Query: 359 cggagtcatttttcttccaagcgggatctca 389 | |||| || |||||||||||||||||||| Sbjct: 10155 ccgagttgttcttcttccaagcgggatctca 10185
>gb|AY054377.1| Hordeum vulgare clone LTR-INS1 Sukkula retrotransposon long terminal repeat, complete sequence Length = 7575 Score = 394 bits (199), Expect = e-106 Identities = 298/328 (90%), Gaps = 6/328 (1%) Strand = Plus / Plus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| Sbjct: 3947 cagttgcaggtacaggtaaaggttacttgacgcgagcgcgttgattgttcttttggagtt 4006 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 || |||||||||||||| |||||||||||||||||||||| |||||||||||| |||||| Sbjct: 4007 gcctcttcttcttcttcttcatcgatctaggatgggttccaggccggcagcctgggatag 4066 Query: 507 caaggatggacgtcgttc-tcttttctcgtttgttttcgtccgtagtcggaccatgctct 565 |||||||||| ||||||| |||||| ||||||||||||||||||||||||||| |||||| Sbjct: 4067 caaggatggatgtcgttcttcttttgtcgtttgttttcgtccgtagtcggaccctgctct 4126 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||| | ||||| ||||||||| |||||||||||||||||||||||||||||| Sbjct: 4127 tactcttgatgatgatgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaa 4186 Query: 626 gcaaattc----tttatatctcaccttttcagtacatgtacttgtaacgatatccattct 681 || || || | |||||||| |||||||||| ||||||||||||||||||||||||| Sbjct: 4187 gccaactctgtatatatatctcttcttttcagtagatgtacttgtaacgatatccattct 4246 Query: 682 tgtgaaacgacgagatacgcttctatcc 709 || || |||||||||| ||||||||||| Sbjct: 4247 tgcgacacgacgagatgcgcttctatcc 4274 Score = 127 bits (64), Expect = 6e-26 Identities = 85/92 (92%) Strand = Plus / Plus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 ||||||||||||||| |||| ||| ||||| ||| ||||||||||||||||||||||||| Sbjct: 2564 agttccgcaagcgtgccggattgtgaggactcgttcgactacgtcggttcgtctgcttca 2623 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| ||||||||||||||||||||| Sbjct: 2624 cggaggcattcttcttccaagcgggatctcag 2655
>emb|Y14573.1|HVCH4H Hordeum vulgare DNA for chromosome 4H Length = 59748 Score = 385 bits (194), Expect = e-103 Identities = 295/327 (90%), Gaps = 5/327 (1%) Strand = Plus / Minus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||| Sbjct: 37532 cagttgcaggtacaggtaaaggttacttgacgcgagcgcgctgattgttcattttgagtt 37473 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||| ||| ||| |||||||||||||||||||||| |||||||||||| |||||| Sbjct: 37472 gcttcttctcctttttcttcatcgatctaggatgggttccaggccggcagcctgggatag 37413 Query: 507 caaggatggacgtcgttctcttttctcgtttgttttcgtccgtagtcggaccatgctctt 566 ||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| Sbjct: 37412 caaggatggacgtcgtttcattttctcgtttgttttcgtccgtagtcggaccccgctctt 37353 Query: 567 cttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaag 626 || ||||| ||||||| ||||||||| ||||||||||||||||||||| ||||||||| Sbjct: 37352 actcttgatgattatgtaatgtactgatgtgactctgatgtagcttgtggtgagtgtaag 37293 Query: 627 caaattc----tttatatctcaccttttcagtacatgtacttgtaacgatatccattctt 682 | || || | |||||||| ||||||||||||||||||||||||||||||||||||| Sbjct: 37292 ccaactctgtatatatatctcttcttttcagtacatgtacttgtaacgatatccattctt 37233 Query: 683 gtgaaacgacgagatacgcttctatcc 709 | || |||||||||| ||||||||||| Sbjct: 37232 gcgacacgacgagatgcgcttctatcc 37206 Score = 135 bits (68), Expect = 3e-28 Identities = 86/92 (93%) Strand = Plus / Minus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 |||||||||||||||||||| ||| ||||||||| |||||||||| |||||||||||||| Sbjct: 38927 agttccgcaagcgtgtcggattgtgaggacccgttcgactacgtcagttcgtctgcttca 38868 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| ||||||||||||||||||||| Sbjct: 38867 cggaggcattcttcttccaagcgggatctcag 38836
>gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, complete sequence Length = 124050 Score = 381 bits (192), Expect = e-102 Identities = 298/329 (90%), Gaps = 7/329 (2%) Strand = Plus / Minus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||| ||| || ||||| ||||||| ||||||||||||||||||||| Sbjct: 65096 cagttgcaggtacaggctaagattacttgatgcgagcgtgttgattgttcatttggagtt 65037 Query: 448 gcttcttcttcttcttcatc---atcgatctaggatgggttccgggccggcagcctgg-a 503 ||||||||||||||||| || |||||||||||||||||||| |||||||||||||| | Sbjct: 65036 gcttcttcttcttcttcttcttcatcgatctaggatgggttccaggccggcagcctggga 64977 Query: 504 tagcaaggatggacgtcgttct-cttttctcgtttgttttcgtccgtagtcggaccatgc 562 |||||||||||||||||||||| ||||| |||||||||||||||||||| |||||| ||| Sbjct: 64976 tagcaaggatggacgtcgttcttcttttgtcgtttgttttcgtccgtagacggaccctgc 64917 Query: 563 tcttcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtg 622 |||| || ||||| ||||||| ||||||||| ||||||||||||||||||||||||||| Sbjct: 64916 tcttactcttgatgattatgtaatgtactgatgtgactctgatgtagcttgtggcgagtg 64857 Query: 623 taagcaaattctt--tatatctcaccttttcagtacatgtacttgtaacgatatccattc 680 ||||| || |||| |||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 64856 taagccaactctttatatatctcttcttttcagtacatgtacttgtaacgatatccattc 64797 Query: 681 ttgtgaaacgacgagatacgcttctatcc 709 ||| || |||||||||| ||||||||||| Sbjct: 64796 ttgcgacacgacgagatgcgcttctatcc 64768 Score = 127 bits (64), Expect = 6e-26 Identities = 86/92 (93%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 |||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||| Sbjct: 66479 agttccgcaagcgtgtcgga-tgtgaggacccgttcgactacgtcggttcgtctgcttca 66421 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| ||||||||||| ||||||||| Sbjct: 66420 cggaggcattcttcttccaagcaggatctcag 66389
>gb|AY643843.1|AY643842S2 Hordeum vulgare subsp. vulgare clones BAC 519K7 and 799C8 hardness locus region Length = 129099 Score = 375 bits (189), Expect = e-100 Identities = 295/326 (90%), Gaps = 7/326 (2%) Strand = Plus / Minus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||| |||| |||| |||||||||||||| |||||||||||||||||||| Sbjct: 68394 cagttgcaggtacacgtaatggttacttgacgcgagcgctttgattgttcatttggagtt 68335 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcctgg-atag 506 |||||||||||||||||||| ||||||||||||||||| |||||||||||||| |||| Sbjct: 68334 gcttcttcttcttcttcatc---gatctaggatgggttccaggccggcagcctgggatag 68278 Query: 507 caaggatggacgtcgttct-cttttctcgtttgttttcgtccgtagtcggaccatgctct 565 ||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||| Sbjct: 68277 caaggatggacgtcgttcttcttttgtcgtttgttttcgtccgtagtcggaccctgctct 68218 Query: 566 tcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaa 625 | || ||||| ||||||| || ||| || ||||||||||||||| |||||||||||||| Sbjct: 68217 tactcttgatgattatgtaatgaacttatgtgactctgatgtagcctgtggcgagtgtaa 68158 Query: 626 gcaaattctt--tatatctcaccttttcagtacatgtacttgtaacgatatccattcttg 683 || || |||| ||||||||| |||||||||||||||||||| ||||||||||||||||| Sbjct: 68157 gccaactctttatatatctcatcttttcagtacatgtacttgcaacgatatccattcttg 68098 Query: 684 tgaaacgacgagatacgcttctatcc 709 || |||||||||| | ||||||||| Sbjct: 68097 cgacacgacgagatgcacttctatcc 68072 Score = 119 bits (60), Expect = 2e-23 Identities = 85/92 (92%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 ||||||||| ||||| |||| ||| ||||||||| ||||||||||||||||||||||||| Sbjct: 69778 agttccgca-gcgtgccggattgtgaggacccgttcgactacgtcggttcgtctgcttca 69720 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| ||||||||||||||||||||| Sbjct: 69719 cggaggcattcttcttccaagcgggatctcag 69688
>gb|AY643844.1|AY643842S3 Hordeum vulgare subsp. vulgare clones BAC 799C8 and 122A5 hardness locus region Length = 160897 Score = 355 bits (179), Expect = 2e-94 Identities = 296/329 (89%), Gaps = 7/329 (2%) Strand = Plus / Minus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||||||||||||||||||| | |||| ||||||||||||||||||| ||||||| Sbjct: 3563 cagttgcaggtacaggtaaaggttattcgacgtgagcgcgttgattgttcatctggagtt 3504 Query: 448 gcttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatag 506 ||||||||||||||||| || ||||||||||||||||||| |||||||||||| |||||| Sbjct: 3503 gcttcttcttcttcttcttcttcgatctaggatgggttccaggccggcagcctgggatag 3444 Query: 507 caaggatggacgtcgttc-tcttttctcgtttg-ttttcgtccgtagtcggaccatgctc 564 |||||||||||||||||| |||||| ||||||| ||||| ||| |||||||||| ||||| Sbjct: 3443 caaggatggacgtcgttcttcttttgtcgtttgtttttcatccatagtcggaccctgctc 3384 Query: 565 ttcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgta 624 || || ||||| ||||||| |||||||| ||||||||||||||||||||||||||||| Sbjct: 3383 ttactcttgatgattatgtaatgtactgaggtgactctgatgtagcttgtggcgagtgta 3324 Query: 625 agcaaa--ttctt--tatatctcaccttttcagtacatgtacttgtaacgatatccattc 680 ||| || |||| |||||||| |||||||||||||||||||||||| ||||||||||| Sbjct: 3323 agccaaccctctttatatatctctccttttcagtacatgtacttgtaatgatatccattc 3264 Query: 681 ttgtgaaacgacgagatacgcttctatcc 709 ||| || |||||||||| ||||||||||| Sbjct: 3263 ttgcgacacgacgagatgcgcttctatcc 3235 Score = 135 bits (68), Expect = 3e-28 Identities = 87/92 (94%), Gaps = 1/92 (1%) Strand = Plus / Minus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 |||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||| Sbjct: 4949 agttccgcaagcgtgtcgga-tgtgaggacccgttcgactacgtcggttcgtctgcttca 4891 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 ||||| |||| ||||||||||||||||||||| Sbjct: 4890 cggaggcattcttcttccaagcgggatctcag 4859
>gb|AF509774.1| Hordeum vulgare subsp. vulgare isolate RSB347 Rpg1 region, genomic sequence Length = 3124 Score = 278 bits (140), Expect = 3e-71 Identities = 256/289 (88%), Gaps = 8/289 (2%) Strand = Plus / Plus Query: 424 cgcgttgattgttcatttggagttgcttcttcttcttcttcatcatcgatctaggatggg 483 |||| ||||||||||||||||||| ||||||||| ||||| || ||||||||||||||| Sbjct: 2197 cgcgatgattgttcatttggagtttcttcttctt--tcttcttcgtcgatctaggatggg 2254 Query: 484 ttccgggccggcagcctgg-atagcaaggatggacgtcgttctcttttctcgtttgtttt 542 |||| || ||||||||||| ||||||||||||||||||||||| ||| ||||||||||| Sbjct: 2255 ttccaggtcggcagcctgggatagcaaggatggacgtcgttct--tttatcgtttgtttt 2312 Query: 543 cgtccgtagtcggaccatgctcttcttcatgatg--tttatgtattgtactgatttgact 600 ||| |||||||||||| |||||||||||||| | | |||||| |||| ||| ||||| Sbjct: 2313 cgttcgtagtcggaccctgctcttcttcatggcgattgtatgtaatgtatcgatgtgact 2372 Query: 601 ctgatgtagcttgtggcgagtgtaagcaaattctttatatctcaccttttcagtacatgt 660 ||||||||||||||||||| ||||||| ||||| |||| ||| || |||||||||||| Sbjct: 2373 ctgatgtagcttgtggcgattgtaagccaattccatata-ctcttctcttcagtacatgt 2431 Query: 661 acttgtaacgatatccattcttgtgaaacgacgagatacgcttctatcc 709 ||||||||||||||||||||||| ||||||||||||| ||||||||||| Sbjct: 2432 acttgtaacgatatccattcttgcgaaacgacgagatgcgcttctatcc 2480 Score = 105 bits (53), Expect = 2e-19 Identities = 89/101 (88%) Strand = Plus / Plus Query: 290 tgccgagaaagttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcg 349 |||||| | |||| ||||||||||||||||||| |||| |||| || |||||| |||||| Sbjct: 765 tgccgatagagtttcgcaagcgtgtcggaatgtgaggaaccgttcggctacgttggttcg 824 Query: 350 tctgcttcacggagtcatttttcttccaagcgggatctcag 390 ||||||||||||| || || ||||||||||| ||||||||| Sbjct: 825 tctgcttcacggattcgttcttcttccaagcaggatctcag 865
