ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf46d20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001056466.1| Oryza sativa (japonica cultivar-group) Os03g... 1752 0.0
2dbj|AK064890.1| Oryza sativa (japonica cultivar-group) cDNA clon... 1752 0.0
3gb|AC118669.2| Genomic sequence for Oryza sativa, Nipponbare str... 1320 0.0
4gb|AC118340.1| Genomic sequence for Oryza sativa, Nipponbare str... 1320 0.0
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 1320 0.0
6dbj|AK060813.1| Oryza sativa (japonica cultivar-group) cDNA clon... 761 0.0
7gb|AY104714.1| Zea mays PCO124238 mRNA sequence 553 e-153
8gb|BT012737.1| Lycopersicon esculentum clone 113675R, mRNA sequence 349 4e-92
9gb|AC153352.19| Medicago truncatula clone mth2-103l4, complete s... 295 5e-76
10ref|NM_116096.2| Arabidopsis thaliana ATP binding / ATP-dependen... 256 4e-64
11gb|BT010331.1| Arabidopsis thaliana At3g62310 mRNA, complete cds 256 4e-64
12gb|AY120782.1| Arabidopsis thaliana ATP-dependent RNA helicase-l... 256 4e-64
13gb|AC002337.3| Arabidopsis thaliana chromosome 2 clone T8I13 map... 252 6e-63
14dbj|AK226886.1| Arabidopsis thaliana mRNA for putative pre-mRNA ... 250 2e-62
15ref|NM_130293.2| Arabidopsis thaliana ATP binding / ATP-dependen... 250 2e-62
16gb|AY128301.1| Arabidopsis thaliana At2g47250/T8I13.9 mRNA, comp... 250 2e-62
17gb|BT004534.1| Arabidopsis thaliana At2g47250/T8I13.9 gene, comp... 250 2e-62
18emb|BX820131.1|CNS0A844 Arabidopsis thaliana Full-length cDNA Co... 244 2e-60
19emb|AL162507.1|ATT12C14 Arabidopsis thaliana DNA chromosome 3, B... 204 1e-48
20dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 186 3e-43
21dbj|AP005416.3| Oryza sativa (japonica cultivar-group) genomic D... 186 3e-43
22dbj|AP004589.3| Oryza sativa (japonica cultivar-group) genomic D... 186 3e-43
23gb|AC135398.2| Oryza sativa (japonica cultivar-group) chromosome... 180 2e-41
24dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 180 2e-41
25gb|AC172877.1| Brassica rapa subsp. pekinensis clone KBrH042F19,... 165 1e-36
26emb|CT962504.10| M.truncatula DNA sequence from clone MTH2-38L12... 147 3e-31
27gb|AC136449.21| Medicago truncatula clone mth2-11k13, complete s... 143 4e-30
28gb|AC133710.4| Oryza sativa (japonica cultivar-group) chromosome... 127 2e-25
29ref|XM_859190.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
30ref|XM_859167.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
31ref|XM_859144.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
32ref|XM_545974.2| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
33ref|XM_859091.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
34ref|XM_859050.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
35ref|XM_859028.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
36ref|XM_859010.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
37ref|XM_858909.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
38ref|XM_858894.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
39ref|XM_846442.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
40ref|XM_858830.1| PREDICTED: Canis familiaris similar to Putative... 94 3e-15
41ref|XM_961271.1| PREDICTED: Tribolium castaneum similar to CG111... 86 8e-13
42ref|XM_716671.1| Candida albicans SC5314 putative spliceosomal R... 80 5e-11
43ref|XM_716551.1| Candida albicans SC5314 putative spliceosomal R... 80 5e-11
44ref|XM_859069.1| PREDICTED: Canis familiaris similar to Putative... 78 2e-10
45ref|XM_627301.1| Cryptosporidium parvum Iowa II PRP43 involved i... 78 2e-10
46ref|XM_662242.1| Cryptosporidium hominis TU502 RNA helicase (Chr... 78 2e-10
47ref|XM_001176826.1| PREDICTED: Strongylocentrotus purpuratus put... 74 3e-09
48ref|XM_001176970.1| PREDICTED: Strongylocentrotus purpuratus put... 74 3e-09
49ref|XM_796883.2| PREDICTED: Strongylocentrotus purpuratus putati... 74 3e-09
50ref|XM_775329.2| PREDICTED: Strongylocentrotus purpuratus putati... 74 3e-09
51ref|NM_001074418.1| Oryza sativa (japonica cultivar-group) Os11g... 74 3e-09
52ref|XM_874839.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
53ref|XM_864986.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
54ref|XM_874665.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
55ref|XM_874579.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
56ref|XM_874495.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
57ref|XM_874418.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
58ref|XM_874337.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
59ref|XM_874254.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
60ref|XM_874078.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
61ref|XM_873988.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
62ref|XM_873894.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
63ref|XM_873606.1| PREDICTED: Bos taurus similar to Putative pre-m... 74 3e-09
64ref|XM_858986.1| PREDICTED: Canis familiaris similar to Putative... 74 3e-09
65ref|NM_001031159.1| Gallus gallus DEAH (Asp-Glu-Ala-His) box pol... 74 3e-09
66dbj|AK067929.1| Oryza sativa (japonica cultivar-group) cDNA clon... 74 3e-09
67gb|BC068766.1| Xenopus laevis hypothetical protein MGC81281, mRN... 72 1e-08
68ref|XM_456737.1| Debaryomyces hansenii CBS767 hypothetical prote... 72 1e-08
69emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS... 72 1e-08
70ref|XM_001164560.1| PREDICTED: Pan troglodytes similar to Putati... 70 5e-08
71ref|XM_001164599.1| PREDICTED: Pan troglodytes similar to Putati... 70 5e-08
72ref|XM_001105716.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-... 70 5e-08
73ref|XM_001105991.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-... 70 5e-08
74ref|XM_001105914.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-... 70 5e-08
75ref|XM_001106067.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-... 70 5e-08
76ref|XM_001105781.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-... 70 5e-08
77ref|NM_121494.1| Arabidopsis thaliana helicase (AT5G14900) mRNA,... 70 5e-08
78ref|XM_740796.1| Plasmodium chabaudi chabaudi ATP-dependant RNA ... 70 5e-08
79emb|CR926098.1| Pongo pygmaeus mRNA; cDNA DKFZp459N1310 (from cl... 70 5e-08
80emb|AL391146.1|ATF2G14 Arabidopsis thaliana DNA chromosome 5, BA... 70 5e-08
81emb|CR858867.1| Pongo pygmaeus mRNA; cDNA DKFZp469J2426 (from cl... 70 5e-08
82ref|XM_721572.1| Plasmodium yoelii yoelii str. 17XNL ATP-depende... 70 5e-08
83ref|XM_451555.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B00561g ... 68 2e-07
84gb|AY815802.1| Schistosoma japonicum SJCHGC04007 protein mRNA, c... 68 2e-07
85emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 68 2e-07
86gb|AC189295.1| Brassica rapa subsp. pekinensis clone KBrB026G01,... 66 8e-07
87ref|XM_001123240.1| PREDICTED: Apis mellifera similar to CG11107... 66 8e-07
88ref|XM_392081.3| PREDICTED: Apis mellifera similar to CG11107-PA... 66 8e-07
89ref|XM_674162.1| Plasmodium berghei strain ANKA ATP-dependant RN... 66 8e-07
90emb|CR380952.1| Candida glabrata strain CBS138 chromosome F comp... 64 3e-06
91ref|XM_446279.1| Candida glabrata CBS138, CAGL0F07139g partial mRNA 64 3e-06
92ref|NM_001358.2| Homo sapiens DEAH (Asp-Glu-Ala-His) box polypep... 62 1e-05
93gb|BC035974.1| Homo sapiens DEAH (Asp-Glu-Ala-His) box polypepti... 62 1e-05
94ref|XM_752152.1| Ustilago maydis 521 hypothetical protein (UM010... 62 1e-05
95emb|CR605943.1| full-length cDNA clone CS0DL005YA19 of B cells (... 62 1e-05
96gb|AF279891.1| Homo sapiens dead box protein 15 mRNA, complete cds 62 1e-05
97dbj|AB001636.1| Homo sapiens mRNA for ATP-dependent RNA helicase... 62 1e-05
98gb|AY813717.1| Schistosoma japonicum SJCHGC06976 protein mRNA, c... 60 5e-05
99ref|XM_001030651.1| Tetrahymena thermophila SB210 Helicase assoc... 58 2e-04
100dbj|AK230569.1| Sus scrofa mRNA, clone:AMP010010H06, expressed i... 58 2e-04
101ref|XM_874168.1| PREDICTED: Bos taurus similar to Putative pre-m... 58 2e-04
102ref|XM_873796.1| PREDICTED: Bos taurus similar to Putative pre-m... 58 2e-04
103ref|NM_001042620.1| Mus musculus DEAH (Asp-Glu-Ala-His) box poly... 56 8e-04
104ref|NM_007839.2| Mus musculus DEAH (Asp-Glu-Ala-His) box polypep... 56 8e-04
105ref|XM_652645.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 8e-04
106gb|BC100343.1| Mus musculus DEAH (Asp-Glu-Ala-His) box polypepti... 56 8e-04
107dbj|AK146441.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 56 8e-04
108dbj|AK151015.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 56 8e-04
109dbj|AK151757.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 56 8e-04
110dbj|AK149869.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 56 8e-04
111dbj|AK145983.1| Mus musculus 14 days pregnant adult female place... 56 8e-04
112dbj|AK168835.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 56 8e-04
113dbj|AK167927.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 56 8e-04
114dbj|AK169174.1| Mus musculus 16 days embryo kidney cDNA, RIKEN f... 56 8e-04
115gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 56 8e-04
116ref|NM_208076.1| Eremothecium gossypii AAR180Cp (AAR180C), mRNA 56 8e-04
117dbj|AK115322.1| Ciona intestinalis cDNA, clone:cieg044o15, full ... 56 8e-04
118gb|BC003745.1| Mus musculus cDNA clone IMAGE:3489032, containing... 56 8e-04
119gb|AF017153.1|AF017153 Mus musculus putative RNA helicase and RN... 56 8e-04
120ref|XM_001054651.1| PREDICTED: Rattus norvegicus DEAH (Asp-Glu-A... 54 0.003
121ref|XM_214053.4| PREDICTED: Rattus norvegicus DEAH (Asp-Glu-Ala-... 54 0.003
122gb|U13644.1| Caenorhabditis elegans cosmid F56D2, complete sequence 54 0.003
123ref|NM_171131.3| Caenorhabditis elegans F56D2.6b (F56D2.6) mRNA,... 54 0.003
124ref|NM_171130.3| Caenorhabditis elegans F56D2.6a (F56D2.6) mRNA,... 54 0.003
125ref|XM_748395.1| Aspergillus fumigatus Af293 pre-mRNA splicing f... 54 0.003
126emb|AL929357.1|PFA929357 Plasmodium falciparum strain 3D7, chrom... 54 0.003
127ref|NM_200024.1| Danio rerio DEAH (Asp-Glu-Ala-His) box polypept... 52 0.012
128gb|AC115110.3| Homo sapiens BAC clone RP11-192P23 from 4, comple... 52 0.012
129ref|XM_697097.1| PREDICTED: Danio rerio hypothetical protein LOC... 52 0.012
130ref|XM_663301.1| Cryptosporidium hominis TU502 hypothetical prot... 50 0.047
131gb|BC055510.1| Danio rerio DEAH (Asp-Glu-Ala-His) box polypeptid... 48 0.18
132gb|BC048369.1| Danio rerio DEAH (Asp-Glu-Ala-His) box polypeptid... 48 0.18
133ref|XM_858970.1| PREDICTED: Canis familiaris similar to Putative... 48 0.18
134ref|XM_858950.1| PREDICTED: Canis familiaris similar to Putative... 48 0.18
135dbj|AK055898.1| Homo sapiens cDNA FLJ31336 fis, clone MAMGL10001... 48 0.18
136dbj|AK056726.1| Homo sapiens cDNA FLJ32164 fis, clone PLACE60003... 48 0.18
137ref|XM_823555.1| Trypanosoma brucei TREU927 pre-mRNA splicing fa... 48 0.18
138gb|BC047577.1| Homo sapiens DEAH (Asp-Glu-Ala-His) box polypepti... 48 0.18
139ref|XM_693517.1| PREDICTED: Danio rerio wu:fb38f09 (wu:fb38f09),... 48 0.18
140emb|CR617314.1| full-length cDNA clone CS0DD009YD17 of Neuroblas... 48 0.18
141ref|XM_001033091.1| Tetrahymena thermophila SB210 RNA helicase, ... 46 0.73
142ref|NM_001074288.1| Oryza sativa (japonica cultivar-group) Os11g... 46 0.73
143ref|NM_001063571.1| Oryza sativa (japonica cultivar-group) Os06g... 46 0.73
144ref|NM_102984.3| Arabidopsis thaliana EMB2733; ATP binding / ATP... 46 0.73
145gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5... 46 0.73
146gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome... 46 0.73
147gb|AC135558.6| Oryza sativa (japonica cultivar-group) chromosome... 46 0.73
148gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 46 0.73
149ref|XM_873509.1| PREDICTED: Bos taurus similar to Putative pre-m... 46 0.73
150ref|XM_500940.1| Yarrowia lipolytica CLIB122, YALI0B15642g predi... 46 0.73
151gb|AY133872.1| Arabidopsis thaliana clone U09737 putative RNA he... 46 0.73
152gb|AY074318.1| Arabidopsis thaliana putative RNA helicase (At1g3... 46 0.73
153gb|AC007767.3|F5D14 Sequence of BAC F5D14 from Arabidopsis thali... 46 0.73
154dbj|AK101122.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.73
155dbj|AK067746.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.73
156gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 46 0.73
157emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 46 0.73
158gb|AC146307.24| Medicago truncatula chromosome 6 clone mth2-9p17... 44 2.9
159ref|XM_001211287.1| Aspergillus terreus NIH2624 pre-mRNA splicin... 44 2.9
160gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete s... 44 2.9
161ref|XM_368721.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 44 2.9
162ref|XM_633231.1| Dictyostelium discoideum AX4 hypothetical prote... 44 2.9
163gb|AC102612.14| Mus musculus chromosome 9, clone RP23-417D20, co... 44 2.9
164gb|AC147775.5| Medicago truncatula clone mth2-13d20, complete se... 44 2.9
165gb|AC009739.4| Drosophila melanogaster clone BACR26B18, complete... 44 2.9
166gb|AC124449.3| Mus musculus BAC clone RP24-212N10 from chromosom... 44 2.9
167gb|AC124381.4| Mus musculus BAC clone RP24-406E24 from chromosom... 44 2.9
168ref|NM_136425.2| Drosophila melanogaster CG11107-RA (CG11107), mRNA 44 2.9
169dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 44 2.9
170ref|XM_390933.1| Gibberella zeae PH-1 chromosome 3 conserved hyp... 44 2.9
171gb|AF178650.3| Homo sapiens chromosome 8 clone CTB-402H9 map 8ce... 44 2.9
172ref|NM_062618.4| Caenorhabditis elegans Masculinisation Of Germl... 44 2.9
173gb|AC084750.3| Homo sapiens BAC clone RP11-215J17 from 4, comple... 44 2.9
174emb|AL355986.7| Human DNA sequence from clone RP11-516G5 on chro... 44 2.9
175emb|AL139240.9| Human DNA sequence from clone RP11-344A5 on chro... 44 2.9
176gb|AY058484.1| Drosophila melanogaster GM13272 full length cDNA 44 2.9
177gb|AC151989.4| Mus musculus BAC clone RP23-298C3 from chromosome... 44 2.9
178ref|NM_001021845.1| Schizosaccharomyces pombe 972h- hypothetical... 44 2.9
179emb|X58681.1|SCPRP22GE S.cerevisiae DNA for PRP22 gene 44 2.9
180emb|BX294024.1|NC20H10 Neurospora crassa DNA linkage group V Cos... 44 2.9
181emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5 44 2.9
182emb|CR925780.8| Zebrafish DNA sequence from clone CH211-112B19 i... 44 2.9
183gb|AC150980.20| Medicago truncatula clone mth2-165j9, complete s... 44 2.9
184gb|U18778.1|SCE9537 Saccharomyces cerevisiae chromosome V cosmid... 44 2.9
185gb|AF286899.1|AF286899 Caenorhabditis elegans sex determining pr... 44 2.9
186ref|XM_955702.1| Neurospora crassa OR74A hypothetical protein (N... 44 2.9
187gb|AC105969.17| Mus musculus chromosome 15, clone RP23-477B23, c... 44 2.9
188gb|AC136365.5| Homo sapiens chromosome 8, clone RP11-97P4, compl... 44 2.9
189gb|AC171133.2| Helobdella robusta clone CH306-1A4, complete sequ... 44 2.9
190emb|AL391397.4|CNS06C87 Human chromosome 14 DNA sequence BAC R-6... 44 2.9
191dbj|AP005902.2| Homo sapiens genomic DNA, chromosome 8p11.21, cl... 44 2.9
192gb|DQ332137.1| Synthetic construct Saccharomyces cerevisiae clon... 44 2.9
193gb|AC174927.2| Mus musculus BAC clone RP24-325L16 from chromosom... 44 2.9
194gb|AC005452.1|AC005452 Drosophila melanogaster, chromosome 2R, r... 44 2.9
195emb|AL928904.16| Mouse DNA sequence from clone RP23-463M17 on ch... 44 2.9
196gb|AF028244.1|AF028244 Strongylocentrotus purpuratus putative RN... 44 2.9
197gb|U23484.1| Caenorhabditis elegans cosmid EEED8, complete sequence 44 2.9

>ref|NM_001056466.1| Oryza sativa (japonica cultivar-group) Os03g0314100 (Os03g0314100)
            mRNA, complete cds
          Length = 2931
 Score = 1752 bits (884), Expect = 0.0
 Identities = 1316/1460 (90%)
 Strand = Plus / Plus

                                                                        
Query: 193  ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
            |||||| ||||||||||| |||||||  ||  |||||||||||||| ||||||| |||||
Sbjct: 209  ggccaacccgtccatcaatcggtggacggggaggccctactcggcgaggtacctcgagat 268

                                                                        
Query: 253  cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
            ||||||||||||||||||||| ||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 269  cctcgagaagcgccgcacgctacccgtgtggcagcagaaggacgatttcctcgccgtcct 328

                                                                        
Query: 313  ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcagat 372
            |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 329  ccgcgacaaccagaccctcatcctcgtcggagaaaccggaagcggcaagaccactcagat 388

                                                                        
Query: 373  cccccaatttgtgcttgaggctgaaggtttgagcaaccgctctatggttgcctgcaccca 432
             |||||||| ||||| ||||||||||| |||||||||||||| |||||||| ||||||||
Sbjct: 389  tccccaattcgtgctcgaggctgaaggcttgagcaaccgctcaatggttgcttgcaccca 448

                                                                        
Query: 433  gccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggatgtcac 492
            ||| |||||||| || || ||||| || || |||||||| ||||||||||||||||| ||
Sbjct: 449  gccgcggagggtggcagctatgtcagtttcccggcgtgttgcggaggagatggatgttac 508

                                                                        
Query: 493  aatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcacaaaactgt 552
             ||||||||||||||||||||||| ||||| || || |||||||||||||||||||| ||
Sbjct: 509  tatcggggaggaagttggttacagcatccgttttgaggattgcagcagtcacaaaacagt 568

                                                                        
Query: 553  tctcaaatatttgacagatggtatgcttctgagagaagcaatggcagacccacttttaga 612
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 569  tctcaaatatttgacagatggtatgcttctgagagaagctatggcagacccacttttaga 628

                                                                        
Query: 613  aaggtacaaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttct 672
             ||||||||||||||||||||||| ||||| |||||||| || || ||||||||||||||
Sbjct: 629  gaggtacaaggtgattgttcttgatgaggcccatgagcggacattagcaacagatgttct 688

                                                                        
Query: 673  gtttgggcttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgag 732
            ||||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 689  gtttgggcttctgaaggaggttctaaagaacagacctgatttgaagcttgttgttatgag 748

                                                                        
Query: 733  tgctactcttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggt 792
            |||||| |||||||| ||||| ||||||   ||||||||||| ||||| |||||||||||
Sbjct: 749  tgctacccttgaggctgagaaatttcagacctatttcagtggtgcaccgttgatgaaggt 808

                                                                        
Query: 793  tcctggtagacttcatccggttgagatcttctatacccaggaaccagaaagggactatct 852
             ||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| ||
Sbjct: 809  gcctgggagacttcatccggttgagatcttctatacacaagaaccagaaagggactacct 868

                                                                        
Query: 853  agaagccgctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatcct 912
             ||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 869  ggaagctgctatcaggacagttgttcagatacatatgtgtgaacctgctggagatatcct 928

                                                                        
Query: 913  tgtattcctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagt 972
            ||| ||||| |||||||| ||||||||||||||||| ||||| || ||||| |||||| |
Sbjct: 929  tgttttccttactggagaggaggagattgaggatgcctgtcggaagataaataaggaaat 988

                                                                        
Query: 973  taataacatgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctccc 1032
            |||||||||||| ||||||||||||||||||||||| ||||| ||||| ||||| || ||
Sbjct: 989  taataacatgggggatcaggttggcccagttaaagttgtgcctttgtattctacgctgcc 1048

                                                                        
Query: 1033 ccctgcaatgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccc 1092
             || ||||||||||||||||||||||| ||||| ||| | ||||  | ||||||||||||
Sbjct: 1049 tccagcaatgcagcagaagatttttgaacctgctccagccccatcaagagagggaggccc 1108

                                                                        
Query: 1093 tgctggaaggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatgg 1152
             ||||||||||||||||||||||||||||| ||||| ||||||||| ||||||| |||||
Sbjct: 1109 agctggaaggaaaattgttgtgtccacaaatattgctgagacatccctaaccatagatgg 1168

