ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf44f08 |
|---|---|
| Clone Library Name | barley_pub |
>gb|DQ245655.1| Zea mays clone 18835 mRNA sequence Length = 780 Score = 1233 bits (622), Expect = 0.0 Identities = 716/745 (96%), Gaps = 3/745 (0%) Strand = Plus / Plus Query: 20 cttaccaaactccggctcccaacacccaaagcctccgcatccagagctccaaaccctaag 79 ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| | Sbjct: 1 cttaccaaactccggctcccaacgcccaaagccttcgcatccagagctccaaaccctagg 60 Query: 80 cgaggcgaggcgcggcgc-gcagagggagaggcaatggatcccgattcggtgtcgaaggc 138 |||||||||||||||||| || ||||||||||| ||||||||||||||||| |||||||| Sbjct: 61 cgaggcgaggcgcggcgcagcggagggagaggccatggatcccgattcggtctcgaaggc 120 Query: 139 cttcgttcagcactactaccagacgttcgactccaaccgcgccgcgctggtggggctgta 198 ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 121 gttcgtgcagcactactaccagacgttcgactccaaccgcgccgcgctggtggggctgta 180 Query: 199 ccaggacggctccatgctcaccttcgagggcgagaagttcggcggccccgccgccatcgc 258 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 181 ccaggacggctccatgctcaccttcgagggcgagaagttcggcggccccgccgccatcgc 240 Query: 259 tggcaagctcggatctctccccttccagcagtgccagcacaagatcgataccgtcgactg 318 ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 241 cggcaagctcggatctctccccttccagcagtgccagcacaagatcgacaccgtcgactg 300 Query: 319 ccagccctcggggccccagggcggcgtcctcgtcttcgtctccggcaccatcaccaccgg 378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 301 ccagccctcggggccccagggcggcgtcctcgtcttcgtctccggcaccatcaccaccgg 360 Query: 379 ccccggcgagcaccccctcaagttctcacagatgttccatttgctgccagctggagggag 438 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 361 ccccggcgagcaccccctcaagttctcacagatgttccatttgctgccagctggagggag 420 Query: 439 cttctacgtgcagaatgacaagttccgcctgaactatggttaaggaagggcggccactct 498 |||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||| Sbjct: 421 cttctacgtgcagaatgacatgttccgcctgaactatggttaaggaagggcgaccgctct 480 Query: 499 ggcagcaaagaacttgatcagggatttatgttgaaacaatgaatatcgaatgatgatgct 558 |||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||| Sbjct: 481 ggcagcaaagaacttgttcagggatttatgttgaaacaatgaacatcaaatgatgatgct 540 Query: 559 gcaga--ctttgtttgtttgccaacttgtgcaatttattgcaaaaaatggccagacttga 616 ||||| ||||||||||| ||||||||||||||||||| ||||||||| ||||||||||| Sbjct: 541 gcagactctttgtttgttcgccaacttgtgcaatttatcgcaaaaaattgccagacttga 600 Query: 617 taggcatccaccagatcatcttttgttttgtgttttccatgtattgtcgttgcttgggta 676 ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 601 taggcatccaccagatcatcttttgttttgtgtttcccatgtattgtcgttgcttgggtg 660 Query: 677 gcactttctttggaatgttgatggaaaccgtcctggtattagttatgcgtggcatctctg 736 ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| Sbjct: 661 gcactttctttggaatgttgatggaaaccgtccaggtactagttatgcgtggcatctctg 720 Query: 737 ggtttgttttgtgacgatttaagtt 761 ||||| |||||||| ||||||||| Sbjct: 721 ggttttgtttgtgaccatttaagtt 745
>emb|CT833132.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA042E19, full insert sequence Length = 674 Score = 317 bits (160), Expect = 3e-83 Identities = 310/360 (86%) Strand = Plus / Plus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| ||||||| ||||| |||||||||||| |||||||||| | ||||| | |||| Sbjct: 89 cggtggcgaaggcgttcgtggagcactactaccggacgttcgacacgaaccggccggcgc 148 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||| ||||||||||||||| ||||||||||||||||||||| || |||| |||| Sbjct: 149 tggtgtcgctgtaccaggacgggtccatgctcaccttcgagggccagcagtttctcggcg 208 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 ||||||||||||| ||||||||||| || ||||||||| ||||||||| ||| | ||| Sbjct: 209 ccgccgccatcgccggcaagctcggctccctccccttcgcgcagtgccaccacgacatca 268 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 | ||||||||||||||||| |||||||| ||||||||| | ||||||||||||||||| Sbjct: 269 acaccgtcgactgccagccgtcggggccgcagggcggcatgctcgtcttcgtctccggat 328 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgc 425 || || ||||||||||| ||||||||||||||||||||| ||||||||||| |||| | Sbjct: 329 ccctccgcaccggccccgacgagcaccccctcaagttctcccagatgttccagctgcttc 388 Query: 426 cagctggagggagcttctacgtgcagaatgacaagttccgcctgaactatggttaaggaa 485 | |||||||| | |||||| |||||||| |||| |||||| ||||||||||||||||||| Sbjct: 389 ccgctggaggcaacttctatgtgcagaacgacatgttccgtctgaactatggttaaggaa 448