>gb|AY187024.1| Hordeum vulgare subsp. vulgare phosphate transporter HvPT4 gene, complete cds Length = 6561 Score = 252 bits (127), Expect = 2e-63 Identities = 239/269 (88%), Gaps = 8/269 (2%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcctgg-atagc 507 |||||||||||||||| ||||| |||||||||||||||| | |||||||||||| ||||| Sbjct: 2734 cttcttcttcttcttcttcatcaatctaggatgggttccagaccggcagcctgggatagc 2675 Query: 508 aaggatggacgtcgttct-cttttctcgtttgttttcgtccgtagtcggaccatgctctt 566 |||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||| Sbjct: 2674 aaggatggacgtcgttcttcttttctcggttgttttcgtccgtagtcggaccctgctctt 2615 Query: 567 cttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcgagtgtaag 626 | ||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||| Sbjct: 2614 acccttgatgattatgtaatgtactgatgtgactctgatgtagcttgtggcgagtgtaag 2555 Query: 627 -caaattc---tttatatctcaccttttcagta-catgtacttgtaa-cgatatccattc 680 | ||||| | |||||||| | |||||||| ||||||||||||| |||||||||||| Sbjct: 2554 cccaattctattatatatctcttcctttcagtaccatgtacttgtaaccgatatccattc 2495 Query: 681 ttgtgaaacgacgagatacgcttctatcc 709 || || |||||||||| ||||||||||| Sbjct: 2494 atgcgacacgacgagatgcgcttctatcc 2466 Score = 113 bits (57), Expect = 1e-21 Identities = 72/77 (93%) Strand = Plus / Minus Query: 388 cagttgcaggtacaggtaaaggttgcttgacgcgagcgcgttgattgttcatttggagtt 447 |||||||| ||||| ||||||||| |||||||||||||||| ||||||| |||||||||| Sbjct: 2822 cagttgcaagtacatgtaaaggttacttgacgcgagcgcgtggattgtttatttggagtt 2763 Query: 448 gcttcttcttcttcttc 464 ||||||||||||||||| Sbjct: 2762 gcttcttcttcttcttc 2746
>gb|DQ663707.1| Brachypodium distachyon Sukkula retrotransposon, partial sequence Length = 324 Score = 236 bits (119), Expect = 1e-58 Identities = 190/211 (90%), Gaps = 2/211 (0%) Strand = Plus / Plus Query: 501 ggatagcaaggatggacgtcgttct-cttttctcgtttgttttcgtccgtagtcggacca 559 |||||||||||||||||||| |||| ||||| |||||| |||||||||||||||||||| Sbjct: 9 ggatagcaaggatggacgtcattcttcttttgtcgtttattttcgtccgtagtcggaccc 68 Query: 560 tgctcttcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcga 619 ||||||| || ||||| |||||| ||||||||| |||||||||||||||||||||||| Sbjct: 69 tgctcttactcttgatgattatgtgatgtactgatgtgactctgatgtagcttgtggcga 128 Query: 620 gtgtaagcaaattctttatatctcacct-tttcagtacatgtacttgtaacgatatccat 678 |||||||| || ||||||||| || | | ||||||||||||||||||||||||||||||| Sbjct: 129 gtgtaagccaactctttatatatctcttctttcagtacatgtacttgtaacgatatccat 188 Query: 679 tcttgtgaaacgacgagatacgcttctatcc 709 ||||| || |||||||||| ||||||||||| Sbjct: 189 tcttgcgacacgacgagatgcgcttctatcc 219
>gb|DQ663708.1| Brachypodium distachyon Sukkula retrotransposon, partial sequence Length = 325 Score = 204 bits (103), Expect = 3e-49 Identities = 188/213 (88%), Gaps = 5/213 (2%) Strand = Plus / Plus Query: 501 ggatagcaaggatggacgtcgttct-cttttctcgtttgttttcgtccgtagtcggacca 559 ||||||||||||||||||||||||| |||||||| || |||||||||| |||||||||| Sbjct: 9 ggatagcaaggatggacgtcgttcttcttttctccttcgttttcgtccatagtcggaccc 68 Query: 560 tgctcttcttcatgatgtttatgtattgtactgatttgactctgatgtagcttgtggcga 619 ||||||| || ||||| |||| | |||||||| |||||||||||||||||||||||| Sbjct: 69 tgctcttactcttgatgaatatgcag-gtactgatgtgactctgatgtagcttgtggcga 127 Query: 620 gtgtaagcaaattcttt---atatctcaccttttcagtacatgtacttgtaacgatatcc 676 ||||||| |||||| | ||||||| ||||||||||||||||||||||||||||||| Sbjct: 128 gtgtaagtcaattctattatatatctcttcttttcagtacatgtacttgtaacgatatcc 187 Query: 677 attcttgtgaaacgacgagatacgcttctatcc 709 ||||||| || |||||||||| ||||||||||| Sbjct: 188 attcttgcgacacgacgagatgcgcttctatcc 220
>gb|AY054380.1| Hordeum patagonicum clone HpaLTR-INS Sukkula retrotransposon long terminal repeat, complete sequence Length = 7731 Score = 157 bits (79), Expect = 7e-35 Identities = 219/260 (84%), Gaps = 13/260 (5%) Strand = Plus / Plus Query: 453 ttcttcttcttcatcatcgatctaggatgggttccgggccggcagcctgg-atagcaagg 511 |||||||||||| || ||||| ||||||||||||| ||| |||||||||| ||||||||| Sbjct: 4122 ttcttcttcttcttcttcgatataggatgggttccaggc-ggcagcctgggatagcaagg 4180 Query: 512 atggacgtcgttctcttttctcgtttgttttcgtccgtagtcggaccatgctcttcttca 571 ||||| ||| || || ||||||||||||||||||||||||||| ||||||||| | Sbjct: 4181 atggatgtcatt-----ttatcgtttgttttcgtccgtagtcggaccctgctcttctgta 4235 Query: 572 tgatgttt----atgta-ttgtactgatttgactctgatgtagcttgtggcgagtgtaag 626 |||||||| |||| ||||| |||| || | || |||||||||||||||||||||| Sbjct: 4236 tgatgtttggatatgttgttgtattgatgtggttttgttgtagcttgtggcgagtgtaag 4295 Query: 627 caaattctttatatctcaccttttcagtacatgtacttgtaacgatatccattcttgtga 686 | ||||| |||| |||| || ||| ||||||||||||||| |||||||||||||| || Sbjct: 4296 ccaattccatata-ctcatctcttctttacatgtacttgtaatgatatccattcttgcga 4354 Query: 687 aacgacgagatacgcttcta 706 |||||||||| |||||||| Sbjct: 4355 cacgacgagatgcgcttcta 4374 Score = 58.0 bits (29), Expect = 5e-05 Identities = 50/57 (87%) Strand = Plus / Plus Query: 334 cgactacgtcggttcgtctgcttcacggagtcatttttcttccaagcgggatctcag 390 |||||| || || |||||| ||||||||| || || ||||||||||||||||||||| Sbjct: 2731 cgactatgttggctcgtcttcttcacggattcgttcttcttccaagcgggatctcag 2787
>gb|AY054378.1| Hordeum vulgare clone HmaLTR-INS Sukkula retrotransposon long terminal repeat, complete sequence Length = 7919 Score = 157 bits (79), Expect = 7e-35 Identities = 223/265 (84%), Gaps = 12/265 (4%) Strand = Plus / Plus Query: 450 ttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatagca 508 ||||||||||||||| ||||| || |||||||| ||| ||| |||||||| |||||||| Sbjct: 4231 ttcttcttcttcttcttcatcaatttaggatggattctaggc-ggcagcctaggatagca 4289 Query: 509 aggatggacgtcgttctcttttctcgtttgttttcgtccgtagtcggaccatgctcttct 568 |||||||| ||| || | || ||||| ||||||||||||||||||| ||||||| | Sbjct: 4290 aggatggatgtcattttatt-----gtttgatttcgtccgtagtcggaccctgctcttat 4344 Query: 569 tcatgatgtt---tatgta-ttgtactgatttgactctgatgtagcttgtggcgagtgta 624 |||||||| ||||| ||||| |||| |||||||||||||||||||| |||||||| Sbjct: 4345 gtatgatgttgagtatgttgttgtattgatgtgactctgatgtagcttgtgacgagtgta 4404 Query: 625 agcaaattctttatatctcaccttttcagtacatgtacttgtaacgatatccattcttgt 684 ||| |||||| |||| |||| || ||| |||||||||||||||| |||||||||||||| Sbjct: 4405 agccaattctatata-ctcatctcttctgtacatgtacttgtaatgatatccattcttgc 4463 Query: 685 gaaacgacgagatacgcttctatcc 709 | | |||||||| ||||||||||| Sbjct: 4464 aacatgacgagatgcgcttctatcc 4488
>gb|AF453660.1| Hordeum euclaston isolate He1 Sukkula retrotransposon, partial sequence Length = 3764 Score = 135 bits (68), Expect = 3e-28 Identities = 153/180 (85%), Gaps = 6/180 (3%) Strand = Plus / Plus Query: 535 tttgttttcgtccgtagtcggaccatgctcttcttcatgatgtttatgtat-----tgta 589 |||||||||||||||||||||||| ||||||||| ||||||||| | ||| |||| Sbjct: 38 tttgttttcgtccgtagtcggaccctgctcttctgtatgatgtttgtatatgttgttgta 97 Query: 590 ctgatttgactctgatgtagcttgtggcgagtgtaagcaaattctttatatctcaccttt 649 |||| ||| |||||||||||||||||||||||||| ||||| |||| |||| || | Sbjct: 98 ttgatgtgatattgatgtagcttgtggcgagtgtaagccaattccatata-ctcatctct 156 Query: 650 tcagtacatgtacttgtaacgatatccattcttgtgaaacgacgagatacgcttctatcc 709 || ||||||||||||||| |||||||||||||| |||| |||||||| ||||||||||| Sbjct: 157 tctttacatgtacttgtaatgatatccattcttgcgaaatgacgagatgcgcttctatcc 216
>gb|AF453659.1| Hordeum euclaston isolate He3 Sukkula retrotransposon, partial sequence Length = 3774 Score = 135 bits (68), Expect = 3e-28 Identities = 153/180 (85%), Gaps = 6/180 (3%) Strand = Plus / Plus Query: 535 tttgttttcgtccgtagtcggaccatgctcttcttcatgatgtttatgtat-----tgta 589 |||||||||||||||||||||||| ||||||||| ||||||||| | ||| |||| Sbjct: 38 tttgttttcgtccgtagtcggaccctgctcttctgtatgatgtttgtatatgttgttgta 97 Query: 590 ctgatttgactctgatgtagcttgtggcgagtgtaagcaaattctttatatctcaccttt 649 |||| ||| |||||||||||||||||||||||||| ||||| |||| |||| || | Sbjct: 98 ttgatgtgatattgatgtagcttgtggcgagtgtaagccaattccatata-ctcatctct 156 Query: 650 tcagtacatgtacttgtaacgatatccattcttgtgaaacgacgagatacgcttctatcc 709 || ||||||||||||||| |||||||||||||| |||| |||||||| ||||||||||| Sbjct: 157 tctttacatgtacttgtaatgatatccattcttgcgaaatgacgagatgcgcttctatcc 216
>gb|AF453663.1| Hordeum patagonicum isolate HPA2 Sukkula retrotransposon, partial sequence Length = 3862 Score = 129 bits (65), Expect = 2e-26 Identities = 179/214 (83%), Gaps = 11/214 (5%) Strand = Plus / Plus Query: 501 ggatagcaaggatggacgtcgttctcttttctcgtttgttttcgtccgtagtcggaccat 560 |||||||||||||||| |||||| || ||||||||||||||| ||||||||||| | Sbjct: 9 ggatagcaaggatggatgtcgtt-----ttatcgtttgttttcgtctgtagtcggaccct 63 Query: 561 gctcttcttcatgatgttt--atgtattgt---actgatttgactctgatgtagcttgtg 615 |||||||| |||||| || |||| |||| | |||| ||| |||| ||||||||| Sbjct: 64 gctcttctgtatgatgattgaatgtgttgttgtattgatatgatcatgatttagcttgtg 123 Query: 616 gcgagtgtaagcaaattctttatatctcaccttttcagtacatgtacttgtaacgatatc 675 |||||||||||| ||||| |||| |||| || ||| ||||||||||||||| |||||| Sbjct: 124 gcgagtgtaagccaattccatata-ctcatctcttctttacatgtacttgtaatgatatc 182 Query: 676 cattcttgtgaaacgacgagatacgcttctatcc 709 |||||||| ||||||||||||| ||||||||||| Sbjct: 183 cattcttgcgaaacgacgagatgcgcttctatcc 216