                                                                        
Query: 1153 tatagtgtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataag 1212
            |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1169 tatagtgtatgtgatagacccagggttttccaaacagaaggtttacaatccaaggataag 1228

                                                                        
Query: 1213 ggtggaatcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcg 1272
            |||||| |||||| ||||||| |||||||| ||||||||||| ||||| |||||||||||
Sbjct: 1229 ggtggagtcccttctggtgtcgccaatttcaaaggcaagtgcacatcagagagctggtcg 1288

                                                                        
Query: 1273 tgctggaagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatgg 1332
            ||||||||||||||| ||||||||||| |||||||| || ||||||||||||||||| | 
Sbjct: 1289 tgctggaagaacgcaacctgggaagtgtttcaggttatatacagagaagagttttaacga 1348

                                                                        
Query: 1333 tgatttacagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttct 1392
            |||||||||||| ||||| ||||||||||| ||| ||||||| || || || || |||||
Sbjct: 1349 tgatttacagccacagacatacccagaaattcttaggtcaaatctggcgaatacggttct 1408

                                                                        
Query: 1393 tactctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgc 1452
            |||  |||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1409 taccttgaagaagcttggaattgatgatttagtgcattttgactttatggatcctcctgc 1468

                                                                        
Query: 1453 acctgaaactctaatgagggccttggaagttctgaactatttgggggcactcgacgatga 1512
            ||| |||||| | |||||||||||||||||| ||||||| || |||||||| || |||||
Sbjct: 1469 accagaaactttgatgagggccttggaagttttgaactacttaggggcacttgatgatga 1528

                                                                        
Query: 1513 aggcaacctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtc 1572
             || ||||| ||  ||||||||||||  |||||||| || ||  |||| || ||||||||
Sbjct: 1529 tggaaacctcacgcctttaggtgaaacaatgagtgaatttcctctagatccccagatgtc 1588

                                                                        
Query: 1573 aaagatgcttgtcatcagtccaaggtacaactgttcaaatgagatcctctcaatatctgc 1632
            |||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||
Sbjct: 1589 aaagatgcttgtcatcagtccaaaatacaactgttcaaatgagatcctttcaatatctgc 1648

                                
Query: 1633 catgctatcaggtatgtcaa 1652
            |||||| |||||||||||||
Sbjct: 1649 catgctgtcaggtatgtcaa 1668



 Score =  880 bits (444), Expect = 0.0
 Identities = 703/788 (89%), Gaps = 1/788 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1830 atcagcaactgtcatgcacctggcttctagagctattgatcgaaatgatcatacagttta 1889
            ||||||||||||| ||||||| |||||| |||||||||||| ||||||||||||||||||
Sbjct: 1856 atcagcaactgtcgtgcacctagcttcttgagctattgatcaaaatgatcatacagttta 1915

                                                                        
Query: 1890 ggctgatgcagatagttgctgtatgttgagttattctgacaaagcaaatggtatcgtctc 1949
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1916 ggctgatgcagatagttgctgtttgttgagttattctgacaaagcaaatggtatcgtctc 1975

                                                                        
Query: 1950 gcctctttgcatctgctgaccaaccatgggcttcgtctgttattaccatatcctttgtct 2009
            |||||||||||||||||||||| |||||| |||||||||||||| || ||| |||| |||
Sbjct: 1976 gcctctttgcatctgctgacca-ccatggacttcgtctgttattgccgtattctttctct 2034

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 2035 agtacccaattgctttctccggcctagggaggcacagaaggctgctgatgaagcgaaggc 2094

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            ||||||||| ||||| |||||||| || || |||||||||||||| ||||||||||||||
Sbjct: 2095 tcgatttggccacattgacggggaccacctgacacttctgaatgtataccatgcatacaa 2154

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            ||| |||||||| |||||    |||||||||||||| ||  |||||||| | ||  | ||
Sbjct: 2155 gcagaacaatgaagatccccagtggtgttatgagaacttcatcaatgccagagctctaaa 2214

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
            ||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 2215 gtcagctgataatgtcagacaacagcttgttcgcatcatgaccagatttaacctcaagat 2274

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| |||||| |
Sbjct: 2275 gtgcagcacagacttcaatagtcgggagtactacgtcaatatcaggaaagccatgcttgc 2334

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             |||||||| ||||||||||||||  |||||||||| || |||||| ||||||| || ||
Sbjct: 2335 agggtacttcatgcaggttgctcacctggagcgaacaggacattacctgaccgtcaaaga 2394

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
            ||| ||||||||||||||||| |||||||| ||| | |||||||||||||||||||||||
Sbjct: 2395 taaccaggttgtccatcttcacccctcgaactgtctagaccataagccggagtgggtcat 2454

                                                                        
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccgtgg 2489
            ||||||||| |||||| |||||||||| ||||||||||| || ||||  |||||||||||
Sbjct: 2455 ctacaatgagtatgttttgaccaccagaaatttcatccgcacggtcatggatatccgtgg 2514

                                                                        
Query: 2490 agagtggctgatcgatatagctccacagtactatgatctgaccaatttcccgtcatgtga 2549
             || |||||||| ||| | |||||||| || |||||||| |  |||||||| || || ||
Sbjct: 2515 tgattggctgattgatgtggctccacactattatgatcttagtaatttcccctcgtgcga 2574

                                                                        
Query: 2550 ggccaagcgtgtcctggagaggctgcacaataagagggagagggaaagagctgctagtag 2609
            ||| ||||| ||||| ||||||||| |||| ||| ||||||||||||||||||||| |||
Sbjct: 2575 ggcaaagcgcgtccttgagaggctgtacaacaagcgggagagggaaagagctgctaatag 2634

                    
Query: 2610 gaactgaa 2617
            ||||||||
Sbjct: 2635 gaactgaa 2642



 Score =  127 bits (64), Expect = 2e-25
 Identities = 82/88 (93%)
 Strand = Plus / Plus

                                                                       
Query: 77  gccgccatggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacc 136
           ||||| |||||||||||||||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 90  gccgcgatggggacggagcggaagcgcaaggtgagcctcttcgacgtggtcgacgagacc 149

                                       
Query: 137 tccgtatcctccaagctcggccgcgccg 164
           ||||| ||| ||||||||||||||||||
Sbjct: 150 tccgtctccgccaagctcggccgcgccg 177



to top

>dbj|AK064890.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000K17, full
            insert sequence
          Length = 2932

 Score = 1752 bits (884), Expect = 0.0
 Identities = 1316/1460 (90%)
 Strand = Plus / Plus

                                                                        
Query: 193  ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
            |||||| ||||||||||| |||||||  ||  |||||||||||||| ||||||| |||||
Sbjct: 210  ggccaacccgtccatcaatcggtggacggggaggccctactcggcgaggtacctcgagat 269

                                                                        
Query: 253  cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
            ||||||||||||||||||||| ||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 270  cctcgagaagcgccgcacgctacccgtgtggcagcagaaggacgatttcctcgccgtcct 329

                                                                        
Query: 313  ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcagat 372
            |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||
Sbjct: 330  ccgcgacaaccagaccctcatcctcgtcggagaaaccggaagcggcaagaccactcagat 389

                                                                        
Query: 373  cccccaatttgtgcttgaggctgaaggtttgagcaaccgctctatggttgcctgcaccca 432
             |||||||| ||||| ||||||||||| |||||||||||||| |||||||| ||||||||
Sbjct: 390  tccccaattcgtgctcgaggctgaaggcttgagcaaccgctcaatggttgcttgcaccca 449

                                                                        
Query: 433  gccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggatgtcac 492
            ||| |||||||| || || ||||| || || |||||||| ||||||||||||||||| ||
Sbjct: 450  gccgcggagggtggcagctatgtcagtttcccggcgtgttgcggaggagatggatgttac 509

                                                                        
Query: 493  aatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcacaaaactgt 552
             ||||||||||||||||||||||| ||||| || || |||||||||||||||||||| ||
Sbjct: 510  tatcggggaggaagttggttacagcatccgttttgaggattgcagcagtcacaaaacagt 569

                                                                        
Query: 553  tctcaaatatttgacagatggtatgcttctgagagaagcaatggcagacccacttttaga 612
            ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 570  tctcaaatatttgacagatggtatgcttctgagagaagctatggcagacccacttttaga 629

                                                                        
Query: 613  aaggtacaaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttct 672
             ||||||||||||||||||||||| ||||| |||||||| || || ||||||||||||||
Sbjct: 630  gaggtacaaggtgattgttcttgatgaggcccatgagcggacattagcaacagatgttct 689

                                                                        
Query: 673  gtttgggcttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgag 732
            ||||||||||||||| || |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 690  gtttgggcttctgaaggaggttctaaagaacagacctgatttgaagcttgttgttatgag 749

                                                                        
Query: 733  tgctactcttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggt 792
            |||||| |||||||| ||||| ||||||   ||||||||||| ||||| |||||||||||
Sbjct: 750  tgctacccttgaggctgagaaatttcagacctatttcagtggtgcaccgttgatgaaggt 809

                                                                        
Query: 793  tcctggtagacttcatccggttgagatcttctatacccaggaaccagaaagggactatct 852
             ||||| ||||||||||||||||||||||||||||| || ||||||||||||||||| ||
Sbjct: 810  gcctgggagacttcatccggttgagatcttctatacacaagaaccagaaagggactacct 869

                                                                        
Query: 853  agaagccgctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatcct 912
             ||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 870  ggaagctgctatcaggacagttgttcagatacatatgtgtgaacctgctggagatatcct 929

                                                                        
Query: 913  tgtattcctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagt 972
            ||| ||||| |||||||| ||||||||||||||||| ||||| || ||||| |||||| |
Sbjct: 930  tgttttccttactggagaggaggagattgaggatgcctgtcggaagataaataaggaaat 989

                                                                        
Query: 973  taataacatgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctccc 1032
            |||||||||||| ||||||||||||||||||||||| ||||| ||||| ||||| || ||
Sbjct: 990  taataacatgggggatcaggttggcccagttaaagttgtgcctttgtattctacgctgcc 1049

                                                                        
Query: 1033 ccctgcaatgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccc 1092
             || ||||||||||||||||||||||| ||||| ||| | ||||  | ||||||||||||
Sbjct: 1050 tccagcaatgcagcagaagatttttgaacctgctccagccccatcaagagagggaggccc 1109

                                                                        
Query: 1093 tgctggaaggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatgg 1152
             ||||||||||||||||||||||||||||| ||||| ||||||||| ||||||| |||||
Sbjct: 1110 agctggaaggaaaattgttgtgtccacaaatattgctgagacatccctaaccatagatgg 1169

                                                                        
Query: 1153 tatagtgtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataag 1212
            |||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 1170 tatagtgtatgtgatagacccagggttttccaaacagaaggtttacaatccaaggataag 1229

                                                                        
Query: 1213 ggtggaatcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcg 1272
            |||||| |||||| ||||||| |||||||| ||||||||||| ||||| |||||||||||
Sbjct: 1230 ggtggagtcccttctggtgtcgccaatttcaaaggcaagtgcacatcagagagctggtcg 1289

                                                                        
Query: 1273 tgctggaagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatgg 1332
            ||||||||||||||| ||||||||||| |||||||| || ||||||||||||||||| | 
Sbjct: 1290 tgctggaagaacgcaacctgggaagtgtttcaggttatatacagagaagagttttaacga 1349

                                                                        
Query: 1333 tgatttacagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttct 1392
            |||||||||||| ||||| ||||||||||| ||| ||||||| || || || || |||||
Sbjct: 1350 tgatttacagccacagacatacccagaaattcttaggtcaaatctggcgaatacggttct 1409

                                                                        
Query: 1393 tactctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgc 1452
            |||  |||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1410 taccttgaagaagcttggaattgatgatttagtgcattttgactttatggatcctcctgc 1469

                                                                        
Query: 1453 acctgaaactctaatgagggccttggaagttctgaactatttgggggcactcgacgatga 1512
            ||| |||||| | |||||||||||||||||| ||||||| || |||||||| || |||||
Sbjct: 1470 accagaaactttgatgagggccttggaagttttgaactacttaggggcacttgatgatga 1529

                                                                        
Query: 1513 aggcaacctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtc 1572
             || ||||| ||  ||||||||||||  |||||||| || ||  |||| || ||||||||
Sbjct: 1530 tggaaacctcacgcctttaggtgaaacaatgagtgaatttcctctagatccccagatgtc 1589

                                                                        
Query: 1573 aaagatgcttgtcatcagtccaaggtacaactgttcaaatgagatcctctcaatatctgc 1632
            |||||||||||||||||||||||  ||||||||||||||||||||||| |||||||||||
Sbjct: 1590 aaagatgcttgtcatcagtccaaaatacaactgttcaaatgagatcctttcaatatctgc 1649

                                
Query: 1633 catgctatcaggtatgtcaa 1652
            |||||| |||||||||||||
Sbjct: 1650 catgctgtcaggtatgtcaa 1669



 Score =  880 bits (444), Expect = 0.0
 Identities = 703/788 (89%), Gaps = 1/788 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1830 atcagcaactgtcatgcacctggcttctagagctattgatcgaaatgatcatacagttta 1889
            ||||||||||||| ||||||| |||||| |||||||||||| ||||||||||||||||||
Sbjct: 1857 atcagcaactgtcgtgcacctagcttcttgagctattgatcaaaatgatcatacagttta 1916

                                                                        
Query: 1890 ggctgatgcagatagttgctgtatgttgagttattctgacaaagcaaatggtatcgtctc 1949
            |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 1917 ggctgatgcagatagttgctgtttgttgagttattctgacaaagcaaatggtatcgtctc 1976

                                                                        
Query: 1950 gcctctttgcatctgctgaccaaccatgggcttcgtctgttattaccatatcctttgtct 2009
            |||||||||||||||||||||| |||||| |||||||||||||| || ||| |||| |||
Sbjct: 1977 gcctctttgcatctgctgacca-ccatggacttcgtctgttattgccgtattctttctct 2035

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 2036 agtacccaattgctttctccggcctagggaggcacagaaggctgctgatgaagcgaaggc 2095

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            ||||||||| ||||| |||||||| || || |||||||||||||| ||||||||||||||
Sbjct: 2096 tcgatttggccacattgacggggaccacctgacacttctgaatgtataccatgcatacaa 2155

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            ||| |||||||| |||||    |||||||||||||| ||  |||||||| | ||  | ||
Sbjct: 2156 gcagaacaatgaagatccccagtggtgttatgagaacttcatcaatgccagagctctaaa 2215

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
            ||| ||||||||||| |||||||| ||||| ||||||||||||||||| |||||||||||
Sbjct: 2216 gtcagctgataatgtcagacaacagcttgttcgcatcatgaccagatttaacctcaagat 2275

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| |||||| |
Sbjct: 2276 gtgcagcacagacttcaatagtcgggagtactacgtcaatatcaggaaagccatgcttgc 2335

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             |||||||| ||||||||||||||  |||||||||| || |||||| ||||||| || ||
Sbjct: 2336 agggtacttcatgcaggttgctcacctggagcgaacaggacattacctgaccgtcaaaga 2395

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
            ||| ||||||||||||||||| |||||||| ||| | |||||||||||||||||||||||
Sbjct: 2396 taaccaggttgtccatcttcacccctcgaactgtctagaccataagccggagtgggtcat 2455

                                                                        
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccgtgg 2489
            ||||||||| |||||| |||||||||| ||||||||||| || ||||  |||||||||||
Sbjct: 2456 ctacaatgagtatgttttgaccaccagaaatttcatccgcacggtcatggatatccgtgg 2515

                                                                        
Query: 2490 agagtggctgatcgatatagctccacagtactatgatctgaccaatttcccgtcatgtga 2549
             || |||||||| ||| | |||||||| || |||||||| |  |||||||| || || ||
Sbjct: 2516 tgattggctgattgatgtggctccacactattatgatcttagtaatttcccctcgtgcga 2575

                                                                        
Query: 2550 ggccaagcgtgtcctggagaggctgcacaataagagggagagggaaagagctgctagtag 2609
            ||| ||||| ||||| ||||||||| |||| ||| ||||||||||||||||||||| |||
Sbjct: 2576 ggcaaagcgcgtccttgagaggctgtacaacaagcgggagagggaaagagctgctaatag 2635

                    
Query: 2610 gaactgaa 2617
            ||||||||
Sbjct: 2636 gaactgaa 2643



 Score =  127 bits (64), Expect = 2e-25
 Identities = 82/88 (93%)
 Strand = Plus / Plus

                                                                       
Query: 77  gccgccatggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacc 136
           ||||| |||||||||||||||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 91  gccgcgatggggacggagcggaagcgcaaggtgagcctcttcgacgtggtcgacgagacc 150

                                       
Query: 137 tccgtatcctccaagctcggccgcgccg 164
           ||||| ||| ||||||||||||||||||
Sbjct: 151 tccgtctccgccaagctcggccgcgccg 178



to top

>gb|AC118669.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBb0011G21, from chromosome 3, complete sequence
          Length = 142401

 Score = 1320 bits (666), Expect = 0.0
 Identities = 987/1094 (90%)
 Strand = Plus / Plus

                                                                          
Query: 559    atatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggta 618
              ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 125295 atatttgacagatggtatgcttctgagagaagctatggcagacccacttttagagaggta 125354

                                                                          
Query: 619    caaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgg 678
              |||||||||||||||||| ||||| |||||||| || || ||||||||||||||||||||
Sbjct: 125355 caaggtgattgttcttgatgaggcccatgagcggacattagcaacagatgttctgtttgg 125414

                                                                          
Query: 679    gcttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctac 738
              ||||||||| || |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 125415 gcttctgaaggaggttctaaagaacagacctgatttgaagcttgttgttatgagtgctac 125474

                                                                          
Query: 739    tcttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctgg 798
               |||||||| ||||| ||||||   ||||||||||| ||||| ||||||||||| |||||
Sbjct: 125475 ccttgaggctgagaaatttcagacctatttcagtggtgcaccgttgatgaaggtgcctgg 125534

                                                                          
Query: 799    tagacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagc 858
               ||||||||||||||||||||||||||||| || ||||||||||||||||| || |||||
Sbjct: 125535 gagacttcatccggttgagatcttctatacacaagaaccagaaagggactacctggaagc 125594

                                                                          
Query: 859    cgctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtatt 918
               ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 125595 tgctatcaggacagttgttcagatacatatgtgtgaacctgctggagatatccttgtttt 125654

                                                                          
Query: 919    cctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataa 978
              ||| |||||||| ||||||||||||||||| ||||| || ||||| |||||| |||||||
Sbjct: 125655 ccttactggagaggaggagattgaggatgcctgtcggaagataaataaggaaattaataa 125714

                                                                          
Query: 979    catgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgc 1038
              |||||| ||||||||||||||||||||||| ||||| ||||| ||||| || || || ||
Sbjct: 125715 catgggggatcaggttggcccagttaaagttgtgcctttgtattctacgctgcctccagc 125774

                                                                          
Query: 1039   aatgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgg 1098
              ||||||||||||||||||||| ||||| ||| | ||||  | |||||||||||| |||||
Sbjct: 125775 aatgcagcagaagatttttgaacctgctccagccccatcaagagagggaggcccagctgg 125834

                                                                          
Query: 1099   aaggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagt 1158
              |||||||||||||||||||||||| ||||| ||||||||| ||||||| |||||||||||
Sbjct: 125835 aaggaaaattgttgtgtccacaaatattgctgagacatccctaaccatagatggtatagt 125894

                                                                          
Query: 1159   gtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtgga 1218
              |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 125895 gtatgtgatagacccagggttttccaaacagaaggtttacaatccaaggataagggtgga 125954

                                                                          
Query: 1219   atcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgg 1278
               |||||| ||||||| |||||||| ||||||||||| ||||| |||||||||||||||||
Sbjct: 125955 gtcccttctggtgtcgccaatttcaaaggcaagtgcacatcagagagctggtcgtgctgg 126014

                                                                          
Query: 1279   aagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattt 1338
              ||||||||| ||||||||||| |||||||| || ||||||||||||||||| | ||||||
Sbjct: 126015 aagaacgcaacctgggaagtgtttcaggttatatacagagaagagttttaacgatgattt 126074

                                                                          
Query: 1339   acagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactct 1398
              |||||| ||||| ||||||||||| ||| ||||||| || || || || ||||||||  |
Sbjct: 126075 acagccacagacatacccagaaattcttaggtcaaatctggcgaatacggttcttacctt 126134

                                                                          
Query: 1399   gaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctga 1458
              ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||
Sbjct: 126135 gaagaagcttggaattgatgatttagtgcattttgactttatggatcctcctgcaccaga 126194

                                                                          
Query: 1459   aactctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaa 1518
              |||| | |||||||||||||||||| ||||||| || |||||||| || ||||| || ||
Sbjct: 126195 aactttgatgagggccttggaagttttgaactacttaggggcacttgatgatgatggaaa 126254

                                                                          
Query: 1519   cctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagat 1578
              ||| ||  ||||||||||||  |||||||| || ||  |||| || ||||||||||||||
Sbjct: 126255 cctcacgcctttaggtgaaacaatgagtgaatttcctctagatccccagatgtcaaagat 126314

                                                                          
Query: 1579   gcttgtcatcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatgct 1638
              |||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 126315 gcttgtcatcagtccaaaatacaactgttcaaatgagatcctttcaatatctgccatgct 126374

                            
Query: 1639   atcaggtatgtcaa 1652
               |||||||||||||
Sbjct: 126375 gtcaggtatgtcaa 126388



 Score =  444 bits (224), Expect = e-121
 Identities = 288/308 (93%), Gaps = 1/308 (0%)
 Strand = Plus / Plus

