ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf44l08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_001224085.1| Chaetomium globosum CBS 148.51 hypothetical ... 46 0.15
2ref|XM_001090549.1| PREDICTED: Macaca mulatta similar to NACHT, ... 42 2.4
3ref|XM_001090672.1| PREDICTED: Macaca mulatta similar to NACHT, ... 42 2.4
4gb|AC117453.7| Homo sapiens 3 BAC RP11-321N5 (Roswell Park Cance... 42 2.4
5emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete ... 42 2.4
6emb|BX640427.1| Bordetella parapertussis strain 12822, complete ... 42 2.4
7emb|BX640415.1| Bordetella pertussis strain Tohama I, complete g... 42 2.4
8gb|AY609520.1| Sus scrofa clone Clu_148790.scr.msk.p1.Contig3, m... 42 2.4
9emb|CT737333.5| Pig DNA sequence from clone CH242-133K23 on chro... 40 9.4
10gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete ge... 40 9.4
11emb|AL590842.1| Yersinia pestis CO92 complete genome 40 9.4
12gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete s... 40 9.4
13gb|AE017042.1| Yersinia pestis biovar Microtus str. 91001, compl... 40 9.4
14gb|DQ771734.1| Synthetic construct Yersinia pestis clone FLH0136... 40 9.4
15gb|CP000308.1| Yersinia pestis Antiqua, complete genome 40 9.4
16gb|CP000305.1| Yersinia pestis Nepal516, complete genome 40 9.4
17emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 40 9.4
18gb|AE009952.1| Yersinia pestis KIM, complete genome 40 9.4
19gb|AC175363.2| Pan troglodytes chromosome X clone CH251-7A1 map ... 40 9.4
20gb|AY674453.1| Euonymus alatus phytochrome gene, partial cds 40 9.4
21gb|AC121285.7| Mus musculus chromosome 3, clone RP23-437I18, com... 40 9.4
22gb|AF241734.2| Homo sapiens chromosome X clone RP1-34M10 map p11... 40 9.4
23gb|AC108881.3| Homo sapiens chromosome X clone RP11-21D3 map p11... 40 9.4
24gb|AC122556.15| Mus musculus chromosome 12, clone RP24-352D3, co... 40 9.4
25gb|AY425097.1| Denhamia celastroides PHYC (PHYC) gene, partial cds 40 9.4
26gb|AC147033.2| Pan troglodytes BAC clone RP43-99I5 from 7, compl... 40 9.4
27gb|AC136451.9| Medicago truncatula clone mth2-17d19, complete se... 40 9.4
28gb|AC010018.6| Drosophila melanogaster 3L BAC RP98-17M19 (Roswel... 40 9.4
29gb|AC091206.3| Drosophila melanogaster 3L BAC RP98-19M9 (Roswell... 40 9.4
30tpg|BK001904.1| TPA_inf: Drosophila melanogaster HDC08240 (HDC08... 40 9.4
31emb|Z97353.3|HS90L6 Human DNA sequence from clone RP1-90L6 on ch... 40 9.4
32emb|AL138760.14| Human DNA sequence from clone RP11-123B3 on chr... 40 9.4
33emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 40 9.4
34gb|AC019047.7| Homo sapiens BAC clone RP11-83N2 from 2, complete... 40 9.4
35gb|AY204752.1| Homo sapiens excision repair cross-complementing ... 40 9.4
36ref|XM_554483.1| Anopheles gambiae str. PEST ENSANGP00000028549 ... 40 9.4
37emb|AJ286667.1|WMI286667 Welwitschia mirabilis partial phyN gene... 40 9.4
38emb|Y07571.1|CRPHYINTR C.revoluta gene for phytochrome (intron) 40 9.4
39emb|AL670662.7| Human DNA sequence from clone XXbac-93B10 on chr... 40 9.4

>ref|XM_001224085.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_04872)
           mRNA, complete cds
          Length = 2097
 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 257 agataaaccggccagcttcgtgg 279
           |||||||||||||||||||||||
Sbjct: 723 agataaaccggccagcttcgtgg 745



to top

>ref|XM_001090549.1| PREDICTED: Macaca mulatta similar to NACHT, leucine rich repeat and
            PYD containing 13, transcript variant 1 (LOC703668), mRNA
          Length = 3532

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 553  tctccaattccatgttctacaactt 577
            ||||||||| |||||||||||||||
Sbjct: 1914 tctccaatttcatgttctacaactt 1938



to top

>ref|XM_001090672.1| PREDICTED: Macaca mulatta similar to NACHT, leucine rich repeat and
            PYD containing 13, transcript variant 2 (LOC703668), mRNA
          Length = 3135

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 553  tctccaattccatgttctacaactt 577
            ||||||||| |||||||||||||||
Sbjct: 1890 tctccaatttcatgttctacaactt 1914



to top

>gb|AC117453.7| Homo sapiens 3 BAC RP11-321N5 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 91001

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 549   atcttctccaattccatgttc 569
             |||||||||||||||||||||
Sbjct: 51521 atcttctccaattccatgttc 51541



to top

>emb|BX640444.1| Bordetella bronchiseptica strain RB50, complete genome; segment 8/16
          Length = 349008