>ref|NM_001068873.1| Oryza sativa (japonica cultivar-group) Os08g0532300 (Os08g0532300) mRNA, complete cds Length = 672 Score = 317 bits (160), Expect = 3e-83 Identities = 310/360 (86%) Strand = Plus / Plus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| ||||||| ||||| |||||||||||| |||||||||| | ||||| | |||| Sbjct: 88 cggtggcgaaggcgttcgtggagcactactaccggacgttcgacacgaaccggccggcgc 147 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||| ||||||||||||||| ||||||||||||||||||||| || |||| |||| Sbjct: 148 tggtgtcgctgtaccaggacgggtccatgctcaccttcgagggccagcagtttctcggcg 207 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 ||||||||||||| ||||||||||| || ||||||||| ||||||||| ||| | ||| Sbjct: 208 ccgccgccatcgccggcaagctcggctccctccccttcgcgcagtgccaccacgacatca 267 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 | ||||||||||||||||| |||||||| ||||||||| | ||||||||||||||||| Sbjct: 268 acaccgtcgactgccagccgtcggggccgcagggcggcatgctcgtcttcgtctccggat 327 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgc 425 || || ||||||||||| ||||||||||||||||||||| ||||||||||| |||| | Sbjct: 328 ccctccgcaccggccccgacgagcaccccctcaagttctcccagatgttccagctgcttc 387 Query: 426 cagctggagggagcttctacgtgcagaatgacaagttccgcctgaactatggttaaggaa 485 | |||||||| | |||||| |||||||| |||| |||||| ||||||||||||||||||| Sbjct: 388 ccgctggaggcaacttctatgtgcagaacgacatgttccgtctgaactatggttaaggaa 447
>dbj|AK119730.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-H12, full insert sequence Length = 672 Score = 317 bits (160), Expect = 3e-83 Identities = 310/360 (86%) Strand = Plus / Plus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| ||||||| ||||| |||||||||||| |||||||||| | ||||| | |||| Sbjct: 88 cggtggcgaaggcgttcgtggagcactactaccggacgttcgacacgaaccggccggcgc 147 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||| ||||||||||||||| ||||||||||||||||||||| || |||| |||| Sbjct: 148 tggtgtcgctgtaccaggacgggtccatgctcaccttcgagggccagcagtttctcggcg 207 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 ||||||||||||| ||||||||||| || ||||||||| ||||||||| ||| | ||| Sbjct: 208 ccgccgccatcgccggcaagctcggctccctccccttcgcgcagtgccaccacgacatca 267 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 | ||||||||||||||||| |||||||| ||||||||| | ||||||||||||||||| Sbjct: 268 acaccgtcgactgccagccgtcggggccgcagggcggcatgctcgtcttcgtctccggat 327 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgc 425 || || ||||||||||| ||||||||||||||||||||| ||||||||||| |||| | Sbjct: 328 ccctccgcaccggccccgacgagcaccccctcaagttctcccagatgttccagctgcttc 387 Query: 426 cagctggagggagcttctacgtgcagaatgacaagttccgcctgaactatggttaaggaa 485 | |||||||| | |||||| |||||||| |||| |||||| ||||||||||||||||||| Sbjct: 388 ccgctggaggcaacttctatgtgcagaacgacatgttccgtctgaactatggttaaggaa 447
>dbj|AK065141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002A14, full insert sequence Length = 671 Score = 317 bits (160), Expect = 3e-83 Identities = 310/360 (86%) Strand = Plus / Plus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| ||||||| ||||| |||||||||||| |||||||||| | ||||| | |||| Sbjct: 87 cggtggcgaaggcgttcgtggagcactactaccggacgttcgacacgaaccggccggcgc 146 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||| ||||||||||||||| ||||||||||||||||||||| || |||| |||| Sbjct: 147 tggtgtcgctgtaccaggacgggtccatgctcaccttcgagggccagcagtttctcggcg 206 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 ||||||||||||| ||||||||||| || ||||||||| ||||||||| ||| | ||| Sbjct: 207 ccgccgccatcgccggcaagctcggctccctccccttcgcgcagtgccaccacgacatca 266 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 | ||||||||||||||||| |||||||| ||||||||| | ||||||||||||||||| Sbjct: 267 acaccgtcgactgccagccgtcggggccgcagggcggcatgctcgtcttcgtctccggat 326 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgc 425 || || ||||||||||| ||||||||||||||||||||| ||||||||||| |||| | Sbjct: 327 ccctccgcaccggccccgacgagcaccccctcaagttctcccagatgttccagctgcttc 386 Query: 426 cagctggagggagcttctacgtgcagaatgacaagttccgcctgaactatggttaaggaa 485 | |||||||| | |||||| |||||||| |||| |||||| ||||||||||||||||||| Sbjct: 387 ccgctggaggcaacttctatgtgcagaacgacatgttccgtctgaactatggttaaggaa 446
>dbj|AB011262.1| Oryza sativa (japonica cultivar-group) mRNA for nuclear transport factor 2 (NTF2), complete cds Length = 661 Score = 317 bits (160), Expect = 3e-83 Identities = 310/360 (86%) Strand = Plus / Plus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| ||||||| ||||| |||||||||||| |||||||||| | ||||| | |||| Sbjct: 77 cggtggcgaaggcgttcgtggagcactactaccggacgttcgacacgaaccggccggcgc 136 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||| ||||||||||||||| ||||||||||||||||||||| || |||| |||| Sbjct: 137 tggtgtcgctgtaccaggacgggtccatgctcaccttcgagggccagcagtttctcggcg 196 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 ||||||||||||| ||||||||||| || ||||||||| ||||||||| ||| | ||| Sbjct: 197 ccgccgccatcgccggcaagctcggctccctccccttcgcgcagtgccaccacgacatca 256 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 | ||||||||||||||||| |||||||| ||||||||| | ||||||||||||||||| Sbjct: 257 acaccgtcgactgccagccgtcggggccgcagggcggcatgctcgtcttcgtctccggat 316 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgc 425 || || ||||||||||| ||||||||||||||||||||| ||||||||||| |||| | Sbjct: 317 ccctccgcaccggccccgacgagcaccccctcaagttctcccagatgttccagctgcttc 376 Query: 426 cagctggagggagcttctacgtgcagaatgacaagttccgcctgaactatggttaaggaa 485 | |||||||| | |||||| |||||||| |||| |||||| ||||||||||||||||||| Sbjct: 377 ccgctggaggcaacttctatgtgcagaacgacatgttccgtctgaactatggttaaggaa 436
>gb|BT016844.1| Zea mays clone Contig677 mRNA sequence Length = 683 Score = 293 bits (148), Expect = 5e-76 Identities = 301/352 (85%) Strand = Plus / Minus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| |||| |||||||| |||||||||||| |||||||||| |||||||||| |||| Sbjct: 595 cggtggcgaaagccttcgtggagcactactaccggacgttcgacaccaaccgcgcggcgc 536 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||||||||||| ||||| |||||||||||||||||||||| |||||||| |||| Sbjct: 535 tggtggggctgtatcaggagacctccatgctcaccttcgagggccagaagttccagggcc 476 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 | ||||||| || ||||||||||||||||| ||||||||| ||| ||||| |||||| Sbjct: 475 catccgccattgccggcaagctcggatctcttcccttccaggcctgcgagcaccagatcg 416 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 ||||| ||||||||||| |||||||||||||| ||| | ||||||||||||||||| Sbjct: 415 tcaccgtagactgccagccgtcggggccccagggaggcatgctcgtcttcgtctccggtt 356 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgc 425 ||||| ||||||||||| ||||||||| |||||||||| ||| ||||||||||||| Sbjct: 355 ccatccgcaccggccccgaggagcaccccatcaagttctctcaggcattccatttgctgc 296 Query: 426 cagctggagggagcttctacgtgcagaatgacaagttccgcctgaactatgg 477 | || | ||| ||||| |||||||||||||| |||||||||||||||||| Sbjct: 295 cggcagctgggtccttcttcgtgcagaatgacatgttccgcctgaactatgg 244