                                                                          
Query: 1830   atcagcaactgtcatgcacctggcttctagagctattgatcgaaatgatcatacagttta 1889
              ||||||||||||| ||||||| |||||| |||||||||||| ||||||||||||||||||
Sbjct: 126576 atcagcaactgtcgtgcacctagcttcttgagctattgatcaaaatgatcatacagttta 126635

                                                                          
Query: 1890   ggctgatgcagatagttgctgtatgttgagttattctgacaaagcaaatggtatcgtctc 1949
              |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 126636 ggctgatgcagatagttgctgtttgttgagttattctgacaaagcaaatggtatcgtctc 126695

                                                                          
Query: 1950   gcctctttgcatctgctgaccaaccatgggcttcgtctgttattaccatatcctttgtct 2009
              ||||||||||||||||||||| ||||||| |||||||||||||| || ||| |||| |||
Sbjct: 126696 gcctctttgcatctgctgacc-accatggacttcgtctgttattgccgtattctttctct 126754

                                                                          
Query: 2010   agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
              |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 126755 agtacccaattgctttctccggcctagggaggcacagaaggctgctgatgaagcgaaggc 126814

                                                                          
Query: 2070   tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
              ||||||||| ||||| |||||||| || || |||||||||||||| ||||||||||||||
Sbjct: 126815 tcgatttggccacattgacggggaccacctgacacttctgaatgtataccatgcatacaa 126874

                      
Query: 2130   gcaaaaca 2137
              ||| ||||
Sbjct: 126875 gcagaaca 126882



 Score =  226 bits (114), Expect = 4e-55
 Identities = 162/178 (91%)
 Strand = Plus / Plus

                                                                          
Query: 193    ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
              |||||| ||||||||||| |||||||  ||  |||||||||||||| ||||||| |||||
Sbjct: 124476 ggccaacccgtccatcaatcggtggacggggaggccctactcggcgaggtacctcgagat 124535

                                                                          
Query: 253    cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
              ||||||||||||||||||||| ||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 124536 cctcgagaagcgccgcacgctacccgtgtggcagcagaaggacgatttcctcgccgtcct 124595

                                                                        
Query: 313    ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcag 370
              |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 124596 ccgcgacaaccagaccctcatcctcgtcggagaaaccggaagcggcaagaccactcag 124653



 Score =  224 bits (113), Expect = 1e-54
 Identities = 200/229 (87%)
 Strand = Plus / Plus

                                                                          
Query: 2152   tggtgttatgagaattttgtcaatgcccgggcgatgaagtctgctgataatgttagacaa 2211
              |||||||||||||| ||  |||||||| | ||  | ||||| ||||||||||| ||||||
Sbjct: 126975 tggtgttatgagaacttcatcaatgccagagctctaaagtcagctgataatgtcagacaa 127034

                                                                          
Query: 2212   caacttgtccgcatcatgaccagattcaacctcaagatgtgcagtacagacttcaacagt 2271
              || ||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 127035 cagcttgttcgcatcatgaccagatttaacctcaagatgtgcagcacagacttcaatagt 127094

                                                                          
Query: 2272   cgtgagtactatgtcaatatcaggaaagcaatgctttcggggtactttatgcaggttgct 2331
              || |||||||| ||||||||||||||||| |||||| | |||||||| ||||||||||||
Sbjct: 127095 cgggagtactacgtcaatatcaggaaagccatgcttgcagggtacttcatgcaggttgct 127154

                                                               
Query: 2332   catttggagcgaactgggcattacttgaccgttaaggataatcaggttg 2380
              ||  |||||||||| || |||||| ||||||| || ||||| |||||||
Sbjct: 127155 cacctggagcgaacaggacattacctgaccgtcaaagataaccaggttg 127203



 Score =  214 bits (108), Expect = 1e-51
 Identities = 171/192 (89%)
 Strand = Plus / Plus

                                                                          
Query: 367    tcagatcccccaatttgtgcttgaggctgaaggtttgagcaaccgctctatggttgcctg 426
              |||||| |||||||| ||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 124960 tcagattccccaattcgtgctcgaggctgaaggcttgagcaaccgctcaatggttgcttg 125019

                                                                          
Query: 427    cacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatgga 486
              ||||||||| |||||||| || || ||||| || || |||||||| ||||||||||||||
Sbjct: 125020 cacccagccgcggagggtggcagctatgtcagtttcccggcgtgttgcggaggagatgga 125079

                                                                          
Query: 487    tgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcacaa 546
              ||| || ||||||||||||||||||||||| ||||| || || |||||||||||||||||
Sbjct: 125080 tgttactatcggggaggaagttggttacagcatccgttttgaggattgcagcagtcacaa 125139

                          
Query: 547    aactgttctcaa 558
              ||| ||||||||
Sbjct: 125140 aacagttctcaa 125151



 Score =  145 bits (73), Expect = 1e-30
 Identities = 106/117 (90%)
 Strand = Plus / Plus

                                                                          
Query: 2373   tcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatcta 2432
              |||||||||||||||||| |||||||| ||| | ||||||||||||||||||||||||||
Sbjct: 127278 tcaggttgtccatcttcacccctcgaactgtctagaccataagccggagtgggtcatcta 127337

                                                                       
Query: 2433   caatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccgtgg 2489
              |||||| |||||| |||||||||| ||||||||||| || ||||  |||||||||||
Sbjct: 127338 caatgagtatgttttgaccaccagaaatttcatccgcacggtcatggatatccgtgg 127394



 Score =  127 bits (64), Expect = 2e-25
 Identities = 82/88 (93%)
 Strand = Plus / Plus

                                                                          
Query: 77     gccgccatggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacc 136
              ||||| |||||||||||||||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 124357 gccgcgatggggacggagcggaagcgcaaggtgagcctcttcgacgtggtcgacgagacc 124416

                                          
Query: 137    tccgtatcctccaagctcggccgcgccg 164
              ||||| ||| ||||||||||||||||||
Sbjct: 124417 tccgtctccgccaagctcggccgcgccg 124444



 Score =  101 bits (51), Expect = 1e-17
 Identities = 105/123 (85%)
 Strand = Plus / Plus

                                                                          
Query: 2495   ggctgatcgatatagctccacagtactatgatctgaccaatttcccgtcatgtgaggcca 2554
              ||||||| ||| | |||||||| || |||||||| |  |||||||| || || ||||| |
Sbjct: 127487 ggctgattgatgtggctccacactattatgatcttagtaatttcccctcgtgcgaggcaa 127546

                                                                          
Query: 2555   agcgtgtcctggagaggctgcacaataagagggagagggaaagagctgctagtaggaact 2614
              |||| ||||| ||||||||| |||| ||| ||||||||||||||||||||| ||||||||
Sbjct: 127547 agcgcgtccttgagaggctgtacaacaagcgggagagggaaagagctgctaataggaact 127606

                 
Query: 2615   gaa 2617
              |||
Sbjct: 127607 gaa 127609



to top

>gb|AC118340.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0085H08, from chromosome 3, complete sequence
          Length = 126708

 Score = 1320 bits (666), Expect = 0.0
 Identities = 987/1094 (90%)
 Strand = Plus / Minus

                                                                         
Query: 559   atatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggta 618
             ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 69110 atatttgacagatggtatgcttctgagagaagctatggcagacccacttttagagaggta 69051

                                                                         
Query: 619   caaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgg 678
             |||||||||||||||||| ||||| |||||||| || || ||||||||||||||||||||
Sbjct: 69050 caaggtgattgttcttgatgaggcccatgagcggacattagcaacagatgttctgtttgg 68991

                                                                         
Query: 679   gcttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctac 738
             ||||||||| || |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 68990 gcttctgaaggaggttctaaagaacagacctgatttgaagcttgttgttatgagtgctac 68931

                                                                         
Query: 739   tcttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctgg 798
              |||||||| ||||| ||||||   ||||||||||| ||||| ||||||||||| |||||
Sbjct: 68930 ccttgaggctgagaaatttcagacctatttcagtggtgcaccgttgatgaaggtgcctgg 68871

                                                                         
Query: 799   tagacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagc 858
              ||||||||||||||||||||||||||||| || ||||||||||||||||| || |||||
Sbjct: 68870 gagacttcatccggttgagatcttctatacacaagaaccagaaagggactacctggaagc 68811

                                                                         
Query: 859   cgctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtatt 918
              ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 68810 tgctatcaggacagttgttcagatacatatgtgtgaacctgctggagatatccttgtttt 68751

                                                                         
Query: 919   cctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataa 978
             ||| |||||||| ||||||||||||||||| ||||| || ||||| |||||| |||||||
Sbjct: 68750 ccttactggagaggaggagattgaggatgcctgtcggaagataaataaggaaattaataa 68691

                                                                         
Query: 979   catgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgc 1038
             |||||| ||||||||||||||||||||||| ||||| ||||| ||||| || || || ||
Sbjct: 68690 catgggggatcaggttggcccagttaaagttgtgcctttgtattctacgctgcctccagc 68631

                                                                         
Query: 1039  aatgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgg 1098
             ||||||||||||||||||||| ||||| ||| | ||||  | |||||||||||| |||||
Sbjct: 68630 aatgcagcagaagatttttgaacctgctccagccccatcaagagagggaggcccagctgg 68571

                                                                         
Query: 1099  aaggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagt 1158
             |||||||||||||||||||||||| ||||| ||||||||| ||||||| |||||||||||
Sbjct: 68570 aaggaaaattgttgtgtccacaaatattgctgagacatccctaaccatagatggtatagt 68511

                                                                         
Query: 1159  gtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtgga 1218
             |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 68510 gtatgtgatagacccagggttttccaaacagaaggtttacaatccaaggataagggtgga 68451

                                                                         
Query: 1219  atcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgg 1278
              |||||| ||||||| |||||||| ||||||||||| ||||| |||||||||||||||||
Sbjct: 68450 gtcccttctggtgtcgccaatttcaaaggcaagtgcacatcagagagctggtcgtgctgg 68391

                                                                         
Query: 1279  aagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattt 1338
             ||||||||| ||||||||||| |||||||| || ||||||||||||||||| | ||||||
Sbjct: 68390 aagaacgcaacctgggaagtgtttcaggttatatacagagaagagttttaacgatgattt 68331

                                                                         
Query: 1339  acagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactct 1398
             |||||| ||||| ||||||||||| ||| ||||||| || || || || ||||||||  |
Sbjct: 68330 acagccacagacatacccagaaattcttaggtcaaatctggcgaatacggttcttacctt 68271

                                                                         
Query: 1399  gaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctga 1458
             ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||
Sbjct: 68270 gaagaagcttggaattgatgatttagtgcattttgactttatggatcctcctgcaccaga 68211

                                                                         
Query: 1459  aactctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaa 1518
             |||| | |||||||||||||||||| ||||||| || |||||||| || ||||| || ||
Sbjct: 68210 aactttgatgagggccttggaagttttgaactacttaggggcacttgatgatgatggaaa 68151

                                                                         
Query: 1519  cctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagat 1578
             ||| ||  ||||||||||||  |||||||| || ||  |||| || ||||||||||||||
Sbjct: 68150 cctcacgcctttaggtgaaacaatgagtgaatttcctctagatccccagatgtcaaagat 68091

                                                                         
Query: 1579  gcttgtcatcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatgct 1638
             |||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 68090 gcttgtcatcagtccaaaatacaactgttcaaatgagatcctttcaatatctgccatgct 68031

                           
Query: 1639  atcaggtatgtcaa 1652
              |||||||||||||
Sbjct: 68030 gtcaggtatgtcaa 68017



 Score =  444 bits (224), Expect = e-121
 Identities = 288/308 (93%), Gaps = 1/308 (0%)
 Strand = Plus / Minus

                                                                         
Query: 1830  atcagcaactgtcatgcacctggcttctagagctattgatcgaaatgatcatacagttta 1889
             ||||||||||||| ||||||| |||||| |||||||||||| ||||||||||||||||||
Sbjct: 67829 atcagcaactgtcgtgcacctagcttcttgagctattgatcaaaatgatcatacagttta 67770

                                                                         
Query: 1890  ggctgatgcagatagttgctgtatgttgagttattctgacaaagcaaatggtatcgtctc 1949
             |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 67769 ggctgatgcagatagttgctgtttgttgagttattctgacaaagcaaatggtatcgtctc 67710

                                                                         
Query: 1950  gcctctttgcatctgctgaccaaccatgggcttcgtctgttattaccatatcctttgtct 2009
             ||||||||||||||||||||| ||||||| |||||||||||||| || ||| |||| |||
Sbjct: 67709 gcctctttgcatctgctgacc-accatggacttcgtctgttattgccgtattctttctct 67651

                                                                         
Query: 2010  agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
             |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 67650 agtacccaattgctttctccggcctagggaggcacagaaggctgctgatgaagcgaaggc 67591

                                                                         
Query: 2070  tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
             ||||||||| ||||| |||||||| || || |||||||||||||| ||||||||||||||
Sbjct: 67590 tcgatttggccacattgacggggaccacctgacacttctgaatgtataccatgcatacaa 67531

                     
Query: 2130  gcaaaaca 2137
             ||| ||||
Sbjct: 67530 gcagaaca 67523



 Score =  226 bits (114), Expect = 4e-55
 Identities = 162/178 (91%)
 Strand = Plus / Minus

                                                                         
Query: 193   ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
             |||||| ||||||||||| |||||||  ||  |||||||||||||| ||||||| |||||
Sbjct: 69929 ggccaacccgtccatcaatcggtggacggggaggccctactcggcgaggtacctcgagat 69870

                                                                         
Query: 253   cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
             ||||||||||||||||||||| ||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 69869 cctcgagaagcgccgcacgctacccgtgtggcagcagaaggacgatttcctcgccgtcct 69810

                                                                       
Query: 313   ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcag 370
             |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 69809 ccgcgacaaccagaccctcatcctcgtcggagaaaccggaagcggcaagaccactcag 69752



 Score =  224 bits (113), Expect = 1e-54
 Identities = 200/229 (87%)
 Strand = Plus / Minus

                                                                         
Query: 2152  tggtgttatgagaattttgtcaatgcccgggcgatgaagtctgctgataatgttagacaa 2211
             |||||||||||||| ||  |||||||| | ||  | ||||| ||||||||||| ||||||
Sbjct: 67430 tggtgttatgagaacttcatcaatgccagagctctaaagtcagctgataatgtcagacaa 67371

                                                                         
Query: 2212  caacttgtccgcatcatgaccagattcaacctcaagatgtgcagtacagacttcaacagt 2271
             || ||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 67370 cagcttgttcgcatcatgaccagatttaacctcaagatgtgcagcacagacttcaatagt 67311

                                                                         
Query: 2272  cgtgagtactatgtcaatatcaggaaagcaatgctttcggggtactttatgcaggttgct 2331
             || |||||||| ||||||||||||||||| |||||| | |||||||| ||||||||||||
Sbjct: 67310 cgggagtactacgtcaatatcaggaaagccatgcttgcagggtacttcatgcaggttgct 67251

                                                              
Query: 2332  catttggagcgaactgggcattacttgaccgttaaggataatcaggttg 2380
             ||  |||||||||| || |||||| ||||||| || ||||| |||||||
Sbjct: 67250 cacctggagcgaacaggacattacctgaccgtcaaagataaccaggttg 67202



 Score =  214 bits (108), Expect = 1e-51
 Identities = 171/192 (89%)
 Strand = Plus / Minus

                                                                         
Query: 367   tcagatcccccaatttgtgcttgaggctgaaggtttgagcaaccgctctatggttgcctg 426
             |||||| |||||||| ||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 69445 tcagattccccaattcgtgctcgaggctgaaggcttgagcaaccgctcaatggttgcttg 69386

                                                                         
Query: 427   cacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatgga 486
             ||||||||| |||||||| || || ||||| || || |||||||| ||||||||||||||
Sbjct: 69385 cacccagccgcggagggtggcagctatgtcagtttcccggcgtgttgcggaggagatgga 69326

                                                                         
Query: 487   tgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcacaa 546
             ||| || ||||||||||||||||||||||| ||||| || || |||||||||||||||||
Sbjct: 69325 tgttactatcggggaggaagttggttacagcatccgttttgaggattgcagcagtcacaa 69266

                         
Query: 547   aactgttctcaa 558
             ||| ||||||||
Sbjct: 69265 aacagttctcaa 69254



 Score =  145 bits (73), Expect = 1e-30
 Identities = 106/117 (90%)
 Strand = Plus / Minus

                                                                         
Query: 2373  tcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatcta 2432
             |||||||||||||||||| |||||||| ||| | ||||||||||||||||||||||||||
Sbjct: 67127 tcaggttgtccatcttcacccctcgaactgtctagaccataagccggagtgggtcatcta 67068

                                                                      
Query: 2433  caatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccgtgg 2489
             |||||| |||||| |||||||||| ||||||||||| || ||||  |||||||||||
Sbjct: 67067 caatgagtatgttttgaccaccagaaatttcatccgcacggtcatggatatccgtgg 67011



 Score =  127 bits (64), Expect = 2e-25
 Identities = 82/88 (93%)
 Strand = Plus / Minus

                                                                         
Query: 77    gccgccatggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacc 136
             ||||| |||||||||||||||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 70048 gccgcgatggggacggagcggaagcgcaaggtgagcctcttcgacgtggtcgacgagacc 69989

                                         
Query: 137   tccgtatcctccaagctcggccgcgccg 164
             ||||| ||| ||||||||||||||||||
Sbjct: 69988 tccgtctccgccaagctcggccgcgccg 69961



 Score =  101 bits (51), Expect = 1e-17
 Identities = 105/123 (85%)
 Strand = Plus / Minus

                                                                         
Query: 2495  ggctgatcgatatagctccacagtactatgatctgaccaatttcccgtcatgtgaggcca 2554
             ||||||| ||| | |||||||| || |||||||| |  |||||||| || || ||||| |
Sbjct: 66918 ggctgattgatgtggctccacactattatgatcttagtaatttcccctcgtgcgaggcaa 66859

                                                                         
Query: 2555  agcgtgtcctggagaggctgcacaataagagggagagggaaagagctgctagtaggaact 2614
             |||| ||||| ||||||||| |||| ||| ||||||||||||||||||||| ||||||||
Sbjct: 66858 agcgcgtccttgagaggctgtacaacaagcgggagagggaaagagctgctaataggaact 66799

                
Query: 2615  gaa 2617
             |||
Sbjct: 66798 gaa 66796



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 1320 bits (666), Expect = 0.0
 Identities = 987/1094 (90%)
 Strand = Plus / Plus

                                                                            
Query: 559      atatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggta 618
                ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||
Sbjct: 11208701 atatttgacagatggtatgcttctgagagaagctatggcagacccacttttagagaggta 11208760

                                                                            
Query: 619      caaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgg 678
                |||||||||||||||||| ||||| |||||||| || || ||||||||||||||||||||
Sbjct: 11208761 caaggtgattgttcttgatgaggcccatgagcggacattagcaacagatgttctgtttgg 11208820

                                                                            
Query: 679      gcttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctac 738
                ||||||||| || |||||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 11208821 gcttctgaaggaggttctaaagaacagacctgatttgaagcttgttgttatgagtgctac 11208880

                                                                            
Query: 739      tcttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctgg 798
                 |||||||| ||||| ||||||   ||||||||||| ||||| ||||||||||| |||||
Sbjct: 11208881 ccttgaggctgagaaatttcagacctatttcagtggtgcaccgttgatgaaggtgcctgg 11208940

                                                                            
Query: 799      tagacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagc 858
                 ||||||||||||||||||||||||||||| || ||||||||||||||||| || |||||
Sbjct: 11208941 gagacttcatccggttgagatcttctatacacaagaaccagaaagggactacctggaagc 11209000

                                                                            
Query: 859      cgctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtatt 918
                 ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||
Sbjct: 11209001 tgctatcaggacagttgttcagatacatatgtgtgaacctgctggagatatccttgtttt 11209060

                                                                            
Query: 919      cctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataa 978
                ||| |||||||| ||||||||||||||||| ||||| || ||||| |||||| |||||||
Sbjct: 11209061 ccttactggagaggaggagattgaggatgcctgtcggaagataaataaggaaattaataa 11209120

                                                                            
Query: 979      catgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgc 1038
                |||||| ||||||||||||||||||||||| ||||| ||||| ||||| || || || ||
Sbjct: 11209121 catgggggatcaggttggcccagttaaagttgtgcctttgtattctacgctgcctccagc 11209180

                                                                            
Query: 1039     aatgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgg 1098
                ||||||||||||||||||||| ||||| ||| | ||||  | |||||||||||| |||||
Sbjct: 11209181 aatgcagcagaagatttttgaacctgctccagccccatcaagagagggaggcccagctgg 11209240

                                                                            
Query: 1099     aaggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagt 1158
                |||||||||||||||||||||||| ||||| ||||||||| ||||||| |||||||||||
Sbjct: 11209241 aaggaaaattgttgtgtccacaaatattgctgagacatccctaaccatagatggtatagt 11209300

                                                                            
Query: 1159     gtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtgga 1218
                |||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 11209301 gtatgtgatagacccagggttttccaaacagaaggtttacaatccaaggataagggtgga 11209360

                                                                            
Query: 1219     atcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgg 1278
                 |||||| ||||||| |||||||| ||||||||||| ||||| |||||||||||||||||
Sbjct: 11209361 gtcccttctggtgtcgccaatttcaaaggcaagtgcacatcagagagctggtcgtgctgg 11209420

                                                                            
Query: 1279     aagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattt 1338
                ||||||||| ||||||||||| |||||||| || ||||||||||||||||| | ||||||
Sbjct: 11209421 aagaacgcaacctgggaagtgtttcaggttatatacagagaagagttttaacgatgattt 11209480

                                                                            
Query: 1339     acagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactct 1398
                |||||| ||||| ||||||||||| ||| ||||||| || || || || ||||||||  |
Sbjct: 11209481 acagccacagacatacccagaaattcttaggtcaaatctggcgaatacggttcttacctt 11209540