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    acaccttgctgggcctgcgct 432
              |||||||||||||||||||||
Sbjct: 296078 acaccttgctgggcctgcgct 296098



to top

>emb|BX640427.1| Bordetella parapertussis strain 12822, complete genome; segment 5/14
          Length = 348997

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 412    acaccttgctgggcctgcgct 432
              |||||||||||||||||||||
Sbjct: 208404 acaccttgctgggcctgcgct 208424



to top

>emb|BX640415.1| Bordetella pertussis strain Tohama I, complete genome; segment 5/12
          Length = 347071

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 412   acaccttgctgggcctgcgct 432
             |||||||||||||||||||||
Sbjct: 71906 acaccttgctgggcctgcgct 71926



to top

>gb|AY609520.1| Sus scrofa clone Clu_148790.scr.msk.p1.Contig3, mRNA sequence
          Length = 1099

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 36  aggcatttgggcagtgaggag 56
           |||||||||||||||||||||
Sbjct: 642 aggcatttgggcagtgaggag 662



to top

>emb|CT737333.5| Pig DNA sequence from clone CH242-133K23 on chromosome 14, complete
              sequence
          Length = 188751

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 573    aacttctgcatgccacaagc 592
              ||||||||||||||||||||
Sbjct: 144363 aacttctgcatgccacaagc 144344



to top

>gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete genome
          Length = 6988209

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 213     gtgccgtccatccgcgcgat 232
               ||||||||||||||||||||
Sbjct: 5311211 gtgccgtccatccgcgcgat 5311192



to top

>emb|AL590842.1| Yersinia pestis CO92 complete genome
          Length = 4653728

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 562     ccatgttctacaacttctgc 581
               ||||||||||||||||||||
Sbjct: 2419219 ccatgttctacaacttctgc 2419200



to top

>gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete sequence
          Length = 24543557

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 33      cacaggcatttgggcagtga 52
               ||||||||||||||||||||
Sbjct: 3308041 cacaggcatttgggcagtga 3308060



to top

>gb|AE017042.1| Yersinia pestis biovar Microtus str. 91001, complete genome
          Length = 4595065

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 562     ccatgttctacaacttctgc 581
               ||||||||||||||||||||
Sbjct: 2168345 ccatgttctacaacttctgc 2168326



to top

>gb|DQ771734.1| Synthetic construct Yersinia pestis clone FLH0136316.01X y2171
           gene, complete sequence
          Length = 933

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 562 ccatgttctacaacttctgc 581
           ||||||||||||||||||||
Sbjct: 77  ccatgttctacaacttctgc 58



to top

>gb|CP000308.1| Yersinia pestis Antiqua, complete genome
          Length = 4702289

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 562     ccatgttctacaacttctgc 581
               ||||||||||||||||||||
Sbjct: 1691181 ccatgttctacaacttctgc 1691162



to top

>gb|CP000305.1| Yersinia pestis Nepal516, complete genome
          Length = 4534590

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 562     ccatgttctacaacttctgc 581
               ||||||||||||||||||||
Sbjct: 1827833 ccatgttctacaacttctgc 1827814



to top

>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence
          Length = 3716413

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 77      catctcgggcgactacgact 96
               ||||||||||||||||||||
Sbjct: 3532221 catctcgggcgactacgact 3532240



to top

>gb|AE009952.1| Yersinia pestis KIM, complete genome
          Length = 4600755

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 562     ccatgttctacaacttctgc 581
               ||||||||||||||||||||
Sbjct: 2400973 ccatgttctacaacttctgc 2400992



to top

>gb|AC175363.2| Pan troglodytes chromosome X clone CH251-7A1 map human ortholog p11.4,
             complete sequence
          Length = 221738

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    ggcatttgggcagtgaggag 56
             ||||||||||||||||||||
Sbjct: 43293 ggcatttgggcagtgaggag 43274



to top

>gb|AY674453.1| Euonymus alatus phytochrome gene, partial cds
          Length = 1173

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 300 tcctttgagatatgcctgtg 319
           ||||||||||||||||||||
Sbjct: 588 tcctttgagatatgcctgtg 607



to top

>gb|AC121285.7| Mus musculus chromosome 3, clone RP23-437I18, complete sequence
          Length = 190736

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 548    gatcttctccaattccatgt 567
              ||||||||||||||||||||
Sbjct: 160482 gatcttctccaattccatgt 160501



to top

>gb|AF241734.2| Homo sapiens chromosome X clone RP1-34M10 map p11.4, complete
            sequence
          Length = 119916

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 37   ggcatttgggcagtgaggag 56
            ||||||||||||||||||||
Sbjct: 1444 ggcatttgggcagtgaggag 1425



to top

>gb|AC108881.3| Homo sapiens chromosome X clone RP11-21D3 map p11.4, complete sequence
          Length = 163215

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    ggcatttgggcagtgaggag 56
             ||||||||||||||||||||
Sbjct: 85907 ggcatttgggcagtgaggag 85888



to top

>gb|AC122556.15| Mus musculus chromosome 12, clone RP24-352D3, complete sequence
          Length = 167088