>gb|AF453670.1| Hordeum roshevitzii isolate Hroshevitzii Sukkula retrotransposon, partial sequence Length = 3434 Score = 127 bits (64), Expect = 6e-26 Identities = 158/188 (84%), Gaps = 6/188 (3%) Strand = Plus / Plus Query: 527 ttttctcgtttgttttcgtccgtagtcggaccatgctcttcttcatgatgtttatgtat- 585 |||| ||||||||||||||||||||||||||| ||||||||| ||||||||| | | | Sbjct: 30 ttttatcgtttgttttcgtccgtagtcggaccctgctcttctgtatgatgtttgtatttg 89 Query: 586 ----tgtactgatttgactctgatgtagcttgtggcgagtgtaagcaaattctttatatc 641 |||| |||| ||| |||||||||||||||||||||||||| ||||| |||| | Sbjct: 90 ttgttgtattgatgtgatattgatgtagcttgtggcgagtgtaagccaattccatata-c 148 Query: 642 tcaccttttcagtacatgtacttgtaacgatatccattcttgtgaaacgacgagatacgc 701 ||| || ||| ||||||||||||||| |||||||||||||| | |||||||||| ||| Sbjct: 149 tcatctcttctttacatgtacttgtaatgatatccattcttgcaacacgacgagatgcgc 208 Query: 702 ttctatcc 709 |||||||| Sbjct: 209 ttctatcc 216
>gb|AF453662.1| Elymus repens isolate Ely3 Sukkula retrotransposon, partial sequence Length = 3622 Score = 125 bits (63), Expect = 3e-25 Identities = 159/188 (84%), Gaps = 6/188 (3%) Strand = Plus / Plus Query: 527 ttttctcgtttgttttcgtccgtagtcggaccatgctcttcttcatgatgttt----atg 582 |||| ||||||||||||||||||||||||||| ||||||||| ||||||||| ||| Sbjct: 30 ttttatcgtttgttttcgtccgtagtcggaccctgctcttctgtatgatgtttggagatg 89 Query: 583 t-attgtactgatttgactctgatgtagcttgtggcgagtgtaagcaaattctttatatc 641 | |||||| |||| ||| |||||||||||||||||||||||||| ||||| |||| | Sbjct: 90 ttattgtattgatgtgatattgatgtagcttgtggcgagtgtaagccaattccatata-c 148 Query: 642 tcaccttttcagtacatgtacttgtaacgatatccattcttgtgaaacgacgagatacgc 701 ||| || ||| ||| || |||||||| ||||||||||| || ||||| ||||||| ||| Sbjct: 149 tcatctcttctttacgtgcacttgtaatgatatccattcctgcgaaacaacgagatgcgc 208 Query: 702 ttctatcc 709 |||||||| Sbjct: 209 ttctatcc 216
>gb|AF453658.1| Elymus repens isolate Ely1 Sukkula retrotransposon, partial sequence Length = 3613 Score = 125 bits (63), Expect = 3e-25 Identities = 159/188 (84%), Gaps = 6/188 (3%) Strand = Plus / Plus Query: 527 ttttctcgtttgttttcgtccgtagtcggaccatgctcttcttcatgatgttt----atg 582 |||| ||||||||||||||||||||||||||| ||||||||| ||||||||| ||| Sbjct: 30 ttttatcgtttgttttcgtccgtagtcggaccctgctcttctgtatgatgtttggagatg 89 Query: 583 t-attgtactgatttgactctgatgtagcttgtggcgagtgtaagcaaattctttatatc 641 | |||||| |||| ||| |||||||||||||||||||||||||| ||||| |||| | Sbjct: 90 ttattgtattgatgtgatattgatgtagcttgtggcgagtgtaagccaattccatata-c 148 Query: 642 tcaccttttcagtacatgtacttgtaacgatatccattcttgtgaaacgacgagatacgc 701 ||| || ||| ||| || |||||||| ||||||||||| || ||||| ||||||| ||| Sbjct: 149 tcatctcttctttacgtgcacttgtaatgatatccattcctgcgaaacaacgagatgcgc 208 Query: 702 ttctatcc 709 |||||||| Sbjct: 209 ttctatcc 216
>gb|AF453667.1| Hordeum patagonicum isolate HPA1 Sukkula retrotransposon, partial sequence Length = 3698 Score = 119 bits (60), Expect = 2e-23 Identities = 157/188 (83%), Gaps = 6/188 (3%) Strand = Plus / Plus Query: 527 ttttctcgtttgttttcgtccgtagtcggaccatgctcttcttcatgatgtttatgtat- 585 |||| |||||||||||||||||||| |||||| ||||||||| |||||| || | ||| Sbjct: 30 ttttatcgtttgttttcgtccgtagccggaccctgctcttctgtatgatgattgtatata 89 Query: 586 ----tgtactgatttgactctgatgtagcttgtggcgagtgtaagcaaattctttatatc 641 |||| |||| ||| || ||||||||||||||||||||||| ||||| |||| | Sbjct: 90 ttgatgtattgatgtgatattgttgtagcttgtggcgagtgtaagccaattccatata-c 148 Query: 642 tcaccttttcagtacatgtacttgtaacgatatccattcttgtgaaacgacgagatacgc 701 ||| || ||| ||||||||||||||| |||||||||||||| || |||||||||| ||| Sbjct: 149 tcatctcttctttacatgtacttgtaatgatatccattcttgcgacacgacgagatgcgc 208 Query: 702 ttctatcc 709 |||||||| Sbjct: 209 ttctatcc 216
>gb|AY069967.1| Hordeum erectifolium clone hele412 retrotransposon sukkula, complete sequence Length = 3695 Score = 117 bits (59), Expect = 6e-23 Identities = 158/188 (84%), Gaps = 6/188 (3%) Strand = Plus / Plus Query: 527 ttttctcgtttgttttcgtccgtagtcggaccatgctcttcttcatgatgtt----tatg 582 |||| |||||||||||||||||||| ||||| ||||||||| |||||||| |||| Sbjct: 30 ttttatcgtttgttttcgtccgtagatggaccctgctcttctgtatgatgttcgaatatg 89 Query: 583 ta-ttgtactgatttgactctgatgtagcttgtggcgagtgtaagcaaattctttatatc 641 | ||||| |||| ||| |||||||||||||||||||||||||| ||||| |||| | Sbjct: 90 ttgttgtattgatgtgatgttgatgtagcttgtggcgagtgtaagccaattccatata-c 148 Query: 642 tcaccttttcagtacatgtacttgtaacgatatccattcttgtgaaacgacgagatacgc 701 ||| || ||| ||||||||||||||| |||||||||||||| || | |||||||| ||| Sbjct: 149 tcatctcttctttacatgtacttgtaatgatatccattcttgcgacatgacgagatgcgc 208 Query: 702 ttctatcc 709 |||||||| Sbjct: 209 ttctatcc 216
>gb|AY069966.1| Hordeum erectifolium clone hele410 retrotransposon sukkula, complete sequence Length = 3683 Score = 111 bits (56), Expect = 4e-21 Identities = 96/108 (88%), Gaps = 1/108 (0%) Strand = Plus / Plus Query: 602 tgatgtagcttgtggcgagtgtaagcaaattctttatatctcaccttttcagtacatgta 661 |||||||||||||||||||||||||| ||||| |||| |||| || ||| |||||||| Sbjct: 110 tgatgtagcttgtggcgagtgtaagccaattccatata-ctcatctcttctttacatgta 168 Query: 662 cttgtaacgatatccattcttgtgaaacgacgagatacgcttctatcc 709 ||||||| |||||||||||||| || |||||||||| ||||||||||| Sbjct: 169 cttgtaatgatatccattcttgcgacacgacgagatgcgcttctatcc 216 Score = 52.0 bits (26), Expect = 0.003 Identities = 29/30 (96%) Strand = Plus / Plus Query: 539 ttttcgtccgtagtcggaccatgctcttct 568 |||||||||||||||||||| ||||||||| Sbjct: 42 ttttcgtccgtagtcggaccctgctcttct 71
>gb|AF453666.1| Hordeum patagonicum isolate HPA5 Sukkula retrotransposon, partial sequence Length = 3804 Score = 105 bits (53), Expect = 2e-19 Identities = 93/105 (88%), Gaps = 1/105 (0%) Strand = Plus / Plus Query: 605 tgtagcttgtggcgagtgtaagcaaattctttatatctcaccttttcagtacatgtactt 664 ||||||||||||||||||||||| ||||| |||| |||| || ||| ||||||||||| Sbjct: 112 tgtagcttgtggcgagtgtaagccaattccatata-ctcatctcttctttacatgtactt 170 Query: 665 gtaacgatatccattcttgtgaaacgacgagatacgcttctatcc 709 |||| |||||||||||||| || |||||||||| ||||||||||| Sbjct: 171 gtaatgatatccattcttgcgacacgacgagatgcgcttctatcc 215 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Plus Query: 527 ttttctcgtttgttttcgtccgtagtcggaccatgctcttct 568 |||| |||||||||||||||||||| |||||| ||||||||| Sbjct: 30 ttttatcgtttgttttcgtccgtagccggaccctgctcttct 71
>gb|AF453664.1| Hordeum patagonicum isolate Hpa3 Sukkula retrotransposon, partial sequence Length = 3943 Score = 105 bits (53), Expect = 2e-19 Identities = 93/105 (88%), Gaps = 1/105 (0%) Strand = Plus / Plus Query: 605 tgtagcttgtggcgagtgtaagcaaattctttatatctcaccttttcagtacatgtactt 664 ||||||||||||||||||||||| ||||| |||| |||| || ||| ||||||||||| Sbjct: 112 tgtagcttgtggcgagtgtaagccaattccatata-ctcatctcttctttacatgtactt 170 Query: 665 gtaacgatatccattcttgtgaaacgacgagatacgcttctatcc 709 |||| |||||||||||||| || |||||||||| ||||||||||| Sbjct: 171 gtaatgatatccattcttgcgacacgacgagatgcgcttctatcc 215 Score = 60.0 bits (30), Expect = 1e-05 Identities = 39/42 (92%) Strand = Plus / Plus Query: 527 ttttctcgtttgttttcgtccgtagtcggaccatgctcttct 568 |||| |||||||||||||||||||| |||||| ||||||||| Sbjct: 30 ttttatcgtttgttttcgtccgtagccggaccctgctcttct 71
>gb|AF509775.1| Hordeum vulgare subsp. vulgare isolate RSB409A Rpg1 region, genomic sequence Length = 7321 Score = 105 bits (53), Expect = 2e-19 Identities = 89/101 (88%) Strand = Plus / Plus Query: 290 tgccgagaaagttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcg 349 |||||| | |||| ||||||||||||||||||| |||| |||| || |||||| |||||| Sbjct: 5994 tgccgatagagtttcgcaagcgtgtcggaatgtgaggaaccgttcggctacgttggttcg 6053 Query: 350 tctgcttcacggagtcatttttcttccaagcgggatctcag 390 ||||||||||||| || || ||||||||||| ||||||||| Sbjct: 6054 tctgcttcacggattcgttcttcttccaagcaggatctcag 6094
>gb|DQ995513.1| Hordeum vulgare clone 604d05_c-69 genomic sequence Length = 20922 Score = 95.6 bits (48), Expect = 2e-16 Identities = 81/92 (88%) Strand = Plus / Minus Query: 299 agttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgcttca 358 |||||||||||||||||||||||| ||||||||| ||||||||| |||||| | || || Sbjct: 286 agttccgcaagcgtgtcggaatgtgaggacccgttcgactacgttggttcgccgactcca 227 Query: 359 cggagtcatttttcttccaagcgggatctcag 390 | |||| || ||||||||||||||||||||| Sbjct: 226 ccgagttgttcttcttccaagcgggatctcag 195
>gb|AY054379.1| Hordeum murinum clone HmuLTR-INS Sukkula retrotransposon long terminal repeat, complete sequence Length = 7586 Score = 93.7 bits (47), Expect = 9e-16 Identities = 90/103 (87%), Gaps = 1/103 (0%) Strand = Plus / Plus Query: 605 tgtagcttgtggcgagtgtaagcaaattctttatatctcaccttttcagtacatgtactt 664 ||||||||||||||||||||||| ||||| |||| |||| || ||| ||||||||||| Sbjct: 4075 tgtagcttgtggcgagtgtaagccaattccatata-ctcatctcttctttacatgtactt 4133 Query: 665 gtaacgatatccattcttgtgaaacgacgagatacgcttctat 707 |||| |||||||||||||| || |||||||||| | ||||||| Sbjct: 4134 gtaatgatatccattcttgcgacacgacgagatgcacttctat 4176 Score = 77.8 bits (39), Expect = 5e-11 Identities = 110/131 (83%), Gaps = 7/131 (5%) Strand = Plus / Plus Query: 450 ttcttcttcttcttcatcatcgatctaggatgggttccgggccggcagcct-ggatagca 508 ||||||||||||||| || | |||| |||||||||||| || ||||||||| |||||||| Sbjct: 3920 ttcttcttcttcttcttctttgatccaggatgggttccagg-cggcagcctgggatagca 3978 Query: 509 aggatggacgtcgttctcttttctcgtttgttttcgtccgtagtcggaccatgctcttct 568 ||||||| ||| |||| ||||||||||||||||||||| |||| ||||||||| Sbjct: 3979 aggatgggtgtc-----attttatcgtttgttttcgtccgtagttagaccctgctcttct 4033 Query: 569 tcatgatgttt 579 ||||||||| Sbjct: 4034 gtatgatgttt 4044 Score = 56.0 bits (28), Expect = 2e-04 Identities = 77/92 (83%), Gaps = 1/92 (1%) Strand = Plus / Plus Query: 297 aaagttccgcaagcgtgtcggaatgtaaggacccgtgcgactacgtcggttcgtctgctt 356 |||||| || |||||| ||||| ||| |||| ||| ||||||||| ||||||| | ||| Sbjct: 2493 aaagtttcgaaagcgt-tcggagtgtgaggattcgttcgactacgttggttcgtttactt 2551 Query: 357 cacggagtcatttttcttccaagcgggatctc 388 ||||| || || ||||||||||||||||||| Sbjct: 2552 cacggtttcgttcttcttccaagcgggatctc 2583
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 73.8 bits (37), Expect = 8e-10 Identities = 91/108 (84%), Gaps = 2/108 (1%) Strand = Plus / Plus Query: 82 gacgcgcatctctacgacgacctggacgccgtcgccatcccgacgctcctcgactcccgc 141 ||||| || ||||||||||||| |||| || | ||||||| || || |||||||||||| Sbjct: 42962829 gacgcccacctctacgacgaccccgacgacgcctccatccccaccctgctcgactcccgc 42962888 Query: 142 atcgacggcgagaaggtcgacgc--tcaagcgcctcctcgccctcatc 187 |||| | ||| ||| ||||||| ||||||||||||||||||||||| Sbjct: 42962889 ttcgatgccgacaagctcgacgccctcaagcgcctcctcgccctcatc 42962936 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 258 aagaagctcgtctacctctac 278 ||||||||||||||||||||| Sbjct: 5131492 aagaagctcgtctacctctac 5131472