                                                                            
Query: 1399     gaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctga 1458
                ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||
Sbjct: 11209541 gaagaagcttggaattgatgatttagtgcattttgactttatggatcctcctgcaccaga 11209600

                                                                            
Query: 1459     aactctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaa 1518
                |||| | |||||||||||||||||| ||||||| || |||||||| || ||||| || ||
Sbjct: 11209601 aactttgatgagggccttggaagttttgaactacttaggggcacttgatgatgatggaaa 11209660

                                                                            
Query: 1519     cctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagat 1578
                ||| ||  ||||||||||||  |||||||| || ||  |||| || ||||||||||||||
Sbjct: 11209661 cctcacgcctttaggtgaaacaatgagtgaatttcctctagatccccagatgtcaaagat 11209720

                                                                            
Query: 1579     gcttgtcatcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatgct 1638
                |||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||||
Sbjct: 11209721 gcttgtcatcagtccaaaatacaactgttcaaatgagatcctttcaatatctgccatgct 11209780

                              
Query: 1639     atcaggtatgtcaa 1652
                 |||||||||||||
Sbjct: 11209781 gtcaggtatgtcaa 11209794



 Score =  444 bits (224), Expect = e-121
 Identities = 288/308 (93%), Gaps = 1/308 (0%)
 Strand = Plus / Plus

                                                                            
Query: 1830     atcagcaactgtcatgcacctggcttctagagctattgatcgaaatgatcatacagttta 1889
                ||||||||||||| ||||||| |||||| |||||||||||| ||||||||||||||||||
Sbjct: 11209982 atcagcaactgtcgtgcacctagcttcttgagctattgatcaaaatgatcatacagttta 11210041

                                                                            
Query: 1890     ggctgatgcagatagttgctgtatgttgagttattctgacaaagcaaatggtatcgtctc 1949
                |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 11210042 ggctgatgcagatagttgctgtttgttgagttattctgacaaagcaaatggtatcgtctc 11210101

                                                                            
Query: 1950     gcctctttgcatctgctgaccaaccatgggcttcgtctgttattaccatatcctttgtct 2009
                ||||||||||||||||||||| ||||||| |||||||||||||| || ||| |||| |||
Sbjct: 11210102 gcctctttgcatctgctgacc-accatggacttcgtctgttattgccgtattctttctct 11210160

                                                                            
Query: 2010     agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
                |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||
Sbjct: 11210161 agtacccaattgctttctccggcctagggaggcacagaaggctgctgatgaagcgaaggc 11210220

                                                                            
Query: 2070     tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
                ||||||||| ||||| |||||||| || || |||||||||||||| ||||||||||||||
Sbjct: 11210221 tcgatttggccacattgacggggaccacctgacacttctgaatgtataccatgcatacaa 11210280

                        
Query: 2130     gcaaaaca 2137
                ||| ||||
Sbjct: 11210281 gcagaaca 11210288



 Score =  226 bits (114), Expect = 4e-55
 Identities = 162/178 (91%)
 Strand = Plus / Plus

                                                                            
Query: 193      ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
                |||||| ||||||||||| |||||||  ||  |||||||||||||| ||||||| |||||
Sbjct: 11207882 ggccaacccgtccatcaatcggtggacggggaggccctactcggcgaggtacctcgagat 11207941

                                                                            
Query: 253      cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
                ||||||||||||||||||||| ||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 11207942 cctcgagaagcgccgcacgctacccgtgtggcagcagaaggacgatttcctcgccgtcct 11208001

                                                                          
Query: 313      ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcag 370
                |||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 11208002 ccgcgacaaccagaccctcatcctcgtcggagaaaccggaagcggcaagaccactcag 11208059



 Score =  224 bits (113), Expect = 1e-54
 Identities = 200/229 (87%)
 Strand = Plus / Plus

                                                                            
Query: 2152     tggtgttatgagaattttgtcaatgcccgggcgatgaagtctgctgataatgttagacaa 2211
                |||||||||||||| ||  |||||||| | ||  | ||||| ||||||||||| ||||||
Sbjct: 11210381 tggtgttatgagaacttcatcaatgccagagctctaaagtcagctgataatgtcagacaa 11210440

                                                                            
Query: 2212     caacttgtccgcatcatgaccagattcaacctcaagatgtgcagtacagacttcaacagt 2271
                || ||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |||
Sbjct: 11210441 cagcttgttcgcatcatgaccagatttaacctcaagatgtgcagcacagacttcaatagt 11210500

                                                                            
Query: 2272     cgtgagtactatgtcaatatcaggaaagcaatgctttcggggtactttatgcaggttgct 2331
                || |||||||| ||||||||||||||||| |||||| | |||||||| ||||||||||||
Sbjct: 11210501 cgggagtactacgtcaatatcaggaaagccatgcttgcagggtacttcatgcaggttgct 11210560

                                                                 
Query: 2332     catttggagcgaactgggcattacttgaccgttaaggataatcaggttg 2380
                ||  |||||||||| || |||||| ||||||| || ||||| |||||||
Sbjct: 11210561 cacctggagcgaacaggacattacctgaccgtcaaagataaccaggttg 11210609



 Score =  214 bits (108), Expect = 1e-51
 Identities = 171/192 (89%)
 Strand = Plus / Plus

                                                                            
Query: 367      tcagatcccccaatttgtgcttgaggctgaaggtttgagcaaccgctctatggttgcctg 426
                |||||| |||||||| ||||| ||||||||||| |||||||||||||| |||||||| ||
Sbjct: 11208366 tcagattccccaattcgtgctcgaggctgaaggcttgagcaaccgctcaatggttgcttg 11208425

                                                                            
Query: 427      cacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatgga 486
                ||||||||| |||||||| || || ||||| || || |||||||| ||||||||||||||
Sbjct: 11208426 cacccagccgcggagggtggcagctatgtcagtttcccggcgtgttgcggaggagatgga 11208485

                                                                            
Query: 487      tgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcacaa 546
                ||| || ||||||||||||||||||||||| ||||| || || |||||||||||||||||
Sbjct: 11208486 tgttactatcggggaggaagttggttacagcatccgttttgaggattgcagcagtcacaa 11208545

                            
Query: 547      aactgttctcaa 558
                ||| ||||||||
Sbjct: 11208546 aacagttctcaa 11208557



 Score =  145 bits (73), Expect = 1e-30
 Identities = 106/117 (90%)
 Strand = Plus / Plus

                                                                            
Query: 2373     tcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatcta 2432
                |||||||||||||||||| |||||||| ||| | ||||||||||||||||||||||||||
Sbjct: 11210684 tcaggttgtccatcttcacccctcgaactgtctagaccataagccggagtgggtcatcta 11210743

                                                                         
Query: 2433     caatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccgtgg 2489
                |||||| |||||| |||||||||| ||||||||||| || ||||  |||||||||||
Sbjct: 11210744 caatgagtatgttttgaccaccagaaatttcatccgcacggtcatggatatccgtgg 11210800



 Score =  127 bits (64), Expect = 2e-25
 Identities = 82/88 (93%)
 Strand = Plus / Plus

                                                                            
Query: 77       gccgccatggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacc 136
                ||||| |||||||||||||||||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 11207763 gccgcgatggggacggagcggaagcgcaaggtgagcctcttcgacgtggtcgacgagacc 11207822

                                            
Query: 137      tccgtatcctccaagctcggccgcgccg 164
                ||||| ||| ||||||||||||||||||
Sbjct: 11207823 tccgtctccgccaagctcggccgcgccg 11207850



 Score =  101 bits (51), Expect = 1e-17
 Identities = 105/123 (85%)
 Strand = Plus / Plus

                                                                            
Query: 2495     ggctgatcgatatagctccacagtactatgatctgaccaatttcccgtcatgtgaggcca 2554
                ||||||| ||| | |||||||| || |||||||| |  |||||||| || || ||||| |
Sbjct: 11210893 ggctgattgatgtggctccacactattatgatcttagtaatttcccctcgtgcgaggcaa 11210952

                                                                            
Query: 2555     agcgtgtcctggagaggctgcacaataagagggagagggaaagagctgctagtaggaact 2614
                |||| ||||| ||||||||| |||| ||| ||||||||||||||||||||| ||||||||
Sbjct: 11210953 agcgcgtccttgagaggctgtacaacaagcgggagagggaaagagctgctaataggaact 11211012

                   
Query: 2615     gaa 2617
                |||
Sbjct: 11211013 gaa 11211015



to top

>dbj|AK060813.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-H05, full
            insert sequence
          Length = 1502

 Score =  761 bits (384), Expect = 0.0
 Identities = 637/720 (88%), Gaps = 1/720 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1898 cagatagttgctgtatgttgagttattctgacaaagcaaatggtatcgtctcgcctcttt 1957
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 485  cagatagttgctgtttgttgagttattctgacaaagcaaatggtatcgtctcgcctcttt 544

                                                                        
Query: 1958 gcatctgctgaccaaccatgggcttcgtctgttattaccatatcctttgtctagtaccca 2017
            |||||||||||||| |||||| |||||||||||||| || ||| |||| |||||||||||
Sbjct: 545  gcatctgctgacca-ccatggacttcgtctgttattgccgtattctttctctagtaccca 603

                                                                        
Query: 2018 attgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggctcgatttg 2077
            |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||
Sbjct: 604  attgctttctccggcctagggaggcacagaaggctgctgatgaagcgaaggctcgatttg 663

                                                                        
Query: 2078 ggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaagcaaaaca 2137
            | ||||| |||||||| || || |||||||||||||| ||||||||||||||||| ||||
Sbjct: 664  gccacattgacggggaccacctgacacttctgaatgtataccatgcatacaagcagaaca 723

                                                                        
Query: 2138 atgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaagtctgctg 2197
            |||| |||||    |||||||||||||| ||  |||||||| | ||  | ||||| ||||
Sbjct: 724  atgaagatccccagtggtgttatgagaacttcatcaatgccagagctctaaagtcagctg 783

                                                                        
Query: 2198 ataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagatgtgcagta 2257
            ||||||| |||||||| ||||| ||||||||||||||||| ||||||||||||||||| |
Sbjct: 784  ataatgtcagacaacagcttgttcgcatcatgaccagatttaacctcaagatgtgcagca 843

                                                                        
Query: 2258 cagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttcggggtact 2317
            |||||||||| ||||| |||||||| ||||||||||||||||| |||||| | |||||||
Sbjct: 844  cagacttcaatagtcgggagtactacgtcaatatcaggaaagccatgcttgcagggtact 903

                                                                        
Query: 2318 ttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatcagg 2377
            | ||||||||||||||  |||||||||| || |||||| ||||||| || ||||| ||||
Sbjct: 904  tcatgcaggttgctcacctggagcgaacaggacattacctgaccgtcaaagataaccagg 963

                                                                        
Query: 2378 ttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatctacaatg 2437
            ||||||||||||| |||||||| ||| | |||||||||||||||||||||| ||||||||
Sbjct: 964  ttgtccatcttcacccctcgaactgtctagaccataagccggagtgggtcacctacaatg 1023

                                                                        
Query: 2438 aatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccgtggagagtggc 2497
            | |||||| |||||||||| ||||||||||| || ||||  ||||||||||| || ||||
Sbjct: 1024 agtatgttttgaccaccagaaatttcatccgcacggtcatggatatccgtggtgattggc 1083

                                                                        
Query: 2498 tgatcgatatagctccacagtactatgatctgaccaatttcccgtcatgtgaggccaagc 2557
            |||| ||| | |||||||| || |||||||| |  |||||||| || || | ||| ||||
Sbjct: 1084 tgattgatgtggctccacactattatgatcttagtaatttcccctcgtgcggggcaaagc 1143

                                                                        
Query: 2558 gtgtcctggagaggctgcacaataagagggagagggaaagagctgctagtaggaactgaa 2617
            | ||||| ||||||||| |||| ||| ||||||||||||||||||||| |||||||||||
Sbjct: 1144 gcgtccttgagaggctgtacaacaagcgggagagggaaagagctgctaataggaactgaa 1203



 Score =  561 bits (283), Expect = e-156
 Identities = 436/487 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1157 gtgtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtg 1216
            |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    gtgtatgtgatagacccagggttttccaaacagaaggtttacaatccaaggataagggtg 60

                                                                        
Query: 1217 gaatcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgct 1276
            || |||||| ||||||| |||||||| ||||||||||| ||||| |||||||||||||||
Sbjct: 61   gagtcccttctggtgtcgccaatttcaaaggcaagtgcacatcagagagctggtcgtgct 120

                                                                        
Query: 1277 ggaagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgat 1336
            ||||||||||| ||||||||||| |||||||| || ||||||||||||||||| | ||||
Sbjct: 121  ggaagaacgcaacctgggaagtgtttcaggttatatacagagaagagttttaacgatgat 180

                                                                        
Query: 1337 ttacagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttact 1396
            |||||||| ||||| ||||||||||| ||| ||||||| || || || || |||||||| 
Sbjct: 181  ttacagccacagacatacccagaaattcttaggtcaaatctggcgaatacggttcttacc 240

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
             |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 241  ttgaagaagcttggaattgatgatttagtgcattttgactttatggatcctcctgcacca 300

                                                                        
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggc 1516
            |||||| | |||||||||||||||||| ||||||| || |||||||| || ||||| || 
Sbjct: 301  gaaactttgatgagggccttggaagttttgaactacttaggggcacttgatgatgatgga 360

                                                                        
Query: 1517 aacctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaag 1576
            ||||| ||  ||||||||||||  |||||||| || ||  |||| || ||||||||||||
Sbjct: 361  aacctcacgcctttaggtgaaacaatgagtgaatttcctctagatccccagatgtcaaag 420

                                                                        
Query: 1577 atgcttgtcatcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatg 1636
            |||||||||||||||||||  ||||||||||||||||||||||| |||||||||||||||
Sbjct: 421  atgcttgtcatcagtccaaaatacaactgttcaaatgagatcctttcaatatctgccatg 480

                   
Query: 1637 ctatcag 1643
            || ||||
Sbjct: 481  ctgtcag 487



to top

>gb|AY104714.1| Zea mays PCO124238 mRNA sequence
          Length = 1218

 Score =  553 bits (279), Expect = e-153
 Identities = 513/591 (86%)
 Strand = Plus / Plus

                                                                        
Query: 2013 acccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggctcg 2072
            |||||||||||| |||||||||||||| || |||||||||||||||||||| ||||||||
Sbjct: 291  acccaattgcttcctccggcctagggaagctcaaaaggctgctgatgaggccaaggctcg 350

                                                                        
Query: 2073 atttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaagca 2132
            |||||| ||||| |||||||| ||||| || ||||||||||| |||||||||||||| ||
Sbjct: 351  atttggccacattgacggggaccatctgacgcttctgaatgtataccatgcatacaaaca 410

                                                                        
Query: 2133 aaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaagtc 2192
            ||||||||| |||||    |||||||| ||||| ||||||||| |  | ||  | |||||
Sbjct: 411  aaacaatgaagatccccagtggtgttacgagaactttgtcaattcaagagcacttaagtc 470

                                                                        
Query: 2193 tgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagatgtg 2252
            ||| || ||||| |||||||| ||||| ||||||||||| ||||||||||||||||||||
Sbjct: 471  tgcagacaatgtcagacaacagcttgttcgcatcatgactagattcaacctcaagatgtg 530

                                                                        
Query: 2253 cagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttcggg 2312
            ||| || || ||||| || ||||||||||| ||||||||||||||| |  ||||| | ||
Sbjct: 531  cagcacggatttcaatagccgtgagtactacgtcaatatcaggaaaaccctgcttgcagg 590

                                                                        
Query: 2313 gtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataa 2372
            ||| || |||||||| |||||  |||| |||||||| |||||| |||| || || |||||
Sbjct: 591  gtatttcatgcaggtcgctcacctggaacgaactggacattacctgactgtaaaagataa 650

                                                                        
Query: 2373 tcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatcta 2432
             ||||| ||||||||||||||||| ||||||||||||||||| || ||||||||||||||
Sbjct: 651  ccaggtcgtccatcttcatccctccaattgtatggaccataaaccagagtgggtcatcta 710

                                                                        
Query: 2433 caatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccgtggaga 2492
             |||||||||||  ||||||||||||||||||| || |||||||||||||||||||| ||
Sbjct: 711  taatgaatatgtcttgaccaccaggaatttcattcgcacagtcaccgatatccgtgggga 770

                                                                        
Query: 2493 gtggctgatcgatatagctccacagtactatgatctgaccaatttcccgtcatgtgaggc 2552
             ||||| || ||||| || ||||| ||||||||||||| |||||||||||||||||||||
Sbjct: 771  ctggctaattgatattgcgccacattactatgatctgagcaatttcccgtcatgtgaggc 830

                                                               
Query: 2553 caagcgtgtcctggagaggctgcacaataagagggagagggaaagagctgc 2603
            ||||||||| || ||||||||| | || ||| | |||||||||||||||||
Sbjct: 831  caagcgtgttcttgagaggctgtataacaagcgagagagggaaagagctgc 881



 Score =  274 bits (138), Expect = 2e-69
 Identities = 251/289 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1355 ccagaaatccttcggtcaaacctcgcaaacacagttcttactctgaagaagcttggaatt 1414
            ||||| || |||||||| ||||| ||||| |||||||||||  ||||||| |||||||||
Sbjct: 1    ccaganattcttcggtcgaacctggcaaatacagttcttaccttgaagaaacttggaatt 60

                                                                        
Query: 1415 gatgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgagggcc 1474
            ||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||
Sbjct: 61   gatgatttagtgcattttgactttatggatcctccagcaccagaaactctaatgagggcc 120

                                                                        
Query: 1475 ttggaagttctgaactatttgggggcactcgacgatgaaggcaacctaacatctttaggt 1534
            || |||||| ||||||||||||| ||||| || |||||||| || || |||   ||||||
Sbjct: 121  ttagaagttttgaactatttgggtgcactagatgatgaaggtaatctgacacagttaggt 180

                                                                        
Query: 1535 gaaatgatgagtgagttccccttagacccacagatgtcaaagatgcttgtcatcagtcca 1594
            || |||||||||||||| ||| | || ||||| ||||| |||||||| ||||||||||||
Sbjct: 181  gagatgatgagtgagtttcccctggatccacaaatgtcgaagatgctcgtcatcagtcca 240

                                                             
Query: 1595 aggtacaactgttcaaatgagatcctctcaatatctgccatgctatcag 1643
            |  ||||||||||| ||||| ||| | ||| ||||||||||||| ||||
Sbjct: 241  aaatacaactgttcgaatgaaatcttatcagtatctgccatgctgtcag 289



to top

>gb|BT012737.1| Lycopersicon esculentum clone 113675R, mRNA sequence
          Length = 2642

 Score =  349 bits (176), Expect = 4e-92
 Identities = 806/1016 (79%)
 Strand = Plus / Plus

                                                                        
Query: 437  cggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggatgtcacaatc 496
            |||||||| ||||||||||| |||||||| ||||| || || |||||||||||   ||| 
Sbjct: 378  cggagggtggctgcaatgtctgtctctcgtcgtgttgctgaagagatggatgttgtaatt 437

                                                                        
Query: 497  ggggaggaagttggttacagtatccgattcgaagattgcagcagtcacaaaactgttctc 556
            ||||| |||||||| || || || || || || || ||||  |||   | ||||||| | 
Sbjct: 438  ggggaagaagttggatatagcattcggtttgaggactgcactagtgctagaactgtttta 497

                                                                        
Query: 557  aaatatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaagg 616
            ||||| || ||||||||||||||| | |||||||||||||| || || || || ||| | 
Sbjct: 498  aaatacttaacagatggtatgcttttaagagaagcaatggcggatcctctattggaacgc 557

                                                                        
Query: 617  tacaaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgttt 676
            ||||| || ||| ||||||| || ||||||||  | || |||||||||||||| ||||||
Sbjct: 558  tacaaagtaattattcttgatgaagctcatgaaagaactttggcaacagatgtcctgttt 617

                                                                        
Query: 677  gggcttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgct 736
            |||||| ||||||| ||  | || || || || ||| | ||||| |||||||||||||| 
Sbjct: 618  gggcttttgaaagaggtgttgaaaaatagaccagacctaaagctagttgttatgagtgcc 677

                                                                        
Query: 737  actcttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcct 796
            || ||||| |||||||||||||||||||| |||  ||| |||||  | ||||| ||||| 
Sbjct: 678  acacttgaagcagagaagtttcagggttacttctttggtgcacctctcatgaaagttccc 737

                                                                        
Query: 797  ggtagacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaa 856
            || || || ||||| || || || ||||| || ||||| || || || |||||||| || 
Sbjct: 738  ggaaggctccatccagtggaaattttctacacgcaggatcctgagagagactatcttgag 797

                                                                        
Query: 857  gccgctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgta 916
            || || ||  |||| || |||||||| || |  ||||||||| ||||||| |||||||| 
Sbjct: 798  gctgccattcggactgtggtgcagattcacacatgtgaacctcctggtgacatccttgtt 857

                                                                        
Query: 917  ttcctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaat 976
            |||||||| ||||||||||||||||| ||||||||||| ||||| |  |||||| ||  |
Sbjct: 858  ttcctcaccggagaagaggagattgaagatgcatgtcgcaaaatcacaaaggaaattggt 917

                                                                        
Query: 977  aacatgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccct 1036
            || ||||||||||| || ||||| |||||||  |||||  | || ||||| || ||||| 
Sbjct: 918  aatatgggtgatcaagtaggccctgttaaagcggtgcctctttattctacacttcccccc 977

                                                                        
Query: 1037 gcaatgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgct 1096
            || |||||||| ||||| ||||| || |||||||| ||| |    ||||| || ||| ||
Sbjct: 978  gctatgcagcaaaagatatttgaaccggccccaccaccagttgtggagggtggtcctcct 1037