>gb|AY103892.1| Zea mays PCO098900 mRNA sequence Length = 855 Score = 293 bits (148), Expect = 5e-76 Identities = 301/352 (85%) Strand = Plus / Plus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| |||| |||||||| |||||||||||| |||||||||| |||||||||| |||| Sbjct: 188 cggtggcgaaagccttcgtggagcactactaccggacgttcgacaccaaccgcgcggcgc 247 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||||||||||| ||||| |||||||||||||||||||||| |||||||| |||| Sbjct: 248 tggtggggctgtatcaggagacctccatgctcaccttcgagggccagaagttccagggcc 307 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 | ||||||| || ||||||||||||||||| ||||||||| ||| ||||| |||| | Sbjct: 308 catccgccattgccggcaagctcggatctcttcccttccaggcctgcgagcaccagattg 367 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 ||||||||||||||||| |||||||||||||| ||| | ||||||||||||||||| Sbjct: 368 tcaccgtcgactgccagccgtcggggccccagggaggcatgctcgtcttcgtctccggtt 427 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgc 425 ||||| ||||||||||| ||||||||| |||||||||| ||| ||||||||||||| Sbjct: 428 ccatccgcaccggccccgaggagcaccccatcaagttctctcaggcattccatttgctgc 487 Query: 426 cagctggagggagcttctacgtgcagaatgacaagttccgcctgaactatgg 477 | || | ||| ||||| |||||||||||||| |||||||||||||||||| Sbjct: 488 cggcagctgggtccttcttcgtgcagaatgacatgttccgcctgaactatgg 539
>gb|DQ244921.1| Zea mays clone 11804 mRNA sequence Length = 638 Score = 266 bits (134), Expect = 1e-67 Identities = 293/346 (84%) Strand = Plus / Plus Query: 132 cgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgctggtgg 191 ||||||||||||| |||| ||||||| ||||||||| |||||||||| |||||||| | Sbjct: 108 cgaaggccttcgtggagcattactaccgaacgttcgacaccaaccgcgcggcgctggttg 167 Query: 192 ggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggccccgccg 251 ||||||||||||| |||||||||||||||||||||| |||||||| ||||| ||| Sbjct: 168 ggctgtaccaggagacctccatgctcaccttcgagggccagaagttccagggcccgtccg 227 Query: 252 ccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcgataccg 311 |||| || |||||||||||||||||||| |||||| ||| |||| |||||| |||| Sbjct: 228 ccattgccggcaagctcggatctctccctttccaggcctgcgagcatcagatcgtcaccg 287 Query: 312 tcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggcaccatca 371 ||||||||||||| ||||| |||||||| ||| | ||||||||||||||||| |||| Sbjct: 288 tcgactgccagccatcgggtccccagggaggcatgctcgtcttcgtctccggttccatac 347 Query: 372 ccaccggccccggcgagcaccccctcaagttctcacagatgttccatttgctgccagctg 431 ||||||||||| ||||||||| |||||||||| ||| |||||||||||||| || | Sbjct: 348 gcaccggccccgaggagcaccccatcaagttctcccaggcattccatttgctgccggccg 407 Query: 432 gagggagcttctacgtgcagaatgacaagttccgcctgaactatgg 477 ||| ||||| |||||||||||||| |||||||||||||||||| Sbjct: 408 ctgggtccttcttcgtgcagaatgacatgttccgcctgaactatgg 453
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8 Length = 28434780 Score = 246 bits (124), Expect = 1e-61 Identities = 241/280 (86%) Strand = Plus / Minus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| ||||||| ||||| |||||||||||| |||||||||| | ||||| | |||| Sbjct: 26529973 cggtggcgaaggcgttcgtggagcactactaccggacgttcgacacgaaccggccggcgc 26529914 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||| ||||||||||||||| ||||||||||||||||||||| || |||| |||| Sbjct: 26529913 tggtgtcgctgtaccaggacgggtccatgctcaccttcgagggccagcagtttctcggcg 26529854 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 ||||||||||||| ||||||||||| || ||||||||| ||||||||| ||| | ||| Sbjct: 26529853 ccgccgccatcgccggcaagctcggctccctccccttcgcgcagtgccaccacgacatca 26529794 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 | ||||||||||||||||| |||||||| ||||||||| | ||||||||||||||||| Sbjct: 26529793 acaccgtcgactgccagccgtcggggccgcagggcggcatgctcgtcttcgtctccggat 26529734 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctc 405 || || ||||||||||| ||||||||||||||||||||| Sbjct: 26529733 ccctccgcaccggccccgacgagcaccccctcaagttctc 26529694 Score = 79.8 bits (40), Expect = 1e-11 Identities = 70/80 (87%) Strand = Plus / Minus Query: 406 acagatgttccatttgctgccagctggagggagcttctacgtgcagaatgacaagttccg 465 |||||||||||| |||| || |||||||| | |||||| |||||||| |||| |||||| Sbjct: 26528283 acagatgttccagctgcttcccgctggaggcaacttctatgtgcagaacgacatgttccg 26528224 Query: 466 cctgaactatggttaaggaa 485 ||||||||||||||||||| Sbjct: 26528223 tctgaactatggttaaggaa 26528204