>dbj|AP003298.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0698H10 Length = 153449 Score = 73.8 bits (37), Expect = 8e-10 Identities = 91/108 (84%), Gaps = 2/108 (1%) Strand = Plus / Plus Query: 82 gacgcgcatctctacgacgacctggacgccgtcgccatcccgacgctcctcgactcccgc 141 ||||| || ||||||||||||| |||| || | ||||||| || || |||||||||||| Sbjct: 63708 gacgcccacctctacgacgaccccgacgacgcctccatccccaccctgctcgactcccgc 63767 Query: 142 atcgacggcgagaaggtcgacgc--tcaagcgcctcctcgccctcatc 187 |||| | ||| ||| ||||||| ||||||||||||||||||||||| Sbjct: 63768 ttcgatgccgacaagctcgacgccctcaagcgcctcctcgccctcatc 63815
>dbj|AP003277.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518C01 Length = 173555 Score = 73.8 bits (37), Expect = 8e-10 Identities = 91/108 (84%), Gaps = 2/108 (1%) Strand = Plus / Plus Query: 82 gacgcgcatctctacgacgacctggacgccgtcgccatcccgacgctcctcgactcccgc 141 ||||| || ||||||||||||| |||| || | ||||||| || || |||||||||||| Sbjct: 156563 gacgcccacctctacgacgaccccgacgacgcctccatccccaccctgctcgactcccgc 156622 Query: 142 atcgacggcgagaaggtcgacgc--tcaagcgcctcctcgccctcatc 187 |||| | ||| ||| ||||||| ||||||||||||||||||||||| Sbjct: 156623 ttcgatgccgacaagctcgacgccctcaagcgcctcctcgccctcatc 156670
>gb|AC189673.2| Trichinella spiralis BAC clone TS195-25H12 from chromosome unknown, complete sequence Length = 138242 Score = 50.1 bits (25), Expect = 0.012 Identities = 25/25 (100%) Strand = Plus / Minus Query: 446 ttgcttcttcttcttcttcatcatc 470 ||||||||||||||||||||||||| Sbjct: 115994 ttgcttcttcttcttcttcatcatc 115970
>ref|XM_001216351.1| Aspergillus terreus NIH2624 conserved hypothetical protein (ATEG_07730) mRNA, complete cds Length = 2454 Score = 48.1 bits (24), Expect = 0.048 Identities = 36/40 (90%) Strand = Plus / Plus Query: 256 tgaagaagctcgtctacctctacctgctccaccatgccga 295 ||||||| ||||||||| |||||||| | ||||||||||| Sbjct: 275 tgaagaaactcgtctacatctacctggtgcaccatgccga 314
>ref|XM_001016641.1| Tetrahymena thermophila SB210 hypothetical protein (TTHERM_00190640) mRNA, complete cds Length = 2628 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 448 gcttcttcttcttcttcatcatc 470 ||||||||||||||||||||||| Sbjct: 632 gcttcttcttcttcttcatcatc 610
>ref|XM_001008066.1| Tetrahymena thermophila SB210 Brix domain containing protein (TTHERM_00004830) mRNA, complete cds Length = 1707 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 1630 cttcttcttcttcttcatcatcg 1608
>ref|NM_119658.2| Arabidopsis thaliana phospholipase C (AT4G34920) mRNA, complete cds Length = 1292 Score = 46.1 bits (23), Expect = 0.19 Identities = 26/27 (96%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcgatct 475 |||||||||||||||||||||| |||| Sbjct: 27 cttcttcttcttcttcatcatcaatct 53
>ref|NM_124400.2| Arabidopsis thaliana quinolinate synthetase A (AT5G50210) mRNA, complete cds Length = 2598 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 446 ttgcttcttcttcttcttcatca 468 ||||||||||||||||||||||| Sbjct: 368 ttgcttcttcttcttcttcatca 390
>ref|NM_122396.3| Arabidopsis thaliana protein binding / ubiquitin-protein ligase/ zinc ion binding (AT5G24870) mRNA, complete cds Length = 2086 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 170 cttcttcttcttcttcatcatcg 192
>ref|XM_633602.1| Dictyostelium discoideum AX4 inositol 5-phosphatase (Dd5P2) mRNA, complete cds Length = 5403 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 3631 cttcttcttcttcttcatcatcg 3609
>ref|XM_876112.1| PREDICTED: Bos taurus similar to Protein KIAA0179, transcript variant 6 (LOC510240), mRNA Length = 2330 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 441 tggagttgcttcttcttcttctt 463 ||||||||||||||||||||||| Sbjct: 1285 tggagttgcttcttcttcttctt 1263
>ref|XM_876040.1| PREDICTED: Bos taurus similar to Protein KIAA0179, transcript variant 5 (LOC510240), mRNA Length = 2440 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 441 tggagttgcttcttcttcttctt 463 ||||||||||||||||||||||| Sbjct: 1395 tggagttgcttcttcttcttctt 1373
>ref|XM_875973.1| PREDICTED: Bos taurus similar to Protein KIAA0179, transcript variant 4 (LOC510240), mRNA Length = 2324 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 441 tggagttgcttcttcttcttctt 463 ||||||||||||||||||||||| Sbjct: 1279 tggagttgcttcttcttcttctt 1257
>ref|XM_587363.2| PREDICTED: Bos taurus similar to Protein KIAA0179, transcript variant 1 (LOC510240), mRNA Length = 2176 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 441 tggagttgcttcttcttcttctt 463 ||||||||||||||||||||||| Sbjct: 1131 tggagttgcttcttcttcttctt 1109
>ref|XM_865355.1| PREDICTED: Bos taurus similar to Protein KIAA0179, transcript variant 2 (LOC510240), mRNA Length = 2348 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 441 tggagttgcttcttcttcttctt 463 ||||||||||||||||||||||| Sbjct: 1285 tggagttgcttcttcttcttctt 1263
>ref|XM_875760.1| PREDICTED: Bos taurus similar to Protein KIAA0179, transcript variant 3 (LOC510240), mRNA Length = 2256 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 441 tggagttgcttcttcttcttctt 463 ||||||||||||||||||||||| Sbjct: 1211 tggagttgcttcttcttcttctt 1189
>ref|XM_713512.1| Candida albicans SC5314 hypothetical protein (CaO19_10040), mRNA Length = 3633 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 1774 cttcttcttcttcttcatcatcg 1752
>ref|XM_713429.1| Candida albicans SC5314 hypothetical protein (CaO19_2504), mRNA Length = 3633 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 1774 cttcttcttcttcttcatcatcg 1752
>ref|XM_712010.1| Candida albicans SC5314 hypothetical protein (CaO19_5299), mRNA Length = 594 Score = 46.1 bits (23), Expect = 0.19 Identities = 26/27 (96%) Strand = Plus / Minus Query: 438 atttggagttgcttcttcttcttcttc 464 |||||||||| |||||||||||||||| Sbjct: 543 atttggagtttcttcttcttcttcttc 517
>gb|AY378152.1| Rosa hybrid cultivar 'Kardinal' 1-aminocyclopropane-1-carboxylate synthase mRNA, complete cds Length = 1750 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 26 cttcttcttcttcttcatcatcg 48
>gb|AY113860.1| Arabidopsis thaliana unknown protein (At5g50210) mRNA, complete cds Length = 2188 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 446 ttgcttcttcttcttcttcatca 468 ||||||||||||||||||||||| Sbjct: 212 ttgcttcttcttcttcttcatca 234
>gb|AY035115.1| Arabidopsis thaliana unknown protein (At5g50210) mRNA, complete cds Length = 2598 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 446 ttgcttcttcttcttcttcatca 468 ||||||||||||||||||||||| Sbjct: 368 ttgcttcttcttcttcttcatca 390
>gb|AY136427.1| Arabidopsis thaliana RING finger-like protein (At5g24870) mRNA, complete cds Length = 1933 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 17 cttcttcttcttcttcatcatcg 39
>gb|AY085553.1| Arabidopsis thaliana clone 15702 mRNA, complete sequence Length = 2523 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 446 ttgcttcttcttcttcttcatca 468 ||||||||||||||||||||||| Sbjct: 309 ttgcttcttcttcttcttcatca 331
>emb|AL392145.1|ATT4C12 Arabidopsis thaliana DNA chromosome 5, BAC clone T4C12 (ESSA project) Length = 87871 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 81725 cttcttcttcttcttcatcatcg 81703
>gb|AY037233.1| Arabidopsis thaliana AT4g34920/F11I11_160 mRNA, complete cds Length = 1239 Score = 46.1 bits (23), Expect = 0.19 Identities = 26/27 (96%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcgatct 475 |||||||||||||||||||||| |||| Sbjct: 27 cttcttcttcttcttcatcatcaatct 53
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82 Length = 195165 Score = 46.1 bits (23), Expect = 0.19 Identities = 26/27 (96%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcgatct 475 |||||||||||||||||||||| |||| Sbjct: 90489 cttcttcttcttcttcatcatcaatct 90515
>emb|AL079347.1|ATF11I11 Arabidopsis thaliana DNA chromosome 4, BAC clone F11I11 (ESSA project) Length = 103150 Score = 46.1 bits (23), Expect = 0.19 Identities = 26/27 (96%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcgatct 475 |||||||||||||||||||||| |||| Sbjct: 61031 cttcttcttcttcttcatcatcaatct 61057
>gb|AY184993.1| Dictyostelium discoideum inositol 5-phosphatase 2 gene, complete cds Length = 5562 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 3790 cttcttcttcttcttcatcatcg 3768
>dbj|AB024031.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K6A12 Length = 64136 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 446 ttgcttcttcttcttcttcatca 468 ||||||||||||||||||||||| Sbjct: 37735 ttgcttcttcttcttcttcatca 37757
>gb|AF069716.1|AF069716 Arabidopsis Thaliana BAC F6A4, Chromosome IV, near 60.5 cM, complete sequence Length = 99123 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcg 471 ||||||||||||||||||||||| Sbjct: 66145 cttcttcttcttcttcatcatcg 66167
>emb|CR762406.11| Zebrafish DNA sequence from clone DKEY-13D23 in linkage group 1, complete sequence Length = 143905 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 53892 cttcttcttcttcttcatcatc 53871
>ref|XM_001023004.1| Tetrahymena thermophila SB210 MIZ zinc finger family protein (TTHERM_00348490) mRNA, complete cds Length = 4620 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 3907 cttcttcttcttcttcatcatc 3886
>ref|XM_001022656.1| Tetrahymena thermophila SB210 Leucine Rich Repeat family protein (TTHERM_00727710) mRNA, complete cds Length = 6030 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 3529 cttcttcttcttcttcatcatc 3508
>ref|XM_001022131.1| Tetrahymena thermophila SB210 hypothetical protein (TTHERM_00786920) mRNA, complete cds Length = 2634 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2017 cttcttcttcttcttcatcatc 1996
>ref|XM_001021992.1| Tetrahymena thermophila SB210 Leucine Rich Repeat family protein (TTHERM_00563930) mRNA, complete cds Length = 14385 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 450 ttcttcttcttcttcatcatcg 471 |||||||||||||||||||||| Sbjct: 963 ttcttcttcttcttcatcatcg 942
>ref|XM_001021866.1| Tetrahymena thermophila SB210 Protein kinase domain containing protein (TTHERM_00933100) mRNA, complete cds Length = 2931 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1285 cttcttcttcttcttcatcatc 1264
>ref|XM_001019528.1| Tetrahymena thermophila SB210 Pescadillo N-terminus family protein (TTHERM_00628420) mRNA, complete cds Length = 1806 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1471 cttcttcttcttcttcatcatc 1450
>ref|XM_001018046.1| Tetrahymena thermophila SB210 hypothetical protein (TTHERM_00954230) mRNA, complete cds Length = 633 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 550 cttcttcttcttcttcatcatc 529
>ref|XM_001017371.1| Tetrahymena thermophila SB210 B-box zinc finger family protein (TTHERM_00476630) mRNA, complete cds Length = 4800 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2068 cttcttcttcttcttcatcatc 2047
>ref|XM_001013035.1| Tetrahymena thermophila SB210 PHD-finger family protein (TTHERM_00324480) mRNA, complete cds Length = 7194 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 6283 cttcttcttcttcttcatcatc 6262
>ref|XM_001012923.1| Tetrahymena thermophila SB210 hypothetical protein (TTHERM_00320240) mRNA, complete cds Length = 4749 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 4348 cttcttcttcttcttcatcatc 4327
>ref|XM_415311.2| PREDICTED: Gallus gallus similar to AP1B1 (LOC417021), mRNA Length = 2721 Score = 44.1 bits (22), Expect = 0.74 Identities = 25/26 (96%) Strand = Plus / Plus Query: 256 tgaagaagctcgtctacctctacctg 281 |||||||||| ||||||||||||||| Sbjct: 74 tgaagaagctggtctacctctacctg 99
>gb|EF058390.1| Synthetic construct Saccharomyces cerevisiae clone FLH202568.01X YPL158C, complete sequence Length = 2277 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2005 cttcttcttcttcttcatcatc 1984 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 450 ttcttcttcttcttcatcatc 470 ||||||||||||||||||||| Sbjct: 2070 ttcttcttcttcttcatcatc 2050
>ref|XM_001188623.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC760535 (LOC760535), mRNA Length = 570 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 379 cttcttcttcttcttcatcatc 358
>ref|XM_001199712.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC763665 (LOC763665), mRNA Length = 570 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 379 cttcttcttcttcttcatcatc 358
>gb|DQ908136.1| Gossypium hirsutum clone LIB5327-035-A1-N1-G1_PS_Gh194 microsatellite sequence Length = 261 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 164 cttcttcttcttcttcatcatc 185
>gb|DQ908092.1| Gossypium hirsutum clone LIB5327-012-A1-N1-H10_PS_Gh150 microsatellite sequence Length = 487 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 293 cttcttcttcttcttcatcatc 272
>gb|DQ907988.1| Gossypium hirsutum clone LIB5327-024-A1-N1-E3_F_S_C_Gh45__Gh46 microsatellite sequence Length = 660 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 559 cttcttcttcttcttcatcatc 580
>gb|AC187866.2| Populus trichocarpa clone Pop1-7B1, complete sequence Length = 150555 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 76001 cttcttcttcttcttcatcatc 75980
>gb|AC182671.2| Populus trichocarpa clone Pop1-24F1, complete sequence Length = 138008 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 14926 cttcttcttcttcttcatcatc 14947
>emb|AM260480.1| Ralstonia eutropha H16 chromosome 2 Length = 2912490 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 138 ccgcatcgacggcgagaaggtc 159 |||||||||||||||||||||| Sbjct: 1522159 ccgcatcgacggcgagaaggtc 1522138
>emb|AM260479.1| Ralstonia eutropha H16 chromosome 1 Length = 4052032 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 96 cgacgacctggacgccgtcgcc 117 |||||||||||||||||||||| Sbjct: 1205577 cgacgacctggacgccgtcgcc 1205598
>gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete sequence Length = 23011544 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 16619569 cttcttcttcttcttcatcatc 16619590 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 444 agttgcttcttcttcttcttc 464 ||||||||||||||||||||| Sbjct: 14579428 agttgcttcttcttcttcttc 14579448
>gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete sequence Length = 24543557 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 10761158 cttcttcttcttcttcatcatc 10761179
>gb|AE014298.4| Drosophila melanogaster chromosome X, complete sequence Length = 22422827 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 19682255 cttcttcttcttcttcatcatc 19682276 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 444 agttgcttcttcttcttcttc 464 ||||||||||||||||||||| Sbjct: 14349435 agttgcttcttcttcttcttc 14349415
>gb|AC127267.4| Mus musculus BAC clone RP23-401H14 from chromosome 6, complete sequence Length = 186704 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 122912 cttcttcttcttcttcatcatc 122933
>gb|AC189297.1| Brassica rapa subsp. pekinensis clone KBrB027O09, complete sequence Length = 149009 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 141347 cttcttcttcttcttcatcatc 141326
>ref|XM_395730.3| PREDICTED: Apis mellifera similar to Transcription factor IIA L CG5930-PA, isoform A (LOC412268), mRNA Length = 1087 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 812 cttcttcttcttcttcatcatc 791
>dbj|AK226990.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL09-43-E18 Length = 1066 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 824 cttcttcttcttcttcatcatc 803
>gb|AC160104.3| Mus musculus BAC clone RP24-330A11 from chromosome 9, complete sequence Length = 223686 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 148985 cttcttcttcttcttcatcatc 148964
>ref|XR_009282.1| PREDICTED: Rattus norvegicus hypothetical protein LOC687574 (LOC687574), mRNA Length = 478 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 169 cttcttcttcttcttcatcatc 148
>ref|XR_011015.1| PREDICTED: Macaca mulatta RNA binding motif protein 28 (RBM28), mRNA Length = 2828 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 854 cttcttcttcttcttcatcatc 833
>gb|AC184061.2| Populus trichocarpa clone Pop1-106E19, complete sequence Length = 73441 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 51017 cttcttcttcttcttcatcatc 51038
>ref|XM_973116.1| PREDICTED: Mus musculus hypothetical protein LOC669115 (LOC669115), mRNA Length = 375 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 79 cttcttcttcttcttcatcatc 58
>ref|XM_973114.1| PREDICTED: Mus musculus hypothetical protein LOC664863 (LOC664863), mRNA Length = 375 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 79 cttcttcttcttcttcatcatc 58
>ref|XM_975279.1| PREDICTED: Mus musculus similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38) (LOC669474), mRNA Length = 1176 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 621 cttcttcttcttcttcatcatc 600
>ref|XM_994119.1| PREDICTED: Mus musculus similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38) (LOC624165), mRNA Length = 1171 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 630 cttcttcttcttcttcatcatc 609
>ref|XM_992884.1| PREDICTED: Mus musculus similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38) (LOC676786), mRNA Length = 1176 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 621 cttcttcttcttcttcatcatc 600
>ref|XM_907784.2| PREDICTED: Mus musculus similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38) (LOC633387), mRNA Length = 736 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 630 cttcttcttcttcttcatcatc 609
>ref|XM_001001040.1| PREDICTED: Mus musculus similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38) (LOC668347), mRNA Length = 1176 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 621 cttcttcttcttcttcatcatc 600
>ref|XM_890841.2| PREDICTED: Mus musculus similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38), transcript variant 1 (LOC624165), mRNA Length = 1171 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 630 cttcttcttcttcttcatcatc 609
>gb|DQ459191.1| Arabidopsis thaliana unknown (At3g57950) gene, complete cds Length = 546 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 29 cttcttcttcttcttcatcatc 50
>emb|CT009563.15| Mouse DNA sequence from clone RP23-69I23 on chromosome 14, complete sequence Length = 68081 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1473 cttcttcttcttcttcatcatc 1452
>gb|AC175056.3| Mus musculus BAC clone RP24-212M24 from chromosome y, complete sequence Length = 166788 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 159401 cttcttcttcttcttcatcatc 159380
>emb|AM183148.1| Crinipellis perniciosa microsatellite DNA, allele 197, clone MsCepec_Cp15 Length = 500 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 131 cttcttcttcttcttcatcatc 110
>gb|AC183526.2| Mus musculus BAC clone RP24-121M8 from chromosome y, complete sequence Length = 175230 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 137622 cttcttcttcttcttcatcatc 137601
>ref|XM_363920.1| Magnaporthe grisea 70-15 hypothetical protein (MG01846.4) partial mRNA Length = 2508 Score = 44.1 bits (22), Expect = 0.74 Identities = 34/38 (89%) Strand = Plus / Plus Query: 258 aagaagctcgtctacctctacctgctccaccatgccga 295 |||||||| |||||| ||||||| || ||||||||||| Sbjct: 337 aagaagctggtctacatctacctccttcaccatgccga 374
>ref|NM_148229.1| Arabidopsis thaliana unknown protein (AT4G04635) mRNA, complete cds Length = 855 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 679 cttcttcttcttcttcatcatc 658
>ref|NM_124599.3| Arabidopsis thaliana unknown protein (AT5G52200) mRNA, complete cds Length = 786 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 447 tgcttcttcttcttcttcatca 468 |||||||||||||||||||||| Sbjct: 331 tgcttcttcttcttcttcatca 310
>ref|NM_105280.2| Arabidopsis thaliana ATP binding / nucleoside-triphosphatase/ nucleotide binding / transmembrane receptor (AT1G66090) mRNA, complete cds Length = 1555 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 89 cttcttcttcttcttcatcatc 110
>ref|NM_120020.3| Arabidopsis thaliana BGAL14; beta-galactosidase/ sugar binding (BGAL14) mRNA, complete cds Length = 3187 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2618 cttcttcttcttcttcatcatc 2597
>ref|NM_115657.1| Arabidopsis thaliana unknown protein (AT3G57950) mRNA, complete cds Length = 546 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 29 cttcttcttcttcttcatcatc 50
>ref|NM_106729.1| Arabidopsis thaliana unknown protein (AT1G80810) mRNA, complete cds Length = 2481 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2344 cttcttcttcttcttcatcatc 2323
>ref|NM_101017.2| Arabidopsis thaliana unknown protein (AT1G11440) mRNA, complete cds Length = 1303 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 788 cttcttcttcttcttcatcatc 767
>ref|NM_117904.1| Arabidopsis thaliana unknown protein (AT4G17940) mRNA, complete cds Length = 1058 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 826 cttcttcttcttcttcatcatc 805
>ref|NM_117528.1| Arabidopsis thaliana ATP binding / kinase/ protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase (AT4G14480) mRNA, complete cds Length = 1464 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1009 cttcttcttcttcttcatcatc 988
>gb|AC167172.3| Mus musculus BAC clone RP23-166M7 from chromosome 3, complete sequence Length = 204419 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 53482 cttcttcttcttcttcatcatc 53461
>ref|XM_633506.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0185982) mRNA, complete cds Length = 2409 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 265 cttcttcttcttcttcatcatc 244
>ref|XM_632924.1| Dictyostelium discoideum AX4 helicase (helD) mRNA, complete cds Length = 4164 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 611 cttcttcttcttcttcatcatc 632
>ref|XM_632338.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0218892) mRNA, complete cds Length = 4734 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 266 cttcttcttcttcttcatcatc 287
>ref|XM_642068.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0189401) mRNA, complete cds Length = 672 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 104 cttcttcttcttcttcatcatc 125
>ref|XM_640096.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0168707) mRNA, complete cds Length = 882 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 259 cttcttcttcttcttcatcatc 238
>ref|XM_639810.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0168922) mRNA, complete cds Length = 1368 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 709 cttcttcttcttcttcatcatc 688
>ref|XM_638506.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0167175) mRNA, complete cds Length = 834 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 775 cttcttcttcttcttcatcatc 754
>ref|XM_638213.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0169480) mRNA, complete cds Length = 2943 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 451 tcttcttcttcttcatcatcga 472 |||||||||||||||||||||| Sbjct: 1192 tcttcttcttcttcatcatcga 1213
>ref|XM_637464.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0218002) mRNA, complete cds Length = 4164 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1486 cttcttcttcttcttcatcatc 1465
>gb|AC110520.12| Mus musculus chromosome 7, clone RP23-24N16, complete sequence Length = 248540 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 20703 cttcttcttcttcttcatcatc 20682
>ref|XM_636111.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0205231) mRNA, complete cds Length = 915 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 331 cttcttcttcttcttcatcatc 310
>ref|XM_634028.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0218485) mRNA, complete cds Length = 5541 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1873 cttcttcttcttcttcatcatc 1852
>ref|XM_633701.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0218548) mRNA, complete cds Length = 3363 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 758 cttcttcttcttcttcatcatc 779
>ref|XM_630308.1| Dictyostelium discoideum AX4 G-protein-coupled receptor (GPCR) family protein (grlP) mRNA, complete cds Length = 4224 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 3389 cttcttcttcttcttcatcatc 3410
>gb|AC132350.4| Mus musculus BAC clone RP24-95A6 from chromosome 6, complete sequence Length = 177167 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 446 ttgcttcttcttcttcttcatc 467 |||||||||||||||||||||| Sbjct: 6555 ttgcttcttcttcttcttcatc 6576
>gb|AC152949.1| Mus musculus 10 BAC RP23-184H3 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206898 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 40031 cttcttcttcttcttcatcatc 40052 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 205216 cttcttcttcttcttcatcatc 205195
>gb|AY728192.1| Dianthus caryophyllus ethylene insensitive 3-like 3 mRNA, complete cds Length = 2187 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 19 cttcttcttcttcttcatcatc 40
>ref|NM_001006873.1| Xenopus tropicalis v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) (mycn), mRNA gb|BC076996.1| Xenopus tropicalis v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian), mRNA (cDNA clone MGC:89626 IMAGE:6995572), complete cds Length = 1782 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1063 cttcttcttcttcttcatcatc 1042
>gb|AC149578.15| Medicago truncatula clone mth2-94f23, complete sequence Length = 119657 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 3804 cttcttcttcttcttcatcatc 3825
>gb|AY588398.1| Humulus lupulus clone HlAGA4 microsatellite sequence Length = 352 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 306 cttcttcttcttcttcatcatc 285
>gb|AE014842.1| Plasmodium falciparum 3D7 chromosome 11 section 7 of 8 of the complete sequence Length = 253151 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 88501 cttcttcttcttcttcatcatc 88522
>gb|AF140073.1| Apis mellifera carnica microsatellite 4A44 sequence Length = 529 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 252 cttcttcttcttcttcatcatc 273
>gb|AE001396.1| Plasmodium falciparum 3D7 chromosome 2 section 33 of 73 of the complete sequence Length = 14613 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 4851 cttcttcttcttcttcatcatc 4830
>gb|AC159319.2| Mus musculus BAC clone RP23-37C8 from chromosome 9, complete sequence Length = 175636 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 128644 cttcttcttcttcttcatcatc 128623
>gb|AC153140.5| Mus musculus BAC clone RP23-340P19 from chromosome 12, complete sequence Length = 241834 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 55208 cttcttcttcttcttcatcatc 55187
>gb|AC096997.3| Takifugu rubripes clone 217A23, complete sequence Length = 74841 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 447 tgcttcttcttcttcttcatca 468 |||||||||||||||||||||| Sbjct: 55642 tgcttcttcttcttcttcatca 55621
>gb|AC113113.18| Mus musculus chromosome 16, clone RP23-334P10, complete sequence Length = 216380 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 21538 cttcttcttcttcttcatcatc 21517
>gb|AC112739.5| Rattus norvegicus 7 BAC CH230-108A12 (Children's Hospital Oakland Research Institute) complete sequence Length = 234420 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 25417 cttcttcttcttcttcatcatc 25438
>ref|XM_716472.1| Candida albicans SC5314 hypothetical protein (CaO19_9174), mRNA Length = 1599 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 772 cttcttcttcttcttcatcatc 751
>ref|XM_715816.1| Candida albicans SC5314 hypothetical protein (CaO19_13939), mRNA Length = 942 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 355 cttcttcttcttcttcatcatc 334
>ref|XM_715040.1| Candida albicans SC5314 hypothetical protein (CaO19_7938), mRNA Length = 1860 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 233 cttcttcttcttcttcatcatc 254
>ref|XM_714908.1| Candida albicans SC5314 hypothetical protein (CaO19_306), mRNA Length = 1860 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 233 cttcttcttcttcttcatcatc 254
>ref|XM_709056.1| Candida albicans SC5314 hypothetical protein (CaO19.11599), mRNA Length = 684 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 26 cttcttcttcttcttcatcatc 47
>ref|XM_707905.1| Candida albicans SC5314 hyphal-specific cell wall protein ECE2 (CaO19.8901), mRNA Length = 1905 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 635 cttcttcttcttcttcatcatc 656
>ref|XM_706364.1| Candida albicans SC5314 hypothetical protein (CaO19.9357), mRNA Length = 1476 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 83 cttcttcttcttcttcatcatc 104
>ref|XM_706347.1| Candida albicans SC5314 hypothetical protein (CaO19.1791), mRNA Length = 1476 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 83 cttcttcttcttcttcatcatc 104
>ref|XM_705674.1| Candida albicans SC5314 hypothetical protein (CaO19.11182), mRNA Length = 681 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 263 cttcttcttcttcttcatcatc 284
>ref|XM_705356.1| Candida albicans SC5314 putative U3 snoRNP protein Utp20p (CaO19.10668), mRNA Length = 3594 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2747 cttcttcttcttcttcatcatc 2768
>ref|XM_705349.1| Candida albicans SC5314 putative U3 snoRNP protein Utp20p (CaO19.3159), mRNA Length = 3594 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2747 cttcttcttcttcttcatcatc 2768
>ref|XM_704869.1| Candida albicans SC5314 hyphal-specific cell wall protein ECE2 (CaO19.1321), mRNA Length = 1905 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 635 cttcttcttcttcttcatcatc 656
>ref|XM_704868.1| Candida albicans SC5314 hypothetical protein (CaO19.1320), mRNA Length = 525 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 373 cttcttcttcttcttcatcatc 352
>ref|XM_658754.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6242.2), mRNA Length = 525 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 484 cttcttcttcttcttcatcatc 463
>gb|AC153518.14| Mus musculus 10 BAC RP23-426B18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 160531 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 141700 cttcttcttcttcttcatcatc 141721
>gb|AC161442.5| Mus musculus chromosome 5, clone RP23-384P12, complete sequence Length = 174557 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 65498 cttcttcttcttcttcatcatc 65519
>gb|AC164559.3| Mus musculus BAC clone RP23-198H17 from chromosome 6, complete sequence Length = 194636 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 171618 cttcttcttcttcttcatcatc 171639
>gb|AC137065.26| Medicago truncatula clone mth2-29h7, complete sequence Length = 105004 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 100376 cttcttcttcttcttcatcatc 100397
>ref|XM_844834.1| PREDICTED: Canis familiaris similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002), transcript variant 2 (LOC608403), mRNA Length = 1759 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 792 cttcttcttcttcttcatcatc 771
>ref|XM_855074.1| PREDICTED: Canis familiaris similar to SET protein (Phosphatase 2A inhibitor I2PP2A) (I-2PP2A) (Template activating factor I) (TAF-I) (Liver regeneration-related protein LRRGR00002), transcript variant 3 (LOC608403), mRNA Length = 1294 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 327 cttcttcttcttcttcatcatc 306
>gb|AC116551.2| Dictyostelium discoideum chromosome 2 map complement(581327-427576) strain AX4, complete sequence Length = 153751 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 86966 cttcttcttcttcttcatcatc 86945
>gb|AC116979.3| Dictyostelium discoideum chromosome 2 map 6445720-6776760 strain AX4, complete sequence Length = 331039 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 451 tcttcttcttcttcatcatcga 472 |||||||||||||||||||||| Sbjct: 147522 tcttcttcttcttcatcatcga 147543
>gb|AC115607.2| Dictyostelium discoideum chromosome 2 map 4559693-4624405 strain AX4, complete sequence Length = 64707 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 26970 cttcttcttcttcttcatcatc 26949
>gb|AY310388.1| Spartina alterniflora clone SPAR.03H microsatellite sequence Length = 545 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 464 cttcttcttcttcttcatcatc 485
>gb|AC133191.3| Mus musculus chromosome 18 clone RP23-390K15, complete sequence Length = 212060 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 211922 cttcttcttcttcttcatcatc 211901
>gb|AC102125.13| Mus musculus chromosome 6, clone RP23-190E16, complete sequence Length = 219870 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 187556 cttcttcttcttcttcatcatc 187535
>gb|AC145302.4| Mus musculus BAC clone RP24-89K13 from chromosome Y, complete sequence Length = 168641 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 21711 cttcttcttcttcttcatcatc 21690
>ref|XM_532624.2| PREDICTED: Canis familiaris similar to chromodomain helicase DNA binding protein 8, transcript variant 1 (LOC475401), mRNA Length = 7415 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1055 cttcttcttcttcttcatcatc 1034
>gb|AC139039.9| Mus musculus chromosome 16, clone RP23-300H4, complete sequence Length = 202308 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 199742 cttcttcttcttcttcatcatc 199721
>gb|AC129016.4| Mus musculus BAC clone RP24-389J11 from chromosome 10, complete sequence Length = 160180 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 69625 cttcttcttcttcttcatcatc 69646
>gb|AC127586.4| Mus musculus BAC clone RP24-142A16 from chromosome 7, complete sequence Length = 164692 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 150386 cttcttcttcttcttcatcatc 150407
>ref|XM_854550.1| PREDICTED: Canis familiaris similar to senataxin, transcript variant 2 (LOC480691), mRNA Length = 8571 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 3103 cttcttcttcttcttcatcatc 3082
>ref|XM_537811.2| PREDICTED: Canis familiaris similar to senataxin, transcript variant 1 (LOC480691), mRNA Length = 8670 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 3103 cttcttcttcttcttcatcatc 3082
>gb|AC129609.3| Mus musculus BAC clone RP23-194H4 from chromosome 7, complete sequence Length = 225829 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 105522 cttcttcttcttcttcatcatc 105501 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 131620 cttcttcttcttcttcatcatc 131599
>gb|AC124399.4| Mus musculus BAC clone RP24-351I17 from chromosome 10, complete sequence Length = 179668 Score = 44.1 bits (22), Expect = 0.74 Identities = 25/26 (96%) Strand = Plus / Minus Query: 445 gttgcttcttcttcttcttcatcatc 470 |||| ||||||||||||||||||||| Sbjct: 108618 gttgtttcttcttcttcttcatcatc 108593
>gb|AC125526.4| Mus musculus BAC clone RP24-498L21 from chromosome 15, complete sequence Length = 178670 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 150071 cttcttcttcttcttcatcatc 150092
>gb|AC124501.3| Mus musculus BAC clone RP23-412F10 from chromosome 6, complete sequence Length = 210057 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 70616 cttcttcttcttcttcatcatc 70637
>gb|AC120837.6| Mus musculus Strain C57BL6/J chromosome 11 BAC, RP23-439E2, Complete Sequence, complete sequence Length = 211996 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 113262 cttcttcttcttcttcatcatc 113283
>gb|AC121838.2| Mus musculus BAC clone RP24-74O18 from 1, complete sequence Length = 180961 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 138501 cttcttcttcttcttcatcatc 138480
>gb|AC121868.2| Mus musculus BAC clone RP24-116H17 from 1, complete sequence Length = 209039 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 24797 cttcttcttcttcttcatcatc 24776
>gb|AC117615.11| Mus musculus chromosome 19, clone RP23-110D20, complete sequence Length = 191809 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 75217 cttcttcttcttcttcatcatc 75238
>gb|BC053442.1| Mus musculus RIKEN cDNA 2810002O09 gene, mRNA (cDNA clone IMAGE:6333717), partial cds Length = 1458 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1401 cttcttcttcttcttcatcatc 1380
>gb|AC161054.3| Mus musculus BAC clone RP23-381H23 from chromosome 10, complete sequence Length = 202932 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 66143 cttcttcttcttcttcatcatc 66122
>gb|AC116458.9| Mus musculus chromosome 16, clone RP23-11L14, complete sequence Length = 219241 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 18442 cttcttcttcttcttcatcatc 18421
>gb|AC154556.2| Mus musculus BAC clone RP23-423F3 from chromosome 14, complete sequence Length = 189092 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 128826 cttcttcttcttcttcatcatc 128805
>gb|AC144799.3| Mus musculus chromosome 18 clone RP24-299J7, complete sequence Length = 192272 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 155443 cttcttcttcttcttcatcatc 155464
>gb|AC139344.17| Medicago truncatula clone mth2-34b22, complete sequence Length = 129728 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 122991 cttcttcttcttcttcatcatc 122970
>ref|XM_631528.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0188026) mRNA, complete cds Length = 2316 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1882 cttcttcttcttcttcatcatc 1861
>gb|AY157667.1| Xenopus laevis HMG transcription factor (Sox10) mRNA, complete cds Length = 2818 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 225 cttcttcttcttcttcatcatc 204
>gb|AC134836.6| Mus musculus BAC clone RP24-323I5 from chromosome 6, complete sequence Length = 150705 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 12934 cttcttcttcttcttcatcatc 12913
>gb|AE014820.1| Plasmodium falciparum 3D7 chromosome 14 section 5 of 13 of the complete sequence Length = 250029 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 45104 cttcttcttcttcttcatcatc 45083 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 49749 cttcttcttcttcttcatcatc 49728
>gb|AC123516.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0035B18, complete sequence Length = 123425 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 35418 cttcttcttcttcttcatcatc 35397
>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 Length = 2505489 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1499558 cttcttcttcttcttcatcatc 1499537
>gb|AY149116.1| Xenopus laevis transcription factor Sox10 mRNA, complete cds Length = 3324 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 246 cttcttcttcttcttcatcatc 225
>ref|XM_381610.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG01434.1) partial mRNA Length = 1134 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 529 cttcttcttcttcttcatcatc 508
>dbj|AP006852.1| Candida albicans genomic DNA, chromosome 7, complete sequence Length = 949626 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 296422 cttcttcttcttcttcatcatc 296443 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 567002 cttcttcttcttcttcatcatc 566981
>gb|AY113882.1| Arabidopsis thaliana putative disease resistance protein (At1g66090) mRNA, complete cds Length = 1321 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 14 cttcttcttcttcttcatcatc 35
>gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 236103 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 152835 cttcttcttcttcttcatcatc 152856
>gb|AF360148.1| Arabidopsis thaliana putative disease resistance protein (At1g66090) mRNA, complete cds Length = 1529 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 47 cttcttcttcttcttcatcatc 68
>gb|AY357582.2| Burkholderia cepacia phage BcepNazgul, complete genome Length = 57455 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 29 cgcgcagcttctcgccgagttc 50 |||||||||||||||||||||| Sbjct: 12229 cgcgcagcttctcgccgagttc 12208
>gb|AC122546.14| Mus musculus chromosome 5, clone RP23-408A1, complete sequence Length = 191640 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 178460 cttcttcttcttcttcatcatc 178481
>ref|XM_459051.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0D14542g) partial mRNA Length = 2883 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2833 cttcttcttcttcttcatcatc 2812
>ref|XM_705655.1| Candida albicans SC5314 hypothetical protein (CaO19.3698) partial mRNA Length = 681 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 263 cttcttcttcttcttcatcatc 284
>gb|AC109243.10| Mus musculus chromosome 18, clone RP23-139O19, complete sequence Length = 186687 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 27648 cttcttcttcttcttcatcatc 27627
>gb|AC010058.7| Drosophila melanogaster 3L BAC RP98-26L14 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181950 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 78387 cttcttcttcttcttcatcatc 78366
>gb|AY116938.1| Arabidopsis thaliana AT5g52200/F17P19_10 mRNA, complete cds Length = 576 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 447 tgcttcttcttcttcttcatca 468 |||||||||||||||||||||| Sbjct: 300 tgcttcttcttcttcttcatca 279
>ref|NM_182000.1| Caenorhabditis elegans Y18D10A.1 (Y18D10A.1) mRNA, complete cds Length = 4905 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 826 cttcttcttcttcttcatcatc 805
>dbj|AK049774.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length enriched library, clone:C530048I19 product:hypothetical protein, full insert sequence Length = 1418 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1415 cttcttcttcttcttcatcatc 1394
>gb|AF324790.1| Pinus taeda clone PtTX4149 microsatellite sequence Length = 360 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 201 cttcttcttcttcttcatcatc 222
>gb|AF351538.1| Gossypium hirsutum clone JESPR300 microsatellite sequence Length = 294 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 203 cttcttcttcttcttcatcatc 224
>dbj|AK050502.1| Mus musculus adult pancreas islet cells cDNA, RIKEN full-length enriched library, clone:C820005A18 product:unclassifiable, full insert sequence Length = 3318 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 145 cttcttcttcttcttcatcatc 166
>gb|AC002505.3| Arabidopsis thaliana chromosome 2 clone T9J22 map B68, complete sequence Length = 115851 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 114234 cttcttcttcttcttcatcatc 114213
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11 Length = 28386948 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1416623 cttcttcttcttcttcatcatc 1416602 Score = 42.1 bits (21), Expect = 2.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatcgat 473 |||||||||||||||| |||||||| Sbjct: 24095200 cttcttcttcttcttcttcatcgat 24095224 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 451 tcttcttcttcttcatcatcg 471 ||||||||||||||||||||| Sbjct: 24570837 tcttcttcttcttcatcatcg 24570857
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3 Length = 36192742 Score = 44.1 bits (22), Expect = 0.74 Identities = 25/26 (96%) Strand = Plus / Plus Query: 438 atttggagttgcttcttcttcttctt 463 |||||||||| ||||||||||||||| Sbjct: 12953431 atttggagtttcttcttcttcttctt 12953456 Score = 42.1 bits (21), Expect = 2.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 446 ttgcttcttcttcttcttcatcatc 470 |||||||||||||||| |||||||| Sbjct: 25002235 ttgcttcttcttcttcatcatcatc 25002259
>gb|AC020632.16| Homo sapiens 3 BAC RP11-333H9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 162029 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 37683 cttcttcttcttcttcatcatc 37704
>emb|Z97987.1|HS453P22 Human DNA sequence from clone RP3-453P22 on chromosome 1p36.2-36.3 Contains two novel genes, complete sequence Length = 155176 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 10966 cttcttcttcttcttcatcatc 10987
>gb|AC022880.10| Homo sapiens chromosome , clone RP11-436P7, complete sequence Length = 166306 Score = 44.1 bits (22), Expect = 0.74 Identities = 25/26 (96%) Strand = Plus / Plus Query: 444 agttgcttcttcttcttcttcatcat 469 |||| ||||||||||||||||||||| Sbjct: 136606 agtttcttcttcttcttcttcatcat 136631
>gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosome 12, complete sequence Length = 196540 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 110458 cttcttcttcttcttcatcatc 110437
>gb|BC097265.1| Rattus norvegicus thioredoxin domain containing 3 (spermatozoa), mRNA (cDNA clone IMAGE:7455991), complete cds Length = 1873 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 797 cttcttcttcttcttcatcatc 776
>gb|BT006248.1| Arabidopsis thaliana At1g11440 mRNA, complete cds Length = 1092 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 730 cttcttcttcttcttcatcatc 709
>ref|XM_651036.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (17.t00039) partial mRNA Length = 708 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 499 cttcttcttcttcttcatcatc 478
>dbj|AP006737.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT20F11, TM1687, complete sequence Length = 91649 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 26441 cttcttcttcttcttcatcatc 26462
>dbj|AP006736.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT45I15, TM1494, complete sequence Length = 114162 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 91443 cttcttcttcttcttcatcatc 91464
>gb|AC114533.17| Mus musculus chromosome 1, clone RP24-255G23, complete sequence Length = 147505 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 16459 cttcttcttcttcttcatcatc 16438
>gb|AY050347.1| Arabidopsis thaliana AT5g52200/F17P19_10 mRNA, complete cds Length = 780 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 447 tgcttcttcttcttcttcatca 468 |||||||||||||||||||||| Sbjct: 330 tgcttcttcttcttcttcatca 309
>emb|Z97336.1|ATFCA1 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 1 Length = 206606 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 88537 cttcttcttcttcttcatcatc 88558
>emb|Z73546.1|SCYPL190C S.cerevisiae chromosome XVI reading frame ORF YPL190c Length = 4474 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 2650 cttcttcttcttcttcatcatc 2671
>emb|X96770.1|SCLACHXVI S.cerevisiae chromosome XVI, left arm DNA Length = 55786 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 25477 cttcttcttcttcttcatcatc 25498 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 450 ttcttcttcttcttcatcatc 470 ||||||||||||||||||||| Sbjct: 25412 ttcttcttcttcttcatcatc 25432
>gb|AY088733.1| Arabidopsis thaliana clone 93530 mRNA, complete sequence Length = 1517 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 47 cttcttcttcttcttcatcatc 68
>gb|AY087263.1| Arabidopsis thaliana clone 33385 mRNA, complete sequence Length = 1065 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 826 cttcttcttcttcttcatcatc 805
>emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS767 of Debaryomyces hansenii Length = 1602771 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 1110683 cttcttcttcttcttcatcatc 1110704
>gb|AC133868.10| Mus musculus chromosome 15, clone RP24-430H1, complete sequence Length = 142534 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 64103 cttcttcttcttcttcatcatc 64124
>gb|AC155641.8| Mus musculus 10 BAC RP24-121N1 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 195480 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 154442 cttcttcttcttcttcatcatc 154463
>emb|AL929355.1|PFA929355 Plasmodium falciparum strain 3D7, chromosome 9; segment 1/5 Length = 330050 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 119292 cttcttcttcttcttcatcatc 119313 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcat 469 ||||||||||||||||||||| Sbjct: 119325 cttcttcttcttcttcatcat 119345 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcat 469 ||||||||||||||||||||| Sbjct: 119379 cttcttcttcttcttcatcat 119399
>emb|AL929354.1|PFA929354 Plasmodium falciparum strain 3D7, chromosome 5, segment 4/4 Length = 340552 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 298382 cttcttcttcttcttcatcatc 298403
>emb|AL596025.22| Mouse DNA sequence from clone RP23-215H18 on chromosome 11 Contains a novel gene and the 3' end of a gene that is a possible ortholog of human dynein axonemal heavy polypeptide 9 (DNAH9), complete sequence Length = 190066 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 96116 cttcttcttcttcttcatcatc 96137
>emb|AL646051.19| Mouse DNA sequence from clone RP23-222M22 on chromosome 11 Contains the 5' end of the Hs3st3a gene for heparan sulfate (glucosamine) 3-O-sulfotransferase 3A and a CpG island, complete sequence Length = 144847 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 23206 cttcttcttcttcttcatcatc 23185
>emb|AL161593.2|ATCHRIV89 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 89 Length = 199789 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 148876 cttcttcttcttcttcatcatc 148855
>emb|AL161577.2|ATCHRIV73 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 73 Length = 194862 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 63227 cttcttcttcttcttcatcatc 63206
>emb|AL161547.2|ATCHRIV47 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 47 Length = 198067 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 449 cttcttcttcttcttcatcatc 470 |||||||||||||||||||||| Sbjct: 127082 cttcttcttcttcttcatcatc 127061 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 111,025,661 Number of extensions: 7367565 Number of successful extensions: 836980 Number of sequences better than 10.0: 533 Number of HSP's gapped: 836645 Number of HSP's successfully gapped: 614 Length of query: 780 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 758 Effective length of database: 18,508,616,841 Effective search space: 14029531565478 Effective search space used: 14029531565478 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