                                                                        
Query: 1097 ggaaggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtata 1156
            || ||||| ||||||||||| || |||||||| || ||||| || || || ||||| || 
Sbjct: 1038 ggcaggaagattgttgtgtcaaccaacattgcagaaacatctttgacaatagatggcatt 1097

                                                                        
Query: 1157 gtgtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtg 1216
            || ||||| ||||||||||| ||| | || || |||||||| || |||||| |  | |||
Sbjct: 1098 gtttatgtcatagatccaggatttgctaagcaaaaggtttataacccaagggtgcgtgtg 1157

                                                                        
Query: 1217 gaatcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgct 1276
            |||||  | ||||||||||| ||||| ||||| |||||||| || ||| | || ||||||
Sbjct: 1158 gaatctttgttggtgtctcctatttcaaaggccagtgcgcaccagagatcaggacgtgct 1217

                                                                        
Query: 1277 ggaagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgat 1336
            |||||||| ||||| || || ||||| ||  | |||||||| || |||||  ||  ||| 
Sbjct: 1218 ggaagaactcagccaggaaaatgctttagactttacacagaaaaaagtttccataatgac 1277

                                                                        
Query: 1337 ttacagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttact 1396
             | || || ||||| || |||||||| |||||||| ||  | || || |||||||| |||
Sbjct: 1278 cttcaaccccagacatatccagaaatacttcggtcgaatttggctaatacagttctaact 1337

                                                                    
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgc 1452
             |||||||||| || ||||||||  | || |||||||| || ||||||||||||||
Sbjct: 1338 ttgaagaagctaggtattgatgacctggttcattttgattttatggatcctcctgc 1393



 Score =  212 bits (107), Expect = 5e-51
 Identities = 474/595 (79%), Gaps = 1/595 (0%)
 Strand = Plus / Plus

                                                                        
Query: 1931 aagcaaatggtatcgtctcgcctctttgcatctgctgaccaaccatgggcttcgtctgtt 1990
            ||||||||||| ||||||||||| | |||||||||||||| ||  ||||| ||  |||| 
Sbjct: 1605 aagcaaatggtgtcgtctcgcctgtatgcatctgctgacctacagtgggcctccgctgtg 1664

                                                                        
Query: 1991 attaccatatcctttgtctagtacccaattgctttctccggcctagggaggcacaaaagg 2050
            || |||| ||  ||| ||||||||||||||||||| |||||||||||||||| ||||| |
Sbjct: 1665 ataacca-attttttctctagtacccaattgctttgtccggcctagggaggctcaaaaag 1723

                                                                        
Query: 2051 ctgctgatgaggcgaaggctcgatttgggcacatcgacggggatcatctcacacttctga 2110
            |||| ||||| || |||  ||| || || ||||| || ||||||||| | ||| | ||||
Sbjct: 1724 ctgcggatgaagcaaagaatcggttcggtcacatagatggggatcatttgacattgctga 1783

                                                                        
Query: 2111 atgtgtaccatgcatacaagcaaaacaatgaggatcctacatggtgttatgagaattttg 2170
            ||||||| ||||| |||||||||||| | |||||||||  ||||||||||||||||||  
Sbjct: 1784 atgtgtatcatgcgtacaagcaaaaccaggaggatcctcaatggtgttatgagaatttca 1843

                                                                        
Query: 2171 tcaatgcccgggcgatgaagtctgctgataatgttagacaacaacttgtccgcatcatga 2230
            |||||    ||||  | || || ||||| ||||| || || || |||   ||||| ||| 
Sbjct: 1844 tcaatcagagggctctcaaatcagctgacaatgtgaggcagcagctttctcgcataatgg 1903

                                                                        
Query: 2231 ccagattcaacctcaagatgtgcagtacagacttcaacagtcgtgagtactatgtcaata 2290
            |||| |||||||||||| | ||||| ||||| ||||||||||| ||||||||||| || |
Sbjct: 1904 ccaggttcaacctcaagttatgcagcacagatttcaacagtcgcgagtactatgtgaaca 1963

                                                                        
Query: 2291 tcaggaaagcaatgctttcggggtactttatgcaggttgctcatttggagcgaactgggc 2350
            | ||||| || ||| |  | || || || ||||||||||| ||  | ||||| |||||||
Sbjct: 1964 taaggaaggctatgttagccggatatttcatgcaggttgcacacctagagcgtactgggc 2023

                                                                        
Query: 2351 attacttgaccgttaaggataatcaggttgtccatcttcatccctcgaattgtatggacc 2410
            ||||  | |||||||| || ||||| || || ||  | ||||| || |||||  |||| |
Sbjct: 2024 attatctaaccgttaaagacaatcaagtggtacacttgcatccttcaaattgcctggatc 2083

                                                                        
Query: 2411 ataagccggagtgggtcatctacaatgaatatgttctgaccaccaggaatttcatccgta 2470
            | ||||| || ||||| || || |||||||||||  | || | ||||||||||||||| |
Sbjct: 2084 acaagccagaatgggttatatataatgaatatgtcttaacaagcaggaatttcatccgca 2143

                                                                   
Query: 2471 cagtcaccgatatccgtggagagtggctgatcgatatagctccacagtactatga 2525
            | || || ||||||||||| || ||| || | ||||| || ||||| ||||||||
Sbjct: 2144 ctgtgactgatatccgtggcgaatggttggttgatattgcaccacactactatga 2198



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1616 atcctctcaatatctgccatgctatcag 1643
            ||||||||||||||||||||| ||||||
Sbjct: 1557 atcctctcaatatctgccatgttatcag 1584



to top

>gb|AC153352.19| Medicago truncatula clone mth2-103l4, complete sequence
          Length = 130178

 Score =  295 bits (149), Expect = 5e-76
 Identities = 509/629 (80%)
 Strand = Plus / Minus

                                                                         
Query: 566   acagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtacaaggtg 625
             ||||||||||||||| |||||||||||||| |||| |||||||| ||  | ||||| || 
Sbjct: 48890 acagatggtatgcttttgagagaagcaatgacagatccacttttggagcgatacaaagta 48831

                                                                         
Query: 626   attgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgggcttctg 685
             ||  ||||||| ||||| |||||  | || ||||| |||||||| || ||||| ||||| 
Sbjct: 48830 ataattcttgatgaggcacatgaaaggactttggctacagatgtgctatttggtcttctc 48771

                                                                         
Query: 686   aaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctactcttgag 745
             || |||||||| || ||||| |||||||||||| | || ||||||||||| || ||||| 
Sbjct: 48770 aaggaagttcttaaaaacagacctgacttgaagttggtggttatgagtgcaacacttgaa 48711

                                                                         
Query: 746   gcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggtagactt 805
             || || ||||||||||| |||||   ||| || ||  | ||||| |||||||| || || 
Sbjct: 48710 gctgaaaagtttcagggctatttttttggtgcccctcttatgaaagttcctggcaggctg 48651

                                                                         
Query: 806   catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
             ||||| || || || || ||||| |||||||||||||| || ||  | || || ||||| 
Sbjct: 48650 catccagtggaaattttttatactcaggaaccagaaagagattacttggaggctgctatt 48591

                                                                         
Query: 866   aggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattcctcact 925
             |||||||| |||||||| || ||||||||||||||||| || || ||||| || || || 
Sbjct: 48590 aggacagtggtgcagattcacatgtgtgaacctgctggagacatacttgtttttcttacc 48531

                                                                         
Query: 926   ggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataacatgggt 985
             ||||| |||||||| || |||||||| || ||||||   || ||||||   |||||||| 
Sbjct: 48530 ggagaggaggagatagaagatgcatgccgcaaaatatctaaagaagttgcaaacatgggg 48471

                                                                         
Query: 986   gatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgcaatgcag 1045
             || ||||| ||||| || |||| ||||||||| || |||||||| ||||| || ||||| 
Sbjct: 48470 gaccaggtgggccctgtgaaagccgtgccattatattctactcttcccccagctatgcaa 48411

                                                                         
Query: 1046  cagaagatttttgaccctgccccacctccattgaaagagggaggccctgctggaaggaaa 1105
             |||||||||||||| || || ||||||||| | || |||||||||||  |||||||||| 
Sbjct: 48410 cagaagatttttgagccagctccacctccagttaaggagggaggcccccctggaaggaag 48351

                                                                         
Query: 1106  attgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgtt 1165
             ||||| || || |||||||| || || || ||||| || |||||||||||||| ||||||
Sbjct: 48350 attgtggtatcaacaaacatagcagaaacttccttgacaattgatggtatagtctatgtt 48291

                                          
Query: 1166  atagatccagggttttccaaacagaaggt 1194
             || ||||| || ||| | || ||||||||
Sbjct: 48290 attgatcctggatttgctaagcagaaggt 48262



 Score =  149 bits (75), Expect = 7e-32
 Identities = 336/423 (79%)
 Strand = Plus / Minus

                                                                         
Query: 1226  ttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaacg 1285
             |||||||||||||| || || || ||||| || || ||  |||| |||||||||||||| 
Sbjct: 48230 ttggtgtctccaatatcaaaagctagtgcacaccagaggtctggacgtgctggaagaact 48171

                                                                         
Query: 1286  cagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgatttacagccg 1345
             ||||| ||||| ||||| ||  | || || || |  ||||| |||  |||| | ||||||
Sbjct: 48170 cagccggggaaatgctttagactttataccgaaagaagtttcaataatgatcttcagccg 48111

                                                                         
Query: 1346  cagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctgaagaag 1405
             |||||||| || |||||  |  | || || || || ||||||||||||||  ||||||| 
Sbjct: 48110 cagacctatcctgaaattttgagatctaatcttgccaacacagttcttacattgaagaaa 48051

                                                                         
Query: 1406  cttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactcta 1465
             || || || ||||||||||| ||||||||||||||||| |||||||| ||||||||  | 
Sbjct: 48050 ctgggtatagatgatttagttcattttgacttcatggaccctcctgcccctgaaaccttg 47991

                                                                         
Query: 1466  atgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaacctaaca 1525
             ||| | || ||||||||  |||| || ||||| ||||| || |||||||| ||| |||||
Sbjct: 47990 atgcgtgctttggaagtgttgaattacttgggtgcactggatgatgaaggtaacttaaca 47931

                                                                         
Query: 1526  tctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgcttgtc 1585
                 | ||||| || ||||||||||| || || ||||| |||||||||||||||||||| 
Sbjct: 47930 aagcttggtgagattatgagtgagtttccattggaccctcagatgtcaaagatgcttgtt 47871

                                                                         
Query: 1586  atcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatgctatcaggt 1645
              | |||||   || ||||||||| |||||||| || ||||| ||||| ||| | ||||||
Sbjct: 47870 gttagtcctgagttcaactgttcgaatgagattctttcaatttctgcgatgttgtcaggt 47811

                
Query: 1646  atg 1648
             |||
Sbjct: 47810 atg 47808



 Score =  129 bits (65), Expect = 6e-26
 Identities = 113/129 (87%)
 Strand = Plus / Minus

                                                                         
Query: 2009  tagtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaagg 2068
             ||||||||||||||||| |||||||||||||||||||||| ||||| ||||| || || |
Sbjct: 47403 tagtacccaattgctttatccggcctagggaggcacaaaaagctgcggatgaagccaaag 47344

                                                                         
Query: 2069  ctcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcataca 2128
             || | ||||| ||||| || || ||||||||||||||  ||||||| |||||||| ||||
Sbjct: 47343 ctaggtttggacacattgatggagatcatctcacactcttgaatgtataccatgcctaca 47284

                      
Query: 2129  agcaaaaca 2137
             |||||||||
Sbjct: 47283 agcaaaaca 47275



 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                         
Query: 2389  catccctcgaattgtatggaccataagccggagtgggtcatctacaatgaatatgttctg 2448
             ||||| || |||||| ||||||| ||||| |||||||| |||||||||||||||||||| 
Sbjct: 46806 catccatcaaattgtctggaccacaagcccgagtgggttatctacaatgaatatgttctt 46747

                                                      
Query: 2449  accaccaggaatttcatccgtacagtcaccgatatccgtgg 2489
             || |   |||||||||| ||||| || || ||||| |||||
Sbjct: 46746 acgagtcggaatttcatacgtactgtgacagatattcgtgg 46706



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 146/186 (78%)
 Strand = Plus / Minus

                                                                         
Query: 2194  gctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagatgtgc 2253
             |||||||||||| ||||||| || || || |||||| | || || ||||| ||| | |||
Sbjct: 47112 gctgataatgttcgacaacagctagtgcgtatcatggctaggtttaacctgaagttatgc 47053

                                                                         
Query: 2254  agtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttcgggg 2313
             || || |||||||| ||||| || ||||| ||||| || || || |||||| |  | || 
Sbjct: 47052 agcactgacttcaatagtcgcgactactacgtcaacataagaaaggcaatgttagcagga 46993

                                                                         
Query: 2314  tactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataat 2373
             || || |||||||| |||||| | ||||| || || || |||||||| ||||| || || 
Sbjct: 46992 tatttcatgcaggtggctcatcttgagcggacaggacactacttgacagttaaagacaac 46933

                   
Query: 2374  caggtt 2379
             ||||||
Sbjct: 46932 caggtt 46927



to top

>ref|NM_116096.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ RNA
            helicase/ helicase/ nucleic acid binding (AT3G62310)
            mRNA, complete cds
          Length = 2580

 Score =  256 bits (129), Expect = 4e-64
 Identities = 513/641 (80%)
 Strand = Plus / Plus

                                                                        
Query: 425  tgcacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatg 484
            ||||| ||||| || || |||||||| ||||| || || || ||||| || || ||||||
Sbjct: 478  tgcacacagcctcgtagagttgctgccatgtctgtgtcccgtcgtgttgctgaagagatg 537

                                                                        
Query: 485  gatgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcac 544
            ||||| || || ||||| |||||||||||||| ||||| ||||| || ||||| || | |
Sbjct: 538  gatgtaactattggggaagaagttggttacagcatccgtttcgaggactgcagtagcccc 597

                                                                        
Query: 545  aaaactgttctcaaatatttgacagatggtatgcttctgagagaagcaatggcagaccca 604
            | ||| ||||| || || ||||| ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 598  agaacggttcttaagtacttgactgatggtatgctcctgagagaagcaatggcggaccct 657

                                                                        
Query: 605  cttttagaaaggtacaaggtgattgttcttgacgaggctcatgagcgcacgttggcaaca 664
            ||| |||| || ||||| || ||| ||||||| ||||| || ||  | ||  | || |||
Sbjct: 658  cttctagagagatacaaagtcattattcttgatgaggcccacgaaaggactctagccaca 717

                                                                        
Query: 665  gatgttctgtttgggcttctgaaagaagttctaaagaacaggcctgacttgaagcttgtt 724
            ||||| |||||||| ||||||||||||||  | || || || |||||  | ||| | |||
Sbjct: 718  gatgtgctgtttggtcttctgaaagaagtgttgaaaaatagacctgatcttaagttagtt 777

                                                                        
Query: 725  gttatgagtgctactcttgaggcagagaagtttcagggttatttcagtggggcaccattg 784
            || |||||||| ||||| || || || |||||||||| |||||| || || || ||  ||
Sbjct: 778  gtgatgagtgcaactctagaagctgaaaagtttcaggattattttagcggtgctcctctg 837

                                                                        
Query: 785  atgaaggttcctggtagacttcatccggttgagatcttctatacccaggaaccagaaagg 844
            ||||| ||||||||||| |||||||| ||||||||||| || || ||||| || || |||
Sbjct: 838  atgaaagttcctggtaggcttcatccagttgagatcttttacactcaggagcctgagagg 897

                                                                        
Query: 845  gactatctagaagccgctatcaggacagttgtgcagatacatatgtgtgaacctgctggt 904
            |||||||| || || ||||| || || ||||| ||||| || |||||||| ||  |||| 
Sbjct: 898  gactatcttgaggctgctattagaactgttgtccagattcacatgtgtgagccacctggc 957

                                                                        
Query: 905  gatatccttgtattcctcactggagaagaggagattgaggatgcatgtcgaaaaataaac 964
            ||||| ||||| ||| | ||||| || ||||||||||| |||||||| || ||||| || 
Sbjct: 958  gatattcttgttttcttaactggggaggaggagattgaagatgcatgccgcaaaatcaat 1017

                                                                        
Query: 965  aaggaagttaataacatgggtgatcaggttggcccagttaaagtcgtgccattgtactct 1024
            || || |||  |||  | || ||||| || || ||  ||||||| |||||| |||| |||
Sbjct: 1018 aaagaggttggtaatcttggggatcaagtggggcctattaaagtagtgccactgtattct 1077

                                                     
Query: 1025 actctcccccctgcaatgcagcagaagatttttgaccctgc 1065
            ||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 1078 actcttccacctgcgatgcagcagaagatatttgatcctgc 1118



 Score =  167 bits (84), Expect = 3e-37
 Identities = 288/356 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1226 ttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaacg 1285
            |||||||| |||||||| ||||||||||| || || ||| |||||||||| || ||||| 
Sbjct: 1279 ttggtgtccccaatttcaaaggcaagtgctcaccagagatctggtcgtgccggtagaaca 1338

                                                                        
Query: 1286 cagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgatttacagccg 1345
            | |||||| || ||||||||| | |||||||||||||||||||||  ||| || ||||||
Sbjct: 1339 cggcctggaaaatgcttcaggctttacacagagaagagttttaataatgacttgcagccg 1398

                                                                        
Query: 1346 cagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctgaagaag 1405
            ||||| || || |||||  |  | |||||||| ||||| |||||||| ||  |||| || 
Sbjct: 1399 cagacgtatcctgaaatattgagatcaaaccttgcaaatacagttctgaccttgaaaaaa 1458

                                                                        
Query: 1406 cttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactcta 1465
            || || |||||||| || ||||| ||||| || |||||||| ||||| || ||||| || 
Sbjct: 1459 ctgggtattgatgacttggtgcactttgattttatggatccccctgctcccgaaacactg 1518

                                                                        
Query: 1466 atgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaacctaaca 1525
            ||| | ||||| |||||| |||| || ||||| ||||| || ||||| || ||| | |||
Sbjct: 1519 atgcgagccttagaagttttgaattacttgggagcactggatgatgatggtaacttgaca 1578

                                                                    
Query: 1526 tctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgct 1581
                 |||||| || ||||||||||||||||| || ||||||||| ||||||||||
Sbjct: 1579 aagacaggtgagatcatgagtgagttccccttggatccacagatggcaaagatgct 1634



 Score =  137 bits (69), Expect = 3e-28
 Identities = 360/457 (78%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||| ||||||||| | |||||||| ||||| ||||| || || ||||| || || ||
Sbjct: 1695 agtaccgaattgctttattcggcctagagaggctcaaaaagcagcagatgaagctaaagc 1754

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            | | ||||| ||||| || || ||||| |||||| |  ||||||| ||||| || | |||
Sbjct: 1755 taggtttggacacattgagggagatcacctcacattgttgaatgtctaccacgctttcaa 1814

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            |||||||||||||||||| |  ||||| ||||| || ||  ||||     | ||||||||
Sbjct: 1815 gcaaaacaatgaggatccaaattggtgctatgaaaacttcatcaacaatagagcgatgaa 1874

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
             ||||| || ||||||||||| || || ||||| || ||| | ||||||||||| |||||
Sbjct: 1875 atctgcagacaatgttagacagcagctagtccggataatgtcaagattcaacctgaagat 1934

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| || || || ||||| || || |||||  |||| || ||||| || |||||| |
Sbjct: 1935 gtgcagcactgattttaacagccgcgactactacatcaacataaggaaggccatgcttgc 1994

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             || || || ||||| || ||||| || || || ||||| |||||||||||||| || ||
Sbjct: 1995 cggttatttcatgcaagtggctcacttagaacgtactggccattacttgaccgtcaaaga 2054

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
             || || || || ||| | ||||| || |||||  |||| || || ||||||||||| ||
Sbjct: 2055 caaccaagtggttcatttgcatccatccaattgcttggatcacaaaccggagtgggtaat 2114

                                                 
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatc 2466
            |||||| ||||||||| |||| | | |||||||||||
Sbjct: 2115 ctacaacgaatatgttttgactagccggaatttcatc 2151



to top

>gb|BT010331.1| Arabidopsis thaliana At3g62310 mRNA, complete cds
          Length = 2181

 Score =  256 bits (129), Expect = 4e-64
 Identities = 513/641 (80%)
 Strand = Plus / Plus

                                                                        
Query: 425  tgcacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatg 484
            ||||| ||||| || || |||||||| ||||| || || || ||||| || || ||||||
Sbjct: 349  tgcacacagcctcgtagagttgctgccatgtctgtgtcccgtcgtgttgctgaagagatg 408

                                                                        
Query: 485  gatgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcac 544
            ||||| || || ||||| |||||||||||||| ||||| ||||| || ||||| || | |
Sbjct: 409  gatgtaactattggggaagaagttggttacagcatccgtttcgaggactgcagtagcccc 468

                                                                        
Query: 545  aaaactgttctcaaatatttgacagatggtatgcttctgagagaagcaatggcagaccca 604
            | ||| ||||| || || ||||| ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 469  agaacggttcttaagtacttgactgatggtatgctcctgagagaagcaatggcggaccct 528

                                                                        
Query: 605  cttttagaaaggtacaaggtgattgttcttgacgaggctcatgagcgcacgttggcaaca 664
            ||| |||| || ||||| || ||| ||||||| ||||| || ||  | ||  | || |||
Sbjct: 529  cttctagagagatacaaagtcattattcttgatgaggcccacgaaaggactctagccaca 588

                                                                        
Query: 665  gatgttctgtttgggcttctgaaagaagttctaaagaacaggcctgacttgaagcttgtt 724
            ||||| |||||||| ||||||||||||||  | || || || |||||  | ||| | |||
Sbjct: 589  gatgtgctgtttggtcttctgaaagaagtgttgaaaaatagacctgatcttaagttagtt 648

                                                                        
Query: 725  gttatgagtgctactcttgaggcagagaagtttcagggttatttcagtggggcaccattg 784
            || |||||||| ||||| || || || |||||||||| |||||| || || || ||  ||
Sbjct: 649  gtgatgagtgcaactctagaagctgaaaagtttcaggattattttagcggtgctcctctg 708

                                                                        
Query: 785  atgaaggttcctggtagacttcatccggttgagatcttctatacccaggaaccagaaagg 844
            ||||| ||||||||||| |||||||| ||||||||||| || || ||||| || || |||
Sbjct: 709  atgaaagttcctggtaggcttcatccagttgagatcttttacactcaggagcctgagagg 768

                                                                        
Query: 845  gactatctagaagccgctatcaggacagttgtgcagatacatatgtgtgaacctgctggt 904
            |||||||| || || ||||| || || ||||| ||||| || |||||||| ||  |||| 
Sbjct: 769  gactatcttgaggctgctattagaactgttgtccagattcacatgtgtgagccacctggc 828

                                                                        
Query: 905  gatatccttgtattcctcactggagaagaggagattgaggatgcatgtcgaaaaataaac 964
            ||||| ||||| ||| | ||||| || ||||||||||| |||||||| || ||||| || 
Sbjct: 829  gatattcttgttttcttaactggggaggaggagattgaagatgcatgccgcaaaatcaat 888

                                                                        
Query: 965  aaggaagttaataacatgggtgatcaggttggcccagttaaagtcgtgccattgtactct 1024
            || || |||  |||  | || ||||| || || ||  ||||||| |||||| |||| |||
Sbjct: 889  aaagaggttggtaatcttggggatcaagtggggcctattaaagtagtgccactgtattct 948

                                                     
Query: 1025 actctcccccctgcaatgcagcagaagatttttgaccctgc 1065
            ||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 949  actcttccacctgcgatgcagcagaagatatttgatcctgc 989



 Score =  167 bits (84), Expect = 3e-37
 Identities = 288/356 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1226 ttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaacg 1285
            |||||||| |||||||| ||||||||||| || || ||| |||||||||| || ||||| 
Sbjct: 1150 ttggtgtccccaatttcaaaggcaagtgctcaccagagatctggtcgtgccggtagaaca 1209

                                                                        
Query: 1286 cagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgatttacagccg 1345
            | |||||| || ||||||||| | |||||||||||||||||||||  ||| || ||||||
Sbjct: 1210 cggcctggaaaatgcttcaggctttacacagagaagagttttaataatgacttgcagccg 1269

                                                                        
Query: 1346 cagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctgaagaag 1405
            ||||| || || |||||  |  | |||||||| ||||| |||||||| ||  |||| || 
Sbjct: 1270 cagacgtatcctgaaatattgagatcaaaccttgcaaatacagttctgaccttgaaaaaa 1329

                                                                        
Query: 1406 cttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactcta 1465
            || || |||||||| || ||||| ||||| || |||||||| ||||| || ||||| || 
Sbjct: 1330 ctgggtattgatgacttggtgcactttgattttatggatccccctgctcccgaaacactg 1389

                                                                        
Query: 1466 atgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaacctaaca 1525
            ||| | ||||| |||||| |||| || ||||| ||||| || ||||| || ||| | |||
Sbjct: 1390 atgcgagccttagaagttttgaattacttgggagcactggatgatgatggtaacttgaca 1449

                                                                    
Query: 1526 tctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgct 1581
                 |||||| || ||||||||||||||||| || ||||||||| ||||||||||
Sbjct: 1450 aagacaggtgagatcatgagtgagttccccttggatccacagatggcaaagatgct 1505



 Score =  137 bits (69), Expect = 3e-28
 Identities = 360/457 (78%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||| ||||||||| | |||||||| ||||| ||||| || || ||||| || || ||
Sbjct: 1566 agtaccgaattgctttattcggcctagagaggctcaaaaagcagcagatgaagctaaagc 1625

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            | | ||||| ||||| || || ||||| |||||| |  ||||||| ||||| || | |||
Sbjct: 1626 taggtttggacacattgagggagatcacctcacattgttgaatgtctaccacgctttcaa 1685

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            |||||||||||||||||| |  ||||| ||||| || ||  ||||     | ||||||||
Sbjct: 1686 gcaaaacaatgaggatccaaattggtgctatgaaaacttcatcaacaatagagcgatgaa 1745

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
             ||||| || ||||||||||| || || ||||| || ||| | ||||||||||| |||||
Sbjct: 1746 atctgcagacaatgttagacagcagctagtccggataatgtcaagattcaacctgaagat 1805

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| || || || ||||| || || |||||  |||| || ||||| || |||||| |
Sbjct: 1806 gtgcagcactgattttaacagccgcgactactacatcaacataaggaaggccatgcttgc 1865

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             || || || ||||| || ||||| || || || ||||| |||||||||||||| || ||
Sbjct: 1866 cggttatttcatgcaagtggctcacttagaacgtactggccattacttgaccgtcaaaga 1925

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
             || || || || ||| | ||||| || |||||  |||| || || ||||||||||| ||
Sbjct: 1926 caaccaagtggttcatttgcatccatccaattgcttggatcacaaaccggagtgggtaat 1985

                                                 
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatc 2466
            |||||| ||||||||| |||| | | |||||||||||
Sbjct: 1986 ctacaacgaatatgttttgactagccggaatttcatc 2022



to top

>gb|AY120782.1| Arabidopsis thaliana ATP-dependent RNA helicase-like protein
            (At3g62310) mRNA, complete cds
          Length = 2558

 Score =  256 bits (129), Expect = 4e-64
 Identities = 513/641 (80%)
 Strand = Plus / Plus

                                                                        
Query: 425  tgcacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatg 484
            ||||| ||||| || || |||||||| ||||| || || || ||||| || || ||||||
Sbjct: 456  tgcacacagcctcgtagagttgctgccatgtctgtgtcccgtcgtgttgctgaagagatg 515

                                                                        
Query: 485  gatgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcagcagtcac 544
            ||||| || || ||||| |||||||||||||| ||||| ||||| || ||||| || | |
Sbjct: 516  gatgtaactattggggaagaagttggttacagcatccgtttcgaggactgcagtagcccc 575

                                                                        
Query: 545  aaaactgttctcaaatatttgacagatggtatgcttctgagagaagcaatggcagaccca 604
            | ||| ||||| || || ||||| ||||||||||| ||||||||||||||||| ||||| 
Sbjct: 576  agaacggttcttaagtacttgactgatggtatgctcctgagagaagcaatggcggaccct 635

                                                                        
Query: 605  cttttagaaaggtacaaggtgattgttcttgacgaggctcatgagcgcacgttggcaaca 664
            ||| |||| || ||||| || ||| ||||||| ||||| || ||  | ||  | || |||
Sbjct: 636  cttctagagagatacaaagtcattattcttgatgaggcccacgaaaggactctagccaca 695

                                                                        
Query: 665  gatgttctgtttgggcttctgaaagaagttctaaagaacaggcctgacttgaagcttgtt 724
            ||||| |||||||| ||||||||||||||  | || || || |||||  | ||| | |||
Sbjct: 696  gatgtgctgtttggtcttctgaaagaagtgttgaaaaatagacctgatcttaagttagtt 755

                                                                        
Query: 725  gttatgagtgctactcttgaggcagagaagtttcagggttatttcagtggggcaccattg 784
            || |||||||| ||||| || || || |||||||||| |||||| || || || ||  ||
Sbjct: 756  gtgatgagtgcaactctagaagctgaaaagtttcaggattattttagcggtgctcctctg 815

                                                                        
Query: 785  atgaaggttcctggtagacttcatccggttgagatcttctatacccaggaaccagaaagg 844
            ||||| ||||||||||| |||||||| ||||||||||| || || ||||| || || |||
Sbjct: 816  atgaaagttcctggtaggcttcatccagttgagatcttttacactcaggagcctgagagg 875

                                                                        
Query: 845  gactatctagaagccgctatcaggacagttgtgcagatacatatgtgtgaacctgctggt 904
            |||||||| || || ||||| || || ||||| ||||| || |||||||| ||  |||| 
Sbjct: 876  gactatcttgaggctgctattagaactgttgtccagattcacatgtgtgagccacctggc 935

                                                                        
Query: 905  gatatccttgtattcctcactggagaagaggagattgaggatgcatgtcgaaaaataaac 964
            ||||| ||||| ||| | ||||| || ||||||||||| |||||||| || ||||| || 
Sbjct: 936  gatattcttgttttcttaactggggaggaggagattgaagatgcatgccgcaaaatcaat 995

                                                                        
Query: 965  aaggaagttaataacatgggtgatcaggttggcccagttaaagtcgtgccattgtactct 1024
            || || |||  |||  | || ||||| || || ||  ||||||| |||||| |||| |||
Sbjct: 996  aaagaggttggtaatcttggggatcaagtggggcctattaaagtagtgccactgtattct 1055

                                                     
Query: 1025 actctcccccctgcaatgcagcagaagatttttgaccctgc 1065
            ||||| || ||||| |||||||||||||| ||||| |||||
Sbjct: 1056 actcttccacctgcgatgcagcagaagatatttgatcctgc 1096



 Score =  167 bits (84), Expect = 3e-37
 Identities = 288/356 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1226 ttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaacg 1285
            |||||||| |||||||| ||||||||||| || || ||| |||||||||| || ||||| 
Sbjct: 1257 ttggtgtccccaatttcaaaggcaagtgctcaccagagatctggtcgtgccggtagaaca 1316

                                                                        
Query: 1286 cagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgatttacagccg 1345
            | |||||| || ||||||||| | |||||||||||||||||||||  ||| || ||||||
Sbjct: 1317 cggcctggaaaatgcttcaggctttacacagagaagagttttaataatgacttgcagccg 1376

                                                                        
Query: 1346 cagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctgaagaag 1405
            ||||| || || |||||  |  | |||||||| ||||| |||||||| ||  |||| || 
Sbjct: 1377 cagacgtatcctgaaatattgagatcaaaccttgcaaatacagttctgaccttgaaaaaa 1436

                                                                        
Query: 1406 cttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactcta 1465
            || || |||||||| || ||||| ||||| || |||||||| ||||| || ||||| || 
Sbjct: 1437 ctgggtattgatgacttggtgcactttgattttatggatccccctgctcccgaaacactg 1496

                                                                        
Query: 1466 atgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaacctaaca 1525
            ||| | ||||| |||||| |||| || ||||| ||||| || ||||| || ||| | |||
Sbjct: 1497 atgcgagccttagaagttttgaattacttgggagcactggatgatgatggtaacttgaca 1556

                                                                    
Query: 1526 tctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgct 1581
                 |||||| || ||||||||||||||||| || ||||||||| ||||||||||
Sbjct: 1557 aagacaggtgagatcatgagtgagttccccttggatccacagatggcaaagatgct 1612



 Score =  137 bits (69), Expect = 3e-28
 Identities = 360/457 (78%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||| ||||||||| | |||||||| ||||| ||||| || || ||||| || || ||
Sbjct: 1673 agtaccgaattgctttattcggcctagagaggctcaaaaagcagcagatgaagctaaagc 1732

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            | | ||||| ||||| || || ||||| |||||| |  ||||||| ||||| || | |||
Sbjct: 1733 taggtttggacacattgagggagatcacctcacattgttgaatgtctaccacgctttcaa 1792

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            |||||||||||||||||| |  ||||| ||||| || ||  ||||     | ||||||||
Sbjct: 1793 gcaaaacaatgaggatccaaattggtgctatgaaaacttcatcaacaatagagcgatgaa 1852

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
             ||||| || ||||||||||| || || ||||| || ||| | ||||||||||| |||||
Sbjct: 1853 atctgcagacaatgttagacagcagctagtccggataatgtcaagattcaacctgaagat 1912

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| || || || ||||| || || |||||  |||| || ||||| || |||||| |
Sbjct: 1913 gtgcagcactgattttaacagccgcgactactacatcaacataaggaaggccatgcttgc 1972

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             || || || ||||| || ||||| || || || ||||| |||||||||||||| || ||
Sbjct: 1973 cggttatttcatgcaagtggctcacttagaacgtactggccattacttgaccgtcaaaga 2032

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
             || || || || ||| | ||||| || |||||  |||| || || ||||||||||| ||
Sbjct: 2033 caaccaagtggttcatttgcatccatccaattgcttggatcacaaaccggagtgggtaat 2092

                                                 
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatc 2466
            |||||| ||||||||| |||| | | |||||||||||
Sbjct: 2093 ctacaacgaatatgttttgactagccggaatttcatc 2129



to top

>gb|AC002337.3| Arabidopsis thaliana chromosome 2 clone T8I13 map CIC06C03, complete
             sequence
          Length = 88068

 Score =  252 bits (127), Expect = 6e-63
 Identities = 847/1087 (77%)
 Strand = Plus / Minus

                                                                         
Query: 560   tatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtac 619
             |||||||| |||||||||||| ||||||| |||||||| || || |||||||| || |||
Sbjct: 36599 tatttgactgatggtatgcttttgagagaggcaatggcggatccgcttttagagagatac 36540

                                                                         
Query: 620   aaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttggg 679
             || || ||| |||| || || ||||||||  | ||  | || || ||||| || ||||| 
Sbjct: 36539 aaagttattattctcgatgaagctcatgaaaggactctagccacggatgtgctctttggt 36480

                                                                         
Query: 680   cttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctact 739
             ||||| ||||| ||  | | ||| ||||||||  | ||||| ||||| |||||||| |||
Sbjct: 36479 cttctcaaagaggtcttgaggaataggcctgatcttaagctagttgtcatgagtgcaact 36420

                                                                         
Query: 740   cttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggt 799
              | || || || ||||||||||  ||||| || || || ||  | ||||| || ||||||
Sbjct: 36419 ttagaagctgaaaagtttcaggaatattttagcggtgctcctcttatgaaagtccctggt 36360

                                                                         
Query: 800   agacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagcc 859
             || |||||||| ||||||||||||||||| |||||||| || ||||| ||||| || || 
Sbjct: 36359 aggcttcatcctgttgagatcttctatacacaggaacctgagagggattatctcgaggct 36300

                                                                         
Query: 860   gctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattc 919
             ||||| ||||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| |||
Sbjct: 36299 gctataaggactgttgttcagatacacatgtgcgagccacctggagatattcttgttttc 36240

                                                                         
Query: 920   ctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataac 979
              | |||||||| ||||| || || ||||| || || ||||| || || || || |  || 
Sbjct: 36239 ttaactggagaggaggaaatagaagatgcttgccgtaaaatcaataaagaggtcagcaat 36180

                                                                         
Query: 980   atgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgca 1039
              | || ||||| || || || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 36179 cttggagatcaagtgggtcctgtcaaagttgtgcctttgtattctactcttccacctgcg 36120

                                                                         
Query: 1040  atgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgga 1099
             ||||||||||||||||| |||||||| |||   || || | ||| || || |||||||||
Sbjct: 36119 atgcagcagaagattttcgaccctgctccagtgccgttaacagaaggtggtcctgctgga 36060

                                                                         
Query: 1100  aggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtg 1159
              | || |||||||| || || |||||||| || || ||  ||||||||||||| || || 
Sbjct: 36059 cgaaagattgttgtctcaaccaacattgctgaaacctctctaaccattgatgggattgtt 36000

                                                                         
Query: 1160  tatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtggaa 1219
             |||||||| || || || ||| | || ||||| || ||||| ||| ||||  | || || 
Sbjct: 35999 tatgttattgaccctggttttgctaagcagaaagtctacaacccacggattcgagttgag 35940

                                                                         
Query: 1220  tcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgga 1279
             ||  | |||||||| ||||| || ||||||||||| || || ||| | ||||||||||| 
Sbjct: 35939 tcattgttggtgtccccaatatcaaaggcaagtgctcaccagagatcaggtcgtgctggt 35880

                                                                         
Query: 1280  agaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattta 1339
             ||||| |  ||||| || || || ||| | ||||||||||||||||| ||   |||  | 
Sbjct: 35879 agaactcgccctggaaaatgttttaggctctacacagagaagagtttcaacaatgacctg 35820

                                                                         
Query: 1340  cagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctg 1399
             ||||| ||||| || || || ||  |  | |||||||| ||||| ||||| || ||  ||
Sbjct: 35819 cagccacagacatatcctgagatattgagatcaaaccttgcaaatacagtcctgacattg 35760

                                                                         
Query: 1400  aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
             || || ||||| |||||||| || ||||| ||||| ||||||||||||||||| ||||| 
Sbjct: 35759 aaaaaacttggcattgatgacttggtgcactttgatttcatggatcctcctgctcctgag 35700

                                                                         
Query: 1460  actctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaac 1519
             || || ||| |||| || || |||||||| |||||||| ||||| || |||||||| |||
Sbjct: 35699 acactgatgcgggcattagaggttctgaattatttgggagcacttgatgatgaaggtaac 35640

                                                                         
Query: 1520  ctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatg 1579
              | |||      |||||||| |||||||| || ||||| || ||||| ||||||||||||
Sbjct: 35639 ttgacaaagacgggtgaaataatgagtgaatttcccttggatccacaaatgtcaaagatg 35580

                                                                         
Query: 1580  cttgtcatcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatgcta 1639
             ||  |  |||||||    | ||||||||| |||||||| |||||  | ||||| ||| ||
Sbjct: 35579 ctcatagtcagtcctgaattcaactgttccaatgagattctctcggtttctgcaatgtta 35520

                    
Query: 1640  tcaggta 1646
             |||||||
Sbjct: 35519 tcaggta 35513



 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 174/217 (80%), Gaps = 5/217 (2%)
 Strand = Plus / Minus

                                                                         
Query: 1931  aagcaaatggtatcgtctc--gcctctttgcatctgctgaccaa--ccatgggcttcgtc 1986
             |||||||||||||||||||  |||||| ||||||||||||||    |||||||| |  ||
Sbjct: 35178 aagcaaatggtatcgtctctcgcctctatgcatctgctgacctcttccatgggcatattc 35119

                                                                         
Query: 1987  tgttattaccata-tcctttgtctagtacccaattgctttctccggcctagggaggcaca 2045
             |||||| |  | | | |||| ||||||||| ||||||||| |||||||||| ||||| ||
Sbjct: 35118 tgttataaaaacaattctttctctagtaccgaattgctttgtccggcctagagaggctca 35059

                                                                         
Query: 2046  aaaggctgctgatgaggcgaaggctcgatttgggcacatcgacggggatcatctcacact 2105
             ||| || || ||||| || || ||| | ||||| ||||| || || ||||| || ||  |
Sbjct: 35058 aaaagcagcagatgaagctaaagctaggtttggacacattgatggagatcacctgacgtt 34999

                                                  
Query: 2106  tctgaatgtgtaccatgcatacaagcaaaacaatgag 2142
              || || |||||||| || ||||||||||||| ||||
Sbjct: 34998 gctaaacgtgtaccacgcctacaagcaaaacagtgag 34962



 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                         
Query: 2245  aagatgtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatg 2304
             ||||||||||| || || |||||||| || || ||||||||||| || || || || |||
Sbjct: 34763 aagatgtgcagcacggatttcaacagccgcgactactatgtcaacataagaaaggccatg 34704

                                                                         
Query: 2305  ctttcggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgtt 2364
             ||| | || || ||||||||||| |||||  | || || ||||| |||||||||||||| 
Sbjct: 34703 cttgctggttattttatgcaggtggctcacctagaacgcactggccattacttgaccgtc 34644

                     
Query: 2365  aaggataa 2372
             || |||||
Sbjct: 34643 aaagataa 34636



 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                         
Query: 428   acccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggat 487
             |||||||| || || |||||||||||||| || ||||| ||||| || || || ||||||
Sbjct: 36817 acccagcctcgtagagttgctgcaatgtctgtgtctcgtcgtgttgctgatgaaatggat 36758

                                             
Query: 488   gtcacaatcggggaggaagttggttacagtat 519
             ||| | || || || |||||||||||||||||
Sbjct: 36757 gtctccattggtgaagaagttggttacagtat 36726



to top

>dbj|AK226886.1| Arabidopsis thaliana mRNA for putative pre-mRNA splicing factor RNA
            helicase, clone: RAFL09-09-N06
          Length = 2441

 Score =  250 bits (126), Expect = 2e-62
 Identities = 798/1022 (78%)
 Strand = Plus / Plus

                                                                        
Query: 560  tatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtac 619
            |||||||| |||||||||||| ||||||| |||||||| || || |||||||| || |||
Sbjct: 513  tatttgactgatggtatgcttttgagagaggcaatggcggatccgcttttagagagatac 572

                                                                        
Query: 620  aaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttggg 679
            || || ||| |||| || || ||||||||  | ||  | || || ||||| || ||||| 
Sbjct: 573  aaagttattattctcgatgaagctcatgaaaggactctagccacggatgtgctctttggt 632

                                                                        
Query: 680  cttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctact 739
            ||||| ||||| ||  | | ||| ||||||||  | ||||| ||||| |||||||| |||
Sbjct: 633  cttctcaaagaggtcttgaggaataggcctgatcttaagctagttgtcatgagtgcaact 692

                                                                        
Query: 740  cttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggt 799
             | || || || ||||||||||  ||||| || || || ||  | ||||| || ||||||
Sbjct: 693  ttagaagctgaaaagtttcaggaatattttagcggtgctcctcttatgaaagtccctggt 752

                                                                        
Query: 800  agacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagcc 859
            || |||||||| ||||||||||||||||| |||||||| || ||||| ||||| || || 
Sbjct: 753  aggcttcatcctgttgagatcttctatacacaggaacctgagagggattatctcgaggct 812

                                                                        
Query: 860  gctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattc 919
            ||||| ||||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| |||
Sbjct: 813  gctataaggactgttgttcagatacacatgtgcgagccacctggagatattcttgttttc 872

                                                                        
Query: 920  ctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataac 979
             | |||||||| ||||| || || ||||| || || ||||| || || || || |  || 
Sbjct: 873  ttaactggagaggaggaaatagaagatgcttgccgtaaaatcaataaagaggtcagcaat 932

                                                                        
Query: 980  atgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgca 1039
             | || ||||| || || || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 933  cttggagatcaagtgggtcctgtcaaagttgtgcctttgtattctactcttccacctgcg 992

                                                                        
Query: 1040 atgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgga 1099
            ||||||||||||||||| |||||||| |||   || || | ||| || || |||||||||
Sbjct: 993  atgcagcagaagattttcgaccctgctccagtgccgttaacagaaggtggtcctgctgga 1052

                                                                        
Query: 1100 aggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtg 1159
             | || |||||||| || || |||||||| || || ||  ||||||||||||| || || 
Sbjct: 1053 cgaaagattgttgtctcaaccaacattgctgaaacctctctaaccattgatgggattgtt 1112

                                                                        
Query: 1160 tatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtggaa 1219
            |||||||| || || || ||| | || ||||| || ||||| ||| ||||  | || || 
Sbjct: 1113 tatgttattgaccctggttttgctaagcagaaagtctacaacccacggattcgagttgag 1172

                                                                        
Query: 1220 tcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgga 1279
            ||  | |||||||| ||||| || ||||||||||| || || ||| | ||||||||||| 
Sbjct: 1173 tcattgttggtgtccccaatatcaaaggcaagtgctcaccagagatcaggtcgtgctggt 1232

                                                                        
Query: 1280 agaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattta 1339
            ||||| |  ||||| || || || ||| | ||||||||||||||||| ||   |||  | 
Sbjct: 1233 agaactcgccctggaaaatgttttaggctctacacagagaagagtttcaacaatgacctg 1292

                                                                        
Query: 1340 cagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctg 1399
            ||||| ||||| || || || ||  |  | |||||||| ||||| ||||| || ||  ||
Sbjct: 1293 cagccacagacatatcctgagatattgagatcaaaccttgcaaatacagtcctgacattg 1352

                                                                        
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
            || || ||||| |||||||| || ||||| ||||| ||||||||||||||||| ||||| 
Sbjct: 1353 aaaaaacttggcattgatgacttggtgcactttgatttcatggatcctcctgctcctgag 1412

                                                                        
Query: 1460 actctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaac 1519
            || || ||| |||| || || |||||||| |||||||| ||||| || |||||||| |||
Sbjct: 1413 acactgatgcgggcattagaggttctgaattatttgggagcacttgatgatgaaggtaac 1472

                                                                        
Query: 1520 ctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatg 1579
             | |||      |||||||| |||||||| || ||||| || ||||| ||||||||||||
Sbjct: 1473 ttgacaaagacgggtgaaataatgagtgaatttcccttggatccacaaatgtcaaagatg 1532

              
Query: 1580 ct 1581
            ||
Sbjct: 1533 ct 1534



 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 371/478 (77%), Gaps = 1/478 (0%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaag-gctgctgatgaggcgaagg 2068
            |||||| ||||||||| |||||||||| ||||| |||||  || || ||||| || || |
Sbjct: 1595 agtaccgaattgctttgtccggcctagagaggctcaaaaaagcagcagatgaagctaaag 1654

                                                                        
Query: 2069 ctcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcataca 2128
            || | ||||| ||||| || || ||||| || ||  | || || |||||||| || ||||
Sbjct: 1655 ctaggtttggacacattgatggagatcacctgacgttgctaaacgtgtaccacgcctaca 1714

                                                                        
Query: 2129 agcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatga 2188
            ||||||||||||| || || |  |||||||  ||||| ||||||||   | | || ||||
Sbjct: 1715 agcaaaacaatgaagacccaaactggtgtttcgagaactttgtcaacaacagagcaatga 1774

                                                                        
Query: 2189 agtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaaga 2248
            | ||||| || ||||| ||||| || || || || || ||| | || || || || ||||
Sbjct: 1775 aatctgcagacaatgtcagacagcagctagtgcggataatgtcgaggtttaatctgaaga 1834

                                                                        
Query: 2249 tgtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgcttt 2308
            ||||||| || || |||||||| || || ||||||||||| || || || || |||||| 
Sbjct: 1835 tgtgcagcacggatttcaacagccgcgactactatgtcaacataagaaaggccatgcttg 1894

                                                                        
Query: 2309 cggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagg 2368
            | || || ||||||||||| |||||  | || || ||||| |||||||||||||| || |
Sbjct: 1895 ctggttattttatgcaggtggctcacctagaacgcactggccattacttgaccgtcaaag 1954

                                                                        
Query: 2369 ataatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtca 2428
            |||| || || || ||  | ||||| || |||||  |||| || || || |||||||| |
Sbjct: 1955 ataaccaagtggttcacttgcatccatctaattgcctggatcacaaaccagagtgggtga 2014

                                                                      
Query: 2429 tctacaatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccg 2486
            | ||||||||||||||  |||| ||  |||||||||| || || || || ||||||||
Sbjct: 2015 tttacaatgaatatgtcttgactactcggaatttcatacgcactgttacagatatccg 2072



 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 428 acccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggat 487
           |||||||| || || |||||||||||||| || ||||| ||||| || || || ||||||
Sbjct: 381 acccagcctcgtagagttgctgcaatgtctgtgtctcgtcgtgttgctgatgaaatggat 440

                                           
Query: 488 gtcacaatcggggaggaagttggttacagtat 519
           ||| | || || || |||||||||||||||||
Sbjct: 441 gtctccattggtgaagaagttggttacagtat 472



to top

>ref|NM_130293.2| Arabidopsis thaliana ATP binding / ATP-dependent helicase/ RNA
            helicase/ helicase/ nucleic acid binding (AT2G47250)
            mRNA, complete cds
          Length = 2474

 Score =  250 bits (126), Expect = 2e-62
 Identities = 798/1022 (78%)
 Strand = Plus / Plus

                                                                        
Query: 560  tatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtac 619
            |||||||| |||||||||||| ||||||| |||||||| || || |||||||| || |||
Sbjct: 552  tatttgactgatggtatgcttttgagagaggcaatggcggatccgcttttagagagatac 611

                                                                        
Query: 620  aaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttggg 679
            || || ||| |||| || || ||||||||  | ||  | || || ||||| || ||||| 
Sbjct: 612  aaagttattattctcgatgaagctcatgaaaggactctagccacggatgtgctctttggt 671

                                                                        
Query: 680  cttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctact 739
            ||||| ||||| ||  | | ||| ||||||||  | ||||| ||||| |||||||| |||
Sbjct: 672  cttctcaaagaggtcttgaggaataggcctgatcttaagctagttgtcatgagtgcaact 731

                                                                        
Query: 740  cttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggt 799
             | || || || ||||||||||  ||||| || || || ||  | ||||| || ||||||
Sbjct: 732  ttagaagctgaaaagtttcaggaatattttagcggtgctcctcttatgaaagtccctggt 791

                                                                        
Query: 800  agacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagcc 859
            || |||||||| ||||||||||||||||| |||||||| || ||||| ||||| || || 
Sbjct: 792  aggcttcatcctgttgagatcttctatacacaggaacctgagagggattatctcgaggct 851

                                                                        
Query: 860  gctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattc 919
            ||||| ||||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| |||
Sbjct: 852  gctataaggactgttgttcagatacacatgtgcgagccacctggagatattcttgttttc 911

                                                                        
Query: 920  ctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataac 979
             | |||||||| ||||| || || ||||| || || ||||| || || || || |  || 
Sbjct: 912  ttaactggagaggaggaaatagaagatgcttgccgtaaaatcaataaagaggtcagcaat 971

                                                                        
Query: 980  atgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgca 1039
             | || ||||| || || || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 972  cttggagatcaagtgggtcctgtcaaagttgtgcctttgtattctactcttccacctgcg 1031

                                                                        
Query: 1040 atgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgga 1099
            ||||||||||||||||| |||||||| |||   || || | ||| || || |||||||||
Sbjct: 1032 atgcagcagaagattttcgaccctgctccagtgccgttaacagaaggtggtcctgctgga 1091

                                                                        
Query: 1100 aggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtg 1159
             | || |||||||| || || |||||||| || || ||  ||||||||||||| || || 
Sbjct: 1092 cgaaagattgttgtctcaaccaacattgctgaaacctctctaaccattgatgggattgtt 1151

                                                                        
Query: 1160 tatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtggaa 1219
            |||||||| || || || ||| | || ||||| || ||||| ||| ||||  | || || 
Sbjct: 1152 tatgttattgaccctggttttgctaagcagaaagtctacaacccacggattcgagttgag 1211

                                                                        
Query: 1220 tcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgga 1279
            ||  | |||||||| ||||| || ||||||||||| || || ||| | ||||||||||| 
Sbjct: 1212 tcattgttggtgtccccaatatcaaaggcaagtgctcaccagagatcaggtcgtgctggt 1271

                                                                        
Query: 1280 agaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattta 1339
            ||||| |  ||||| || || || ||| | ||||||||||||||||| ||   |||  | 
Sbjct: 1272 agaactcgccctggaaaatgttttaggctctacacagagaagagtttcaacaatgacctg 1331

                                                                        
Query: 1340 cagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctg 1399
            ||||| ||||| || || || ||  |  | |||||||| ||||| ||||| || ||  ||
Sbjct: 1332 cagccacagacatatcctgagatattgagatcaaaccttgcaaatacagtcctgacattg 1391

                                                                        
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
            || || ||||| |||||||| || ||||| ||||| ||||||||||||||||| ||||| 
Sbjct: 1392 aaaaaacttggcattgatgacttggtgcactttgatttcatggatcctcctgctcctgag 1451

                                                                        
Query: 1460 actctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaac 1519
            || || ||| |||| || || |||||||| |||||||| ||||| || |||||||| |||
Sbjct: 1452 acactgatgcgggcattagaggttctgaattatttgggagcacttgatgatgaaggtaac 1511

                                                                        
Query: 1520 ctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatg 1579
             | |||      |||||||| |||||||| || ||||| || ||||| ||||||||||||
Sbjct: 1512 ttgacaaagacgggtgaaataatgagtgaatttcccttggatccacaaatgtcaaagatg 1571

              
Query: 1580 ct 1581
            ||
Sbjct: 1572 ct 1573



 Score =  105 bits (53), Expect = 9e-19
 Identities = 371/477 (77%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||| ||||||||| |||||||||| ||||| ||||| || || ||||| || || ||
Sbjct: 1634 agtaccgaattgctttgtccggcctagagaggctcaaaaagcagcagatgaagctaaagc 1693

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            | | ||||| ||||| || || ||||| || ||  | || || |||||||| || |||||
Sbjct: 1694 taggtttggacacattgatggagatcacctgacgttgctaaacgtgtaccacgcctacaa 1753

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            |||||||||||| || || |  |||||||  ||||| ||||||||   | | || |||||
Sbjct: 1754 gcaaaacaatgaagacccaaactggtgtttcgagaactttgtcaacaacagagcaatgaa 1813

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
             ||||| || ||||| ||||| || || || || || ||| | || || || || |||||
Sbjct: 1814 atctgcagacaatgtcagacagcagctagtgcggataatgtcgaggtttaatctgaagat 1873

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| || || |||||||| || || ||||||||||| || || || || |||||| |
Sbjct: 1874 gtgcagcacggatttcaacagccgcgactactatgtcaacataagaaaggccatgcttgc 1933

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             || || ||||||||||| |||||  | || || ||||| |||||||||||||| || ||
Sbjct: 1934 tggttattttatgcaggtggctcacctagaacgcactggccattacttgaccgtcaaaga 1993

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
            ||| || || || ||  | ||||| || |||||  |||| || || || |||||||| ||
Sbjct: 1994 taaccaagtggttcacttgcatccatctaattgcctggatcacaaaccagagtgggtgat 2053

                                                                     
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccg 2486
             ||||||||||||||  |||| ||  |||||||||| || || || || ||||||||
Sbjct: 2054 ttacaatgaatatgtcttgactactcggaatttcatacgcactgttacagatatccg 2110



 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 428 acccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggat 487
           |||||||| || || |||||||||||||| || ||||| ||||| || || || ||||||
Sbjct: 420 acccagcctcgtagagttgctgcaatgtctgtgtctcgtcgtgttgctgatgaaatggat 479

                                           
Query: 488 gtcacaatcggggaggaagttggttacagtat 519
           ||| | || || || |||||||||||||||||
Sbjct: 480 gtctccattggtgaagaagttggttacagtat 511



to top

>gb|AY128301.1| Arabidopsis thaliana At2g47250/T8I13.9 mRNA, complete cds
          Length = 2477

 Score =  250 bits (126), Expect = 2e-62
 Identities = 798/1022 (78%)
 Strand = Plus / Plus

                                                                        
Query: 560  tatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtac 619
            |||||||| |||||||||||| ||||||| |||||||| || || |||||||| || |||
Sbjct: 555  tatttgactgatggtatgcttttgagagaggcaatggcggatccgcttttagagagatac 614

                                                                        
Query: 620  aaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttggg 679
            || || ||| |||| || || ||||||||  | ||  | || || ||||| || ||||| 
Sbjct: 615  aaagttattattctcgatgaagctcatgaaaggactctagccacggatgtgctctttggt 674

                                                                        
Query: 680  cttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctact 739
            ||||| ||||| ||  | | ||| ||||||||  | ||||| ||||| |||||||| |||
Sbjct: 675  cttctcaaagaggtcttgaggaataggcctgatcttaagctagttgtcatgagtgcaact 734

                                                                        
Query: 740  cttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggt 799
             | || || || ||||||||||  ||||| || || || ||  | ||||| || ||||||
Sbjct: 735  ttagaagctgaaaagtttcaggaatattttagcggtgctcctcttatgaaagtccctggt 794

                                                                        
Query: 800  agacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagcc 859
            || |||||||| ||||||||||||||||| |||||||| || ||||| ||||| || || 
Sbjct: 795  aggcttcatcctgttgagatcttctatacacaggaacctgagagggattatctcgaggct 854

                                                                        
Query: 860  gctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattc 919
            ||||| ||||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| |||
Sbjct: 855  gctataaggactgttgttcagatacacatgtgcgagccacctggagatattcttgttttc 914

                                                                        
Query: 920  ctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataac 979
             | |||||||| ||||| || || ||||| || || ||||| || || || || |  || 
Sbjct: 915  ttaactggagaggaggaaatagaagatgcttgccgtaaaatcaataaagaggtcagcaat 974

                                                                        
Query: 980  atgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgca 1039
             | || ||||| || || || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 975  cttggagatcaagtgggtcctgtcaaagttgtgcctttgtattctactcttccacctgcg 1034

                                                                        
Query: 1040 atgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgga 1099
            ||||||||||||||||| |||||||| |||   || || | ||| || || |||||||||
Sbjct: 1035 atgcagcagaagattttcgaccctgctccagtgccgttaacagaaggtggtcctgctgga 1094

                                                                        
Query: 1100 aggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtg 1159
             | || |||||||| || || |||||||| || || ||  ||||||||||||| || || 
Sbjct: 1095 cgaaagattgttgtctcaaccaacattgctgaaacctctctaaccattgatgggattgtt 1154

                                                                        
Query: 1160 tatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtggaa 1219
            |||||||| || || || ||| | || ||||| || ||||| ||| ||||  | || || 
Sbjct: 1155 tatgttattgaccctggttttgctaagcagaaagtctacaacccacggattcgagttgag 1214

                                                                        
Query: 1220 tcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgga 1279
            ||  | |||||||| ||||| || ||||||||||| || || ||| | ||||||||||| 
Sbjct: 1215 tcattgttggtgtccccaatatcaaaggcaagtgctcaccagagatcaggtcgtgctggt 1274

                                                                        
Query: 1280 agaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattta 1339
            ||||| |  ||||| || || || ||| | ||||||||||||||||| ||   |||  | 
Sbjct: 1275 agaactcgccctggaaaatgttttaggctctacacagagaagagtttcaacaatgacctg 1334

                                                                        
Query: 1340 cagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctg 1399
            ||||| ||||| || || || ||  |  | |||||||| ||||| ||||| || ||  ||
Sbjct: 1335 cagccacagacatatcctgagatattgagatcaaaccttgcaaatacagtcctgacattg 1394

                                                                        
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
            || || ||||| |||||||| || ||||| ||||| ||||||||||||||||| ||||| 
Sbjct: 1395 aaaaaacttggcattgatgacttggtgcactttgatttcatggatcctcctgctcctgag 1454

                                                                        
Query: 1460 actctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaac 1519
            || || ||| |||| || || |||||||| |||||||| ||||| || |||||||| |||
Sbjct: 1455 acactgatgcgggcattagaggttctgaattatttgggagcacttgatgatgaaggtaac 1514

                                                                        
Query: 1520 ctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatg 1579
             | |||      |||||||| |||||||| || ||||| || ||||| ||||||||||||
Sbjct: 1515 ttgacaaagacgggtgaaataatgagtgaatttcccttggatccacaaatgtcaaagatg 1574

              
Query: 1580 ct 1581
            ||
Sbjct: 1575 ct 1576



 Score =  105 bits (53), Expect = 9e-19
 Identities = 371/477 (77%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||| ||||||||| |||||||||| ||||| ||||| || || ||||| || || ||
Sbjct: 1637 agtaccgaattgctttgtccggcctagagaggctcaaaaagcagcagatgaagctaaagc 1696

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            | | ||||| ||||| || || ||||| || ||  | || || |||||||| || |||||
Sbjct: 1697 taggtttggacacattgatggagatcacctgacgttgctaaacgtgtaccacgcctacaa 1756

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            |||||||||||| || || |  |||||||  ||||| ||||||||   | | || |||||
Sbjct: 1757 gcaaaacaatgaagacccaaactggtgtttcgagaactttgtcaacaacagagcaatgaa 1816

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
             ||||| || ||||| ||||| || || || || || ||| | || || || || |||||
Sbjct: 1817 atctgcagacaatgtcagacagcagctagtgcggataatgtcgaggtttaatctgaagat 1876

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| || || |||||||| || || ||||||||||| || || || || |||||| |
Sbjct: 1877 gtgcagcacggatttcaacagccgcgactactatgtcaacataagaaaggccatgcttgc 1936

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             || || ||||||||||| |||||  | || || ||||| |||||||||||||| || ||
Sbjct: 1937 tggttattttatgcaggtggctcacctagaacgcactggccattacttgaccgtcaaaga 1996

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
            ||| || || || ||  | ||||| || |||||  |||| || || || |||||||| ||
Sbjct: 1997 taaccaagtggttcacttgcatccatctaattgcctggatcacaaaccagagtgggtgat 2056

                                                                     
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccg 2486
             ||||||||||||||  |||| ||  |||||||||| || || || || ||||||||
Sbjct: 2057 ttacaatgaatatgtcttgactactcggaatttcatacgcactgttacagatatccg 2113



 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 428 acccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggat 487
           |||||||| || || |||||||||||||| || ||||| ||||| || || || ||||||
Sbjct: 423 acccagcctcgtagagttgctgcaatgtctgtgtctcgtcgtgttgctgatgaaatggat 482

                                           
Query: 488 gtcacaatcggggaggaagttggttacagtat 519
           ||| | || || || |||||||||||||||||
Sbjct: 483 gtctccattggtgaagaagttggttacagtat 514



to top

>gb|BT004534.1| Arabidopsis thaliana At2g47250/T8I13.9 gene, complete cds
          Length = 2190

 Score =  250 bits (126), Expect = 2e-62
 Identities = 798/1022 (78%)
 Strand = Plus / Plus

                                                                        
Query: 560  tatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtac 619
            |||||||| |||||||||||| ||||||| |||||||| || || |||||||| || |||
Sbjct: 496  tatttgactgatggtatgcttttgagagaggcaatggcggatccgcttttagagagatac 555

                                                                        
Query: 620  aaggtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttggg 679
            || || ||| |||| || || ||||||||  | ||  | || || ||||| || ||||| 
Sbjct: 556  aaagttattattctcgatgaagctcatgaaaggactctagccacggatgtgctctttggt 615

                                                                        
Query: 680  cttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctact 739
            ||||| ||||| ||  | | ||| ||||||||  | ||||| ||||| |||||||| |||
Sbjct: 616  cttctcaaagaggtcttgaggaataggcctgatcttaagctagttgtcatgagtgcaact 675

                                                                        
Query: 740  cttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggt 799
             | || || || ||||||||||  ||||| || || || ||  | ||||| || ||||||
Sbjct: 676  ttagaagctgaaaagtttcaggaatattttagcggtgctcctcttatgaaagtccctggt 735

                                                                        
Query: 800  agacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagcc 859
            || |||||||| ||||||||||||||||| |||||||| || ||||| ||||| || || 
Sbjct: 736  aggcttcatcctgttgagatcttctatacacaggaacctgagagggattatctcgaggct 795

                                                                        
Query: 860  gctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattc 919
            ||||| ||||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| |||
Sbjct: 796  gctataaggactgttgttcagatacacatgtgcgagccacctggagatattcttgttttc 855

                                                                        
Query: 920  ctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataac 979
             | |||||||| ||||| || || ||||| || || ||||| || || || || |  || 
Sbjct: 856  ttaactggagaggaggaaatagaagatgcttgccgtaaaatcaataaagaggtcagcaat 915

                                                                        
Query: 980  atgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgca 1039
             | || ||||| || || || || ||||| ||||| ||||| |||||||| || ||||| 
Sbjct: 916  cttggagatcaagtgggtcctgtcaaagttgtgcctttgtattctactcttccacctgcg 975