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 245   cgtgaacatcggagataaac 264
             ||||||||||||||||||||
Sbjct: 97416 cgtgaacatcggagataaac 97397



to top

>gb|AY425097.1| Denhamia celastroides PHYC (PHYC) gene, partial cds
          Length = 1189

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 300 tcctttgagatatgcctgtg 319
           ||||||||||||||||||||
Sbjct: 603 tcctttgagatatgcctgtg 622



to top

>gb|AC147033.2| Pan troglodytes BAC clone RP43-99I5 from 7, complete sequence
          Length = 188305

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 548   gatcttctccaattccatgt 567
             ||||||||||||||||||||
Sbjct: 32357 gatcttctccaattccatgt 32338



to top

>gb|AC136451.9| Medicago truncatula clone mth2-17d19, complete sequence
          Length = 132473

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   tctacaacttctgcatgcca 587
             ||||||||||||||||||||
Sbjct: 23282 tctacaacttctgcatgcca 23263



to top

>gb|AC010018.6| Drosophila melanogaster 3L BAC RP98-17M19 (Roswell Park Cancer
             Institute Drosophila BAC Library) complete sequence
          Length = 172284

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 33    cacaggcatttgggcagtga 52
             ||||||||||||||||||||
Sbjct: 28097 cacaggcatttgggcagtga 28116



to top

>gb|AC091206.3| Drosophila melanogaster 3L BAC RP98-19M9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 178019

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 33    cacaggcatttgggcagtga 52
             ||||||||||||||||||||
Sbjct: 98112 cacaggcatttgggcagtga 98093



to top

>tpg|BK001904.1| TPA_inf: Drosophila melanogaster HDC08240 (HDC08240) gene, complete
           cds
          Length = 872

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 33  cacaggcatttgggcagtga 52
           ||||||||||||||||||||
Sbjct: 138 cacaggcatttgggcagtga 157



to top

>emb|Z97353.3|HS90L6 Human DNA sequence from clone RP1-90L6 on chromosome 22q11.21-11.23,
             complete sequence
          Length = 190837

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   aaggcgaagggaagctggtg 215
             ||||||||||||||||||||
Sbjct: 96542 aaggcgaagggaagctggtg 96523



to top

>emb|AL138760.14| Human DNA sequence from clone RP11-123B3 on chromosome 10 Contains the
              gene for a novel protein similar to rodent paired-like
              homeodomain trancription factor Drg11, a novel gene, the 3'
              end of the ERCC6 gene for excision repair
              cross-complementing rodent repair deficiency
              complementation group 6 and a CpG island, complete sequence
          Length = 173268

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 131    tgggtgggcctgtgcctacc 150
              ||||||||||||||||||||
Sbjct: 119957 tgggtgggcctgtgcctacc 119938



to top

>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 562     ccatgttctacaacttctgc 581
               ||||||||||||||||||||
Sbjct: 2446505 ccatgttctacaacttctgc 2446486



to top

>gb|AC019047.7| Homo sapiens BAC clone RP11-83N2 from 2, complete sequence
          Length = 165007

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 24    agaaacatccacaggcattt 43
             ||||||||||||||||||||
Sbjct: 61842 agaaacatccacaggcattt 61861



to top

>gb|AY204752.1| Homo sapiens excision repair cross-complementing rodent repair
             deficiency, complementation group 6 (ERCC6) gene, complete
             cds
          Length = 82019

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 131   tgggtgggcctgtgcctacc 150
             ||||||||||||||||||||
Sbjct: 58421 tgggtgggcctgtgcctacc 58440



to top

>ref|XM_554483.1| Anopheles gambiae str. PEST ENSANGP00000028549
           (ENSANGG00000022392), partial mRNA
          Length = 993

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 279 ggctcgcaggagtggattgg 298
           ||||||||||||||||||||
Sbjct: 314 ggctcgcaggagtggattgg 333



to top

>emb|AJ286667.1|WMI286667 Welwitschia mirabilis partial phyN gene for phytochrome
          Length = 576

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 300 tcctttgagatatgcctgtg 319
           ||||||||||||||||||||
Sbjct: 402 tcctttgagatatgcctgtg 421



to top

>emb|Y07571.1|CRPHYINTR C.revoluta gene for phytochrome (intron)
          Length = 569

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 300 tcctttgagatatgcctgtg 319
           ||||||||||||||||||||
Sbjct: 395 tcctttgagatatgcctgtg 414



to top

>emb|AL670662.7| Human DNA sequence from clone XXbac-93B10 on chromosome 6, complete
             sequence
          Length = 115723

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 37    ggcatttgggcagtgaggag 56
             ||||||||||||||||||||
Sbjct: 38378 ggcatttgggcagtgaggag 38359


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 92,032,931
Number of extensions: 4313214
Number of successful extensions: 77589
Number of sequences better than 10.0: 39
Number of HSP's gapped: 77589
Number of HSP's successfully gapped: 39
Length of query: 639
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 617
Effective length of database: 18,508,616,841
Effective search space: 11419816590897
Effective search space used: 11419816590897
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top