>dbj|AP005529.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0702E04 Length = 190948 Score = 246 bits (124), Expect = 1e-61 Identities = 241/280 (86%) Strand = Plus / Minus Query: 126 cggtgtcgaaggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgc 185 ||||| ||||||| ||||| |||||||||||| |||||||||| | ||||| | |||| Sbjct: 78840 cggtggcgaaggcgttcgtggagcactactaccggacgttcgacacgaaccggccggcgc 78781 Query: 186 tggtggggctgtaccaggacggctccatgctcaccttcgagggcgagaagttcggcggcc 245 ||||| ||||||||||||||| ||||||||||||||||||||| || |||| |||| Sbjct: 78780 tggtgtcgctgtaccaggacgggtccatgctcaccttcgagggccagcagtttctcggcg 78721 Query: 246 ccgccgccatcgctggcaagctcggatctctccccttccagcagtgccagcacaagatcg 305 ||||||||||||| ||||||||||| || ||||||||| ||||||||| ||| | ||| Sbjct: 78720 ccgccgccatcgccggcaagctcggctccctccccttcgcgcagtgccaccacgacatca 78661 Query: 306 ataccgtcgactgccagccctcggggccccagggcggcgtcctcgtcttcgtctccggca 365 | ||||||||||||||||| |||||||| ||||||||| | ||||||||||||||||| Sbjct: 78660 acaccgtcgactgccagccgtcggggccgcagggcggcatgctcgtcttcgtctccggat 78601 Query: 366 ccatcaccaccggccccggcgagcaccccctcaagttctc 405 || || ||||||||||| ||||||||||||||||||||| Sbjct: 78600 ccctccgcaccggccccgacgagcaccccctcaagttctc 78561 Score = 79.8 bits (40), Expect = 1e-11 Identities = 70/80 (87%) Strand = Plus / Minus Query: 406 acagatgttccatttgctgccagctggagggagcttctacgtgcagaatgacaagttccg 465 |||||||||||| |||| || |||||||| | |||||| |||||||| |||| |||||| Sbjct: 77150 acagatgttccagctgcttcccgctggaggcaacttctatgtgcagaacgacatgttccg 77091 Query: 466 cctgaactatggttaaggaa 485 ||||||||||||||||||| Sbjct: 77090 tctgaactatggttaaggaa 77071
>gb|DQ427497.1| Sorghum propinquum locus CSU608 genomic sequence Length = 676 Score = 210 bits (106), Expect = 6e-51 Identities = 166/186 (89%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcggggccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427496.1| Sorghum bicolor voucher PI585454 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427495.1| Sorghum bicolor voucher PI267539b locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427494.1| Sorghum bicolor voucher PI267539a locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427493.1| Sorghum bicolor voucher PI267408 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427492.1| Sorghum bicolor voucher PI221607 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427491.1| Sorghum bicolor voucher PI152702 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427490.1| Sorghum bicolor voucher NSL92371 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427489.1| Sorghum bicolor voucher NSL87902 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427488.1| Sorghum bicolor voucher NSL87666 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427487.1| Sorghum bicolor voucher NSL77217 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427486.1| Sorghum bicolor voucher NSL77034 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427485.1| Sorghum bicolor voucher NSL56174 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427484.1| Sorghum bicolor voucher NSL56003 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427483.1| Sorghum bicolor voucher NSL55243 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427482.1| Sorghum bicolor voucher NSL51365 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427481.1| Sorghum bicolor voucher NSL51030 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427480.1| Sorghum bicolor voucher NSL50875 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>gb|DQ427479.1| Sorghum bicolor voucher BTx623 locus CSU608 genomic sequence Length = 679 Score = 202 bits (102), Expect = 1e-48 Identities = 165/186 (88%) Strand = Plus / Plus