                                                                        
Query: 1040 atgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgga 1099
            ||||||||||||||||| |||||||| |||   || || | ||| || || |||||||||
Sbjct: 976  atgcagcagaagattttcgaccctgctccagtgccgttaacagaaggtggtcctgctgga 1035

                                                                        
Query: 1100 aggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtg 1159
             | || |||||||| || || |||||||| || || ||  ||||||||||||| || || 
Sbjct: 1036 cgaaagattgttgtctcaaccaacattgctgaaacctctctaaccattgatgggattgtt 1095

                                                                        
Query: 1160 tatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtggaa 1219
            |||||||| || || || ||| | || ||||| || ||||| ||| ||||  | || || 
Sbjct: 1096 tatgttattgaccctggttttgctaagcagaaagtctacaacccacggattcgagttgag 1155

                                                                        
Query: 1220 tcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgga 1279
            ||  | |||||||| ||||| || ||||||||||| || || ||| | ||||||||||| 
Sbjct: 1156 tcattgttggtgtccccaatatcaaaggcaagtgctcaccagagatcaggtcgtgctggt 1215

                                                                        
Query: 1280 agaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattta 1339
            ||||| |  ||||| || || || ||| | ||||||||||||||||| ||   |||  | 
Sbjct: 1216 agaactcgccctggaaaatgttttaggctctacacagagaagagtttcaacaatgacctg 1275

                                                                        
Query: 1340 cagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctg 1399
            ||||| ||||| || || || ||  |  | |||||||| ||||| ||||| || ||  ||
Sbjct: 1276 cagccacagacatatcctgagatattgagatcaaaccttgcaaatacagtcctgacattg 1335

                                                                        
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
            || || ||||| |||||||| || ||||| ||||| ||||||||||||||||| ||||| 
Sbjct: 1336 aaaaaacttggcattgatgacttggtgcactttgatttcatggatcctcctgctcctgag 1395

                                                                        
Query: 1460 actctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaac 1519
            || || ||| |||| || || |||||||| |||||||| ||||| || |||||||| |||
Sbjct: 1396 acactgatgcgggcattagaggttctgaattatttgggagcacttgatgatgaaggtaac 1455

                                                                        
Query: 1520 ctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatg 1579
             | |||      |||||||| |||||||| || ||||| || ||||| ||||||||||||
Sbjct: 1456 ttgacaaagacgggtgaaataatgagtgaatttcccttggatccacaaatgtcaaagatg 1515

              
Query: 1580 ct 1581
            ||
Sbjct: 1516 ct 1517



 Score =  105 bits (53), Expect = 9e-19
 Identities = 371/477 (77%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||| ||||||||| |||||||||| ||||| ||||| || || ||||| || || ||
Sbjct: 1578 agtaccgaattgctttgtccggcctagagaggctcaaaaagcagcagatgaagctaaagc 1637

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            | | ||||| ||||| || || ||||| || ||  | || || |||||||| || |||||
Sbjct: 1638 taggtttggacacattgatggagatcacctgacgttgctaaacgtgtaccacgcctacaa 1697

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            |||||||||||| || || |  |||||||  ||||| ||||||||   | | || |||||
Sbjct: 1698 gcaaaacaatgaagacccaaactggtgtttcgagaactttgtcaacaacagagcaatgaa 1757

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
             ||||| || ||||| ||||| || || || || || ||| | || || || || |||||
Sbjct: 1758 atctgcagacaatgtcagacagcagctagtgcggataatgtcgaggtttaatctgaagat 1817

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| || || |||||||| || || ||||||||||| || || || || |||||| |
Sbjct: 1818 gtgcagcacggatttcaacagccgcgactactatgtcaacataagaaaggccatgcttgc 1877

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             || || ||||||||||| |||||  | || || ||||| |||||||||||||| || ||
Sbjct: 1878 tggttattttatgcaggtggctcacctagaacgcactggccattacttgaccgtcaaaga 1937

                                                                        
Query: 2370 taatcaggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcat 2429
            ||| || || || ||  | ||||| || |||||  |||| || || || |||||||| ||
Sbjct: 1938 taaccaagtggttcacttgcatccatctaattgcctggatcacaaaccagagtgggtgat 1997

                                                                     
Query: 2430 ctacaatgaatatgttctgaccaccaggaatttcatccgtacagtcaccgatatccg 2486
             ||||||||||||||  |||| ||  |||||||||| || || || || ||||||||
Sbjct: 1998 ttacaatgaatatgtcttgactactcggaatttcatacgcactgttacagatatccg 2054



 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 77/92 (83%)
 Strand = Plus / Plus

                                                                       
Query: 428 acccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggat 487
           |||||||| || || |||||||||||||| || ||||| ||||| || || || ||||||
Sbjct: 364 acccagcctcgtagagttgctgcaatgtctgtgtctcgtcgtgttgctgatgaaatggat 423

                                           
Query: 488 gtcacaatcggggaggaagttggttacagtat 519
           ||| | || || || |||||||||||||||||
Sbjct: 424 gtctccattggtgaagaagttggttacagtat 455



to top

>emb|BX820131.1|CNS0A844 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS78ZD10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 2425

 Score =  244 bits (123), Expect = 2e-60
 Identities = 799/1023 (78%), Gaps = 1/1023 (0%)
 Strand = Plus / Plus

                                                                        
Query: 560  tatttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtac 619
            |||||||| |||||||||||| ||||||| |||||||| || || |||||||| || |||
Sbjct: 539  tatttgactgatggtatgcttttgagagaggcaatggcggatccgcttttagagagatac 598

                                                                        
Query: 620  aagg-tgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgg 678
            || | | ||| |||| || || ||||||||| | ||  | || || ||||| || |||||
Sbjct: 599  aaagattattattctcgatgaagctcatgagaggactctagccacggatgtgctctttgg 658

                                                                        
Query: 679  gcttctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctac 738
             ||||| ||||| ||  | | ||| ||||||||  | ||||| ||||| |||||||| ||
Sbjct: 659  tcttctcaaagaggtcttgaggaataggcctgatcttaagctagttgtcatgagtgcaac 718

                                                                        
Query: 739  tcttgaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctgg 798
            | | || || || ||||||||||  ||||| || || || ||  | ||||| || |||||
Sbjct: 719  tttagaagctgaaaagtttcaggaatattttagcggtgctcctcttatgaaagtccctgg 778

                                                                        
Query: 799  tagacttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagc 858
            ||| |||||||| ||||||||||||||||| |||||||| || ||||| ||||| || ||
Sbjct: 779  taggcttcatcctgttgagatcttctatacacaggaacctgagagggattatctcgaggc 838

                                                                        
Query: 859  cgctatcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtatt 918
             ||||| ||||| ||||| |||||||| ||||| || ||  |||| ||||| ||||| ||
Sbjct: 839  tgctataaggactgttgttcagatacacatgtgcgagccacctggagatattcttgtttt 898

                                                                        
Query: 919  cctcactggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataa 978
            | | |||||||| ||||| || || ||||| || || ||||| || || || || |  ||
Sbjct: 899  cttaactggagaggaggaaatagaagatgcttgccgtaaaatcaataaagaggtcagcaa 958

                                                                        
Query: 979  catgggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgc 1038
              | || ||||| || || || || ||||| ||||| ||||| |||||||| || |||||
Sbjct: 959  tcttggagatcaagtgggtcctgtcaaagttgtgcctttgtattctactcttccacctgc 1018

                                                                        
Query: 1039 aatgcagcagaagatttttgaccctgccccacctccattgaaagagggaggccctgctgg 1098
             ||||||||||||||||| |||||||| |||   || || | ||| || || ||||||||
Sbjct: 1019 gatgcagcagaagattttcgaccctgctccagtgccgttaacagaaggtggtcctgctgg 1078

                                                                        
Query: 1099 aaggaaaattgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagt 1158
            | | || |||||||| || || |||||||| || || ||  ||||||||||||| || ||
Sbjct: 1079 acgaaagattgttgtctcaaccaacattgctgaaacctctctaaccattgatgggattgt 1138

                                                                        
Query: 1159 gtatgttatagatccagggttttccaaacagaaggtttacaatccaaggataagggtgga 1218
             |||||||| || || || ||| | || ||||| || ||||| ||| ||||  | || ||
Sbjct: 1139 ttatgttattgaccctggttttgctaagcagaaagtctacaacccacggattcgagttga 1198

                                                                        
Query: 1219 atcccttttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctgg 1278
             ||  | |||||||| ||||| || ||||||||||| || || ||| | |||||||||||
Sbjct: 1199 gtcattgttggtgtccccaatatcaaaggcaagtgctcaccagagatcaggtcgtgctgg 1258

                                                                        
Query: 1279 aagaacgcagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgattt 1338
             ||||| |  ||||| || || || ||| | ||||||||||||||||| ||   |||  |
Sbjct: 1259 tagaactcgccctggaaaatgttttaggctctacacagagaagagtttcaacaatgacct 1318

                                                                        
Query: 1339 acagccgcagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactct 1398
             ||||| ||||| || || || ||  |  | |||||||| ||||| ||||| || ||  |
Sbjct: 1319 gcagccacagacatatcctgagatattgagatcaaaccttgcaaatacagtcctgacatt 1378

                                                                        
Query: 1399 gaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctga 1458
            ||| || ||||| |||||||| || ||||| ||||| ||||||||||||||||| |||||
Sbjct: 1379 gaaaaaacttggcattgatgacttggtgcactttgatttcatggatcctcctgctcctga 1438

                                                                        
Query: 1459 aactctaatgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaa 1518
             || || ||| |||| || || |||||||| |||||||| ||||| || |||||||| ||
Sbjct: 1439 gacactgatgcgggcattagaggttctgaattatttgggagcacttgatgatgaaggtaa 1498

                                                                        
Query: 1519 cctaacatctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagat 1578
            | | |||      |||||||| |||||||| || ||||| || ||||| |||||||||||
Sbjct: 1499 cttgacaaagacgggtgaaataatgagtgaatttcccttggatccacaaatgtcaaagat 1558

               
Query: 1579 gct 1581
            |||
Sbjct: 1559 gct 1561



 Score = 77.8 bits (39), Expect = 2e-10
 Identities = 282/363 (77%)
 Strand = Plus / Plus

                                                                        
Query: 2010 agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
            |||||| ||||||||| |||||||||| ||||| ||||| || || ||||| || || ||
Sbjct: 1622 agtaccgaattgctttgtccggcctagagaggctcaaaaagcagcagatgaagctaaagc 1681

                                                                        
Query: 2070 tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            | | ||||| ||||| || || ||||| || ||  | || || |||||||| || |||||
Sbjct: 1682 taggtttggacacattgatggagatcacctgacgttgctaaacgtgtaccacgcctacaa 1741

                                                                        
Query: 2130 gcaaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaa 2189
            |||||||||||| || || |  |||||||  ||||| ||||||||   | | || |||||
Sbjct: 1742 gcaaaacaatgaagacccaaactggtgtttcgagaactttgtcaacaacagagcaatgaa 1801

                                                                        
Query: 2190 gtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagat 2249
             ||||| || ||||| ||||| || || || || || ||| | || || || || |||||
Sbjct: 1802 atctgcagacaatgtcagacagcagctagtgcggataatgtcgaggtttaatctgaagat 1861

                                                                        
Query: 2250 gtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttc 2309
            |||||| || ||  ||||||| || || ||||||||||| || || || || |||||| |
Sbjct: 1862 gtgcagcacggatctcaacagccgcgactactatgtcaacataagaaaggccatgcttgc 1921

                                                                        
Query: 2310 ggggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaagga 2369
             || ||  |||||||||| |||||  | || || ||||| |||||||||||||| || ||
Sbjct: 1922 tggttatcttatgcaggtggctcacctagaacgcactggccattacttgaccgtcaaaga 1981

               
Query: 2370 taa 2372
            |||
Sbjct: 1982 taa 1984



 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 76/92 (82%)
 Strand = Plus / Plus

                                                                       
Query: 428 acccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatggat 487
           |||||||| || || |||||||| ||||| || ||||| ||||| || || || ||||||
Sbjct: 407 acccagcctcgtagagttgctgcgatgtctgtgtctcgtcgtgttgctgatgaaatggat 466

                                           
Query: 488 gtcacaatcggggaggaagttggttacagtat 519
           ||| | || || || |||||||||||||||||
Sbjct: 467 gtctccattggtgaagaagttggttacagtat 498



to top

>emb|AL162507.1|ATT12C14 Arabidopsis thaliana DNA chromosome 3, BAC clone T12C14
          Length = 77720

 Score =  204 bits (103), Expect = 1e-48
 Identities = 403/503 (80%)
 Strand = Plus / Minus

                                                                        
Query: 563  ttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtacaag 622
            ||||| ||||||||||| ||||||||||||||||| ||||| ||| |||| || ||||| 
Sbjct: 3091 ttgactgatggtatgctcctgagagaagcaatggcggaccctcttctagagagatacaaa 3032

                                                                        
Query: 623  gtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgggctt 682
            || ||| ||||||| ||||| || ||  | ||  | || |||||||| |||||||| |||
Sbjct: 3031 gtcattattcttgatgaggcccacgaaaggactctagccacagatgtgctgtttggtctt 2972

                                                                        
Query: 683  ctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctactctt 742
            |||||||||||  | || || || |||||  | ||| | ||||| |||||||| ||||| 
Sbjct: 2971 ctgaaagaagtgttgaaaaatagacctgatcttaagttagttgtgatgagtgcaactcta 2912

                                                                        
Query: 743  gaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggtaga 802
            || || || |||||||||| |||||| || || || ||  ||||||| ||||||||||| 
Sbjct: 2911 gaagctgaaaagtttcaggattattttagcggtgctcctctgatgaaagttcctggtagg 2852

                                                                        
Query: 803  cttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgct 862
            |||||||| ||||||||||| || || ||||| || || ||||||||||| || || |||
Sbjct: 2851 cttcatccagttgagatcttttacactcaggagcctgagagggactatcttgaggctgct 2792

                                                                        
Query: 863  atcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattcctc 922
            || || || ||||| ||||| || |||||||| ||  |||| ||||| ||||| ||| | 
Sbjct: 2791 attagaactgttgtccagattcacatgtgtgagccacctggcgatattcttgttttctta 2732

                                                                        
Query: 923  actggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataacatg 982
            ||||| || ||||||||||| |||||||| || ||||| || || || |||  |||  | 
Sbjct: 2731 actggggaggaggagattgaagatgcatgccgcaaaatcaataaagaggttggtaatctt 2672

                                                                        
Query: 983  ggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgcaatg 1042
            || ||||| || || ||  ||||||| |||||| |||| |||||||| || ||||| |||
Sbjct: 2671 ggggatcaagtggggcctattaaagtagtgccactgtattctactcttccacctgcgatg 2612

                                   
Query: 1043 cagcagaagatttttgaccctgc 1065
            ||||||||||| ||||| |||||
Sbjct: 2611 cagcagaagatatttgatcctgc 2589



 Score =  168 bits (85), Expect = 7e-38
 Identities = 337/421 (80%)
 Strand = Plus / Minus

                                                                        
Query: 1226 ttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaacg 1285
            |||||||| |||||||| ||||||||||| || || ||| |||||||||| || ||||| 
Sbjct: 2428 ttggtgtccccaatttcaaaggcaagtgctcaccagagatctggtcgtgccggtagaaca 2369

                                                                        
Query: 1286 cagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgatttacagccg 1345
            | |||||| || ||||||||| | |||||||||||||||||||||  ||| || ||||||
Sbjct: 2368 cggcctggaaaatgcttcaggctttacacagagaagagttttaataatgacttgcagccg 2309

                                                                        
Query: 1346 cagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctgaagaag 1405
            ||||| || || |||||  |  | |||||||| ||||| |||||||| ||  |||| || 
Sbjct: 2308 cagacgtatcctgaaatattgagatcaaaccttgcaaatacagttctgaccttgaaaaaa 2249

                                                                        
Query: 1406 cttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactcta 1465
            || || |||||||| || ||||| ||||| || |||||||| ||||| || ||||| || 
Sbjct: 2248 ctgggtattgatgacttggtgcactttgattttatggatccccctgctcccgaaacactg 2189

                                                                        
Query: 1466 atgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaacctaaca 1525
            ||| | ||||| |||||| |||| || ||||| ||||| || ||||| || ||| | |||
Sbjct: 2188 atgcgagccttagaagttttgaattacttgggagcactggatgatgatggtaacttgaca 2129

                                                                        
Query: 1526 tctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgcttgtc 1585
                 |||||| || ||||||||||||||||| || ||||||||| ||||||||||  | 
Sbjct: 2128 aagacaggtgagatcatgagtgagttccccttggatccacagatggcaaagatgctcata 2069

                                                                        
Query: 1586 atcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatgctatcaggt 1645
             |||||||    | |||||| ||||| ||||| |||||| | || || ||||||||||||
Sbjct: 2068 gtcagtcctgaattcaactgctcaaacgagattctctcagtttcagctatgctatcaggt 2009

             
Query: 1646 a 1646
            |
Sbjct: 2008 a 2008



 Score = 75.8 bits (38), Expect = 8e-10
 Identities = 146/182 (80%)
 Strand = Plus / Minus

                                                                        
Query: 2182 gcgatgaagtctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaac 2241
            |||||||| ||||| || ||||||||||| || || ||||| || ||| | |||||||||
Sbjct: 1374 gcgatgaaatctgcagacaatgttagacagcagctagtccggataatgtcaagattcaac 1315

                                                                        
Query: 2242 ctcaagatgtgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagca 2301
            || ||||||||||| || || || ||||| || || |||||  |||| || ||||| || 
Sbjct: 1314 ctgaagatgtgcagcactgattttaacagccgcgactactacatcaacataaggaaggcc 1255

                                                                        
Query: 2302 atgctttcggggtactttatgcaggttgctcatttggagcgaactgggcattacttgacc 2361
            |||||| | || || || ||||| || ||||| || || || ||||| ||||||||||||
Sbjct: 1254 atgcttgccggttatttcatgcaagtggctcacttagaacgtactggccattacttgacc 1195

              
Query: 2362 gt 2363
            ||
Sbjct: 1194 gt 1193



 Score = 65.9 bits (33), Expect = 8e-07
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                        
Query: 425  tgcacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggaggagatg 484
            ||||| ||||| || || |||||||| ||||| || || || ||||| || || ||||||
Sbjct: 3319 tgcacacagcctcgtagagttgctgccatgtctgtgtcccgtcgtgttgctgaagagatg 3260

                                                                 
Query: 485  gatgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcag 537
            ||||| || || ||||| |||||||||||||| ||||| ||||| || |||||
Sbjct: 3259 gatgtaactattggggaagaagttggttacagcatccgtttcgaggactgcag 3207



 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 110/136 (80%)
 Strand = Plus / Minus

                                                                        
Query: 2002 ctttgtctagtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgag 2061
            |||| ||||||||| ||||||||| | |||||||| ||||| ||||| || || ||||| 
Sbjct: 1649 ctttctctagtaccgaattgctttattcggcctagagaggctcaaaaagcagcagatgaa 1590

                                                                        
Query: 2062 gcgaaggctcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccat 2121
            || || ||| | ||||| ||||| || || ||||| |||||| |  ||||||| ||||| 
Sbjct: 1589 gctaaagctaggtttggacacattgagggagatcacctcacattgttgaatgtctaccac 1530

                            
Query: 2122 gcatacaagcaaaaca 2137
            || | |||||||||||
Sbjct: 1529 gctttcaagcaaaaca 1514



 Score = 54.0 bits (27), Expect = 0.003
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                               
Query: 2416 ccggagtgggtcatctacaatgaatatgttctgaccaccaggaatttcatc 2466
            ||||||||||| |||||||| ||||||||| |||| | | |||||||||||
Sbjct: 1060 ccggagtgggtaatctacaacgaatatgttttgactagccggaatttcatc 1010



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8
          Length = 28434780

 Score =  186 bits (94), Expect = 3e-43
 Identities = 157/178 (88%)
 Strand = Plus / Minus

                                                                           
Query: 193     ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
               |||||| |||||||||||  ||||||  ||  |||||||||||||  ||||||| |||||
Sbjct: 5769983 ggccaacccgtccatcaattggtggacggggaggccctactcggcaaggtacctcgagat 5769924

                                                                           
Query: 253     cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
               |||| |||||| ||||||||||||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 5769923 cctctagaagcaccgcacgctccccgtgtggcagcagaaggacgatttcctcgccgtcct 5769864

                                                                         
Query: 313     ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcag 370
               ||| |||||||||||||||||||| |||||||||||||||||  ||||||||||||||
Sbjct: 5769863 ccgtgacaaccagaccctcatcctcgtcggagaaaccggaagcagcaagaccactcag 5769806



 Score = 89.7 bits (45), Expect = 5e-14
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                           
Query: 83      atggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacctccgta 142
               |||||||||||||||||||||| ||| ||||||||||||||||| ||  ||| |||||| 
Sbjct: 5770093 atggggacggagcggaagcgcatggtgagcctcttcgacgtggtcgatgagagctccgtc 5770034

                                        
Query: 143     tcctccaagctcggccgcgccggca 167
               ||  |||||||||||| ||||||||
Sbjct: 5770033 tctaccaagctcggccacgccggca 5770009



to top

>dbj|AP005416.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBb0094P23
          Length = 149341

 Score =  186 bits (94), Expect = 3e-43
 Identities = 157/178 (88%)
 Strand = Plus / Minus

                                                                          
Query: 193    ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
              |||||| |||||||||||  ||||||  ||  |||||||||||||  ||||||| |||||
Sbjct: 124608 ggccaacccgtccatcaattggtggacggggaggccctactcggcaaggtacctcgagