ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf44m18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 72 3e-09
2dbj|AP003634.3| Oryza sativa (japonica cultivar-group) genomic D... 72 3e-09
3gb|AC132373.4| Mus musculus BAC clone RP23-480H8 from 1, complet... 44 0.66
4gb|DQ057050.1| HIV-1 isolate CE158 from Cameroon gag protein (ga... 42 2.6
5gb|DQ056999.1| HIV-1 isolate LT24 from Cameroon gag protein (gag... 42 2.6
6gb|AY371131.1| HIV-1 isolate 01CM.0074NY from Cameroon gag prote... 42 2.6
7gb|AY371123.1| HIV-1 isolate 01CM.0005BBY from Cameroon gag prot... 42 2.6
8gb|AC125109.3| Mus musculus BAC clone RP24-232H5 from chromosome... 42 2.6
9gb|AC100773.2| Homo sapiens chromosome 11, clone RP11-960D24, co... 42 2.6
10gb|AC093652.5| Homo sapiens BAC clone RP11-379D15 from 4, comple... 42 2.6
11emb|BX294150.1| Rhodopirellula baltica SH 1 complete genome; seg... 42 2.6
12gb|AC154388.4| Mus musculus BAC clone RP23-14P7 from chromosome ... 42 2.6
13emb|CT010520.15| Mouse DNA sequence from clone RP23-349A19 on ch... 42 2.6
14gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, comple... 42 2.6
15gb|AC113035.21| Mus musculus chromosome 8, clone RP23-222J21, co... 42 2.6
16gb|AC161214.4| Mus musculus chromosome 8, clone RP23-78A10, comp... 42 2.6
17gb|AC116729.14| Mus musculus chromosome 3, clone RP23-346I1, com... 42 2.6

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6
          Length = 30731886
 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                            
Query: 277      ctgaacaagtcgagtcgacaaccccaggtcatagccctagcattggccataacagtccac 336
                |||||||||| || || || || ||||| ||||||||||||||||||||||||| ||| |
Sbjct: 29517657 ctgaacaagttgattcaaccactccaggccatagccctagcattggccataacactcctc 29517598

                            
Query: 337      caaactgagatg 348
                | ||||||||||
Sbjct: 29517597 ccaactgagatg 29517586



to top

>dbj|AP003634.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0655A07
          Length = 172473

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Minus

                                                                         
Query: 277   ctgaacaagtcgagtcgacaaccccaggtcatagccctagcattggccataacagtccac 336
             |||||||||| || || || || ||||| ||||||||||||||||||||||||| ||| |
Sbjct: 82163 ctgaacaagttgattcaaccactccaggccatagccctagcattggccataacactcctc 82104

                         
Query: 337   caaactgagatg 348
             | ||||||||||
Sbjct: 82103 ccaactgagatg 82092



to top

>gb|AC132373.4| Mus musculus BAC clone RP23-480H8 from 1, complete sequence
          Length = 192562

 Score = 44.1 bits (22), Expect = 0.66
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 146   tttcatgttgctgctcagtact 167
             ||||||||||||||||||||||
Sbjct: 47012 tttcatgttgctgctcagtact 47033



to top

>gb|DQ057050.1| HIV-1 isolate CE158 from Cameroon gag protein (gag) gene, partial
           cds
          Length = 448

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 175 tgcagcttcctgtgccagctg 195
           |||||||||||||||||||||
Sbjct: 396 tgcagcttcctgtgccagctg 376



to top

>gb|DQ056999.1| HIV-1 isolate LT24 from Cameroon gag protein (gag) gene, partial
           cds
          Length = 440

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 175 tgcagcttcctgtgccagctg 195
           |||||||||||||||||||||
Sbjct: 393 tgcagcttcctgtgccagctg 373



to top

>gb|AY371131.1| HIV-1 isolate 01CM.0074NY from Cameroon gag protein (gag) and pol
           protein (pol) genes, partial cds; vif protein (vif), vpr
           protein (vpr), tat protein (tat), rev protein (rev), vpu
           protein (vpu), and envelope glycoprotein (env) genes,
           complete cds; and nef protein (nef) gene, partial cds
          Length = 8405