Query: 220 cttcgagggcgagaagttcggcggccccgccgccatcgctggcaagctcggatctctccc 279 |||||||||| | |||||| |||||||||||||| || |||||||||||||||||||| Sbjct: 1 cttcgagggccataagttccagggccccgccgccattgccggcaagctcggatctctccc 60 Query: 280 cttccagcagtgccagcacaagatcgataccgtcgactgccagccctcggggccccaggg 339 ||||||| ||||||||||||||||| ||||||||||||||||| ||||| |||||||| Sbjct: 61 cttccaggcctgccagcacaagatcgacaccgtcgactgccagccgtcgggaccccaggg 120 Query: 340 cggcgtcctcgtcttcgtctccggcaccatcaccaccggccccggcgagcaccccctcaa 399 ||||| |||||||||||||||||| ||||| ||||||||||| || ||||||||||| Sbjct: 121 aggcgtgctcgtcttcgtctccggctccatccgcaccggccccgaggatcaccccctcaa 180 Query: 400 gttctc 405 |||||| Sbjct: 181 gttctc 186
>emb|CT980280.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 721 Score = 91.7 bits (46), Expect = 4e-15 Identities = 133/162 (82%) Strand = Plus / Plus Query: 197 taccaggacggctccatgctcaccttcgagggcgagaagttcggcggccccgccgccatc 256 |||||||| |||||||||||||||||||||||| ||||| || ||| || || |||| Sbjct: 164 taccaggagggctccatgctcaccttcgagggccagaagatccagggctcccccagcatc 223 Query: 257 gctggcaagctcggatctctccccttccagcagtgccagcacaagatcgataccgtcgac 316 | | ||||||| || ||||||||||||||||||||||||| ||| ||||||||| Sbjct: 224 gtcgccaagctcacctccctccccttccagcagtgccagcacagcatcaccaccgtcgac 283 Query: 317 tgccagccctcggggccccagggcggcgtcctcgtcttcgtc 358 ||||||||||| || ||| |||||| | |||||||||||| Sbjct: 284 tgccagccctccggccccgccggcggcatgctcgtcttcgtc 325
>ref|NM_001051014.1| Oryza sativa (japonica cultivar-group) Os01g0788200 (Os01g0788200) mRNA, complete cds Length = 750 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 136 ggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgct 186 ||||||||| || |||||||||||||||||||| |||||||||||||||| Sbjct: 167 ggccttcgtggagtactactaccagacgttcgacaccaaccgcgccgcgct 217
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 136 ggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgct 186 ||||||||| || |||||||||||||||||||| |||||||||||||||| Sbjct: 33441820 ggccttcgtggagtactactaccagacgttcgacaccaaccgcgccgcgct 33441870
>dbj|AP003345.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0415A04 Length = 160669 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 136 ggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgct 186 ||||||||| || |||||||||||||||||||| |||||||||||||||| Sbjct: 117986 ggccttcgtggagtactactaccagacgttcgacaccaaccgcgccgcgct 118036
>dbj|AK098941.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013046E12, full insert sequence Length = 729 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 136 ggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgct 186 ||||||||| || |||||||||||||||||||| |||||||||||||||| Sbjct: 166 ggccttcgtggagtactactaccagacgttcgacaccaaccgcgccgcgct 216
>dbj|AK073030.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023144D17, full insert sequence Length = 754 Score = 69.9 bits (35), Expect = 1e-08 Identities = 47/51 (92%) Strand = Plus / Plus Query: 136 ggccttcgttcagcactactaccagacgttcgactccaaccgcgccgcgct 186 ||||||||| || |||||||||||||||||||| |||||||||||||||| Sbjct: 171 ggccttcgtggagtactactaccagacgttcgacaccaaccgcgccgcgct 221
>gb|AC189194.1| Brassica rapa subsp. pekinensis clone KBrB003O07, complete sequence Length = 94092 Score = 56.0 bits (28), Expect = 2e-04 Identities = 94/116 (81%) Strand = Plus / Plus Query: 113 atggatcccgattcggtgtcgaaggccttcgttcagcactactaccagacgttcgactcc 172 |||||||||||| | ||| ||||||||||||| ||||||||||| ||| |||||| | Sbjct: 68174 atggatcccgatgccgtggcgaaggccttcgtcgagcactactactcgaccttcgacaac 68233 Query: 173 aaccgcgccgcgctggtggggctgtaccaggacggctccatgctcaccttcgaggg 228 ||||||| || || | || || |||||||| | |||||||| ||||||||||| Sbjct: 68234 aaccgcgtcggcctcgccggtctctaccaggaagcttccatgctgaccttcgaggg 68289 Score = 50.1 bits (25), Expect = 0.012 Identities = 46/53 (86%) Strand = Plus / Plus Query: 272 tctctccccttccagcagtgccagcacaagatcgataccgtcgactgccagcc 324 |||||||| |||||||||||| ||||||| ||| ||||||||||| ||||| Sbjct: 68333 tctctccctttccagcagtgcaagcacaacatctccaccgtcgactgtcagcc 68385