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 175 tgcagcttcctgtgccagctg 195
           |||||||||||||||||||||
Sbjct: 370 tgcagcttcctgtgccagctg 350



to top

>gb|AY371123.1| HIV-1 isolate 01CM.0005BBY from Cameroon gag protein (gag) and pol
           protein (pol) genes, partial cds; vif protein (vif), vpr
           protein (vpr), tat protein (tat), rev protein (rev), vpu
           protein (vpu), and envelope glycoprotein (env) genes,
           complete cds; and nef protein (nef) gene, partial cds
          Length = 8377

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 175 tgcagcttcctgtgccagctg 195
           |||||||||||||||||||||
Sbjct: 370 tgcagcttcctgtgccagctg 350



to top

>gb|AC125109.3| Mus musculus BAC clone RP24-232H5 from chromosome 3, complete sequence
          Length = 165361

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 513    cttgtgcctgcatttctttca 533
              |||||||||||||||||||||
Sbjct: 157992 cttgtgcctgcatttctttca 157972



to top

>gb|AC100773.2| Homo sapiens chromosome 11, clone RP11-960D24, complete sequence
          Length = 199549

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 302   aggtcatagccctagcattggccat 326
             |||||||||||| ||||||||||||
Sbjct: 38996 aggtcatagccccagcattggccat 39020



to top

>gb|AC093652.5| Homo sapiens BAC clone RP11-379D15 from 4, complete sequence
          Length = 61340

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 550   ttttgcttaccattgtctctg 570
             |||||||||||||||||||||
Sbjct: 34183 ttttgcttaccattgtctctg 34203



to top

>emb|BX294150.1| Rhodopirellula baltica SH 1 complete genome; segment 18/24
          Length = 283050

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 374    aggactttgcagcttgggtat 394
              |||||||||||||||||||||
Sbjct: 151188 aggactttgcagcttgggtat 151168



to top

>gb|AC154388.4| Mus musculus BAC clone RP23-14P7 from chromosome 14, complete sequence
          Length = 246800

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 482   ttccctttaattttcttttgt 502
             |||||||||||||||||||||
Sbjct: 46308 ttccctttaattttcttttgt 46288



to top

>emb|CT010520.15| Mouse DNA sequence from clone RP23-349A19 on chromosome 14, complete
            sequence
          Length = 175582

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 482  ttccctttaattttcttttgt 502
            |||||||||||||||||||||
Sbjct: 6704 ttccctttaattttcttttgt 6724



to top

>gb|AC147562.5| Mus musculus BAC clone RP23-239A13 from 3, complete sequence
          Length = 167633

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 513   cttgtgcctgcatttctttca 533
             |||||||||||||||||||||
Sbjct: 11577 cttgtgcctgcatttctttca 11557



to top

>gb|AC113035.21| Mus musculus chromosome 8, clone RP23-222J21, complete sequence
          Length = 206554

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 513   cttgtgcctgcatttctttca 533
             |||||||||||||||||||||
Sbjct: 43140 cttgtgcctgcatttctttca 43160



to top

>gb|AC161214.4| Mus musculus chromosome 8, clone RP23-78A10, complete sequence
          Length = 182742

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 513   cttgtgcctgcatttctttca 533
             |||||||||||||||||||||
Sbjct: 91068 cttgtgcctgcatttctttca 91088



to top

>gb|AC116729.14| Mus musculus chromosome 3, clone RP23-346I1, complete sequence
          Length = 224088

 Score = 42.1 bits (21), Expect = 2.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 476   ttttgtttccctttaattttctttt 500
             |||| ||||||||||||||||||||
Sbjct: 54563 ttttttttccctttaattttctttt 54539


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 127,356,475
Number of extensions: 6448109
Number of successful extensions: 158722
Number of sequences better than 10.0: 17
Number of HSP's gapped: 158722
Number of HSP's successfully gapped: 17
Length of query: 694
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 672
Effective length of database: 18,508,616,841
Effective search space: 12437790517152
Effective search space used: 12437790517152
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top