>ref|XM_001213756.1| Aspergillus terreus NIH2624 nuclear transport factor 2 (ATEG_04578) mRNA, complete cds Length = 375 Score = 46.1 bits (23), Expect = 0.19 Identities = 26/27 (96%) Strand = Plus / Plus Query: 151 ctactaccagacgttcgactccaaccg 177 ||||||||||||||||||||| ||||| Sbjct: 42 ctactaccagacgttcgactcgaaccg 68
>gb|AY106921.1| Zea mays PCO069699 mRNA sequence Length = 785 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 340 cggcgtcctcgtcttcgtctccg 362 ||||||||||||||||||||||| Sbjct: 576 cggcgtcctcgtcttcgtctccg 598
>gb|AY705500.1| Coffea canephora x Coffea congensis microsatellite CofEST-SSR05 sequence Length = 733 Score = 44.1 bits (22), Expect = 0.74 Identities = 28/30 (93%) Strand = Plus / Plus Query: 275 ctccccttccagcagtgccagcacaagatc 304 |||||||||||||||||||| ||| ||||| Sbjct: 276 ctccccttccagcagtgccaccaccagatc 305
>gb|AC122392.3| Mus musculus BAC clone RP24-81I14 from chromosome 16, complete sequence Length = 195550 Score = 44.1 bits (22), Expect = 0.74 Identities = 25/26 (96%) Strand = Plus / Minus Query: 631 atcatcttttgttttgtgttttccat 656 ||||||||||||||||||| |||||| Sbjct: 115845 atcatcttttgttttgtgtgttccat 115820
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6 Length = 30731886 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 79 gcgaggcgaggcgcggcgcgca 100 |||||||||||||||||||||| Sbjct: 17766041 gcgaggcgaggcgcggcgcgca 17766062
>emb|CR847979.6| Zebrafish DNA sequence from clone CH211-195H14 in linkage group 15, complete sequence Length = 117096 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 637 ttttgttttgtgttttccatgt 658 |||||||||||||||||||||| Sbjct: 47885 ttttgttttgtgttttccatgt 47906
>emb|AL939104.1|SCO939104 Streptomyces coelicolor A3(2) complete genome; segment 1/29 Length = 299050 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 358 ctccggcaccatcaccaccggc 379 |||||||||||||||||||||| Sbjct: 88048 ctccggcaccatcaccaccggc 88027
>emb|CR860388.1| Pongo pygmaeus mRNA; cDNA DKFZp459A0512 (from clone DKFZp459A0512) Length = 2098 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Minus Query: 31 ccggctcccaacacccaaagcc 52 |||||||||||||||||||||| Sbjct: 56 ccggctcccaacacccaaagcc 35
>dbj|AP004743.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBb0026G06 Length = 123129 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 79 gcgaggcgaggcgcggcgcgca 100 |||||||||||||||||||||| Sbjct: 36463 gcgaggcgaggcgcggcgcgca 36484
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 44.1 bits (22), Expect = 0.74 Identities = 25/26 (96%) Strand = Plus / Plus Query: 163 gttcgactccaaccgcgccgcgctgg 188 ||||||||||| |||||||||||||| Sbjct: 1936865 gttcgactccacccgcgccgcgctgg 1936890
>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence Length = 2648638 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 326 tcggggccccagggcggcgtcc 347 |||||||||||||||||||||| Sbjct: 2162259 tcggggccccagggcggcgtcc 2162280
>gb|AY857192.1| Uncultured bacterium clone xyl1 xylanase gene, partial cds Length = 432 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 358 ctccggcaccatcaccaccggc 379 |||||||||||||||||||||| Sbjct: 393 ctccggcaccatcaccaccggc 414
>gb|M64553.1|STMXLNC Streptomyces lividans xylanase C (xlnC) gene, complete cds Length = 1008 Score = 44.1 bits (22), Expect = 0.74 Identities = 22/22 (100%) Strand = Plus / Plus Query: 358 ctccggcaccatcaccaccggc 379 |||||||||||||||||||||| Sbjct: 795 ctccggcaccatcaccaccggc 816
>gb|CP000325.1| Mycobacterium ulcerans Agy99, complete genome Length = 5631606 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 367 catcaccaccggccccggcga 387 ||||||||||||||||||||| Sbjct: 3385749 catcaccaccggccccggcga 3385769
>gb|CP000463.1| Rhodopseudomonas palustris BisA53, complete genome Length = 5505494 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 348 tcgtcttcgtctccggcacca 368 ||||||||||||||||||||| Sbjct: 5379409 tcgtcttcgtctccggcacca 5379389
>ref|NM_001062736.1| Oryza sativa (japonica cultivar-group) Os05g0543100 (Os05g0543100) mRNA, complete cds Length = 1898 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 agcgaggcgaggcgcggcgcg 98 ||||||||||||||||||||| Sbjct: 45 agcgaggcgaggcgcggcgcg 25
>gb|CP000394.1| Granulibacter bethesdensis CGDNIH1, complete genome Length = 2708355 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 614 tgataggcatccaccagatca 634 ||||||||||||||||||||| Sbjct: 70197 tgataggcatccaccagatca 70177
>gb|CP000434.1| Rhodococcus sp. RHA1 plasmid pRHL3, complete sequence Length = 332361 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 360 ccggcaccatcaccaccggcc 380 ||||||||||||||||||||| Sbjct: 212105 ccggcaccatcaccaccggcc 212125
>emb|CR749741.13| Zebrafish DNA sequence from clone DKEY-86K10 in linkage group 12, complete sequence Length = 215743 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 642 ttttgtgttttccatgtattg 662 ||||||||||||||||||||| Sbjct: 179590 ttttgtgttttccatgtattg 179610
>emb|CR848731.9| Zebrafish DNA sequence from clone DKEY-201I2 in linkage group 12, complete sequence Length = 129565 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 642 ttttgtgttttccatgtattg 662 ||||||||||||||||||||| Sbjct: 62107 ttttgtgttttccatgtattg 62087
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 348 tcgtcttcgtctccggcacca 368 ||||||||||||||||||||| Sbjct: 957902 tcgtcttcgtctccggcacca 957882
>gb|AC098833.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1288_A07, complete sequence Length = 122120 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 agcgaggcgaggcgcggcgcg 98 ||||||||||||||||||||| Sbjct: 31015 agcgaggcgaggcgcggcgcg 31035
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome Length = 5751492 Score = 42.1 bits (21), Expect = 2.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 639 ttgttttgtgttttccatgtattgt 663 |||||||||||||||||| |||||| Sbjct: 4065881 ttgttttgtgttttccatctattgt 4065857
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5 Length = 29737217 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 78 agcgaggcgaggcgcggcgcg 98 ||||||||||||||||||||| Sbjct: 26749076 agcgaggcgaggcgcggcgcg 26749096
>emb|X81045.1|SSXLNG Streptomyces sp. xln gene for xylanase Length = 1080 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 358 ctccggcaccatcaccaccgg 378 ||||||||||||||||||||| Sbjct: 662 ctccggcaccatcaccaccgg 682
>dbj|AK065138.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002A10, full insert sequence Length = 1899 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 78 agcgaggcgaggcgcggcgcg 98 ||||||||||||||||||||| Sbjct: 46 agcgaggcgaggcgcggcgcg 26
>dbj|AP004904.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT10C05, TM0062, complete sequence Length = 81367 Score = 42.1 bits (21), Expect = 2.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 632 tcatcttttgttttgtgtttt 652 ||||||||||||||||||||| Sbjct: 73309 tcatcttttgttttgtgtttt 73329 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 137,934,184 Number of extensions: 9670443 Number of successful extensions: 187914 Number of sequences better than 10.0: 64 Number of HSP's gapped: 187907 Number of HSP's successfully gapped: 69 Length of query: 775 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 753 Effective length of database: 18,508,616,841 Effective search space: 13936988481273 Effective search space used: 13936988481273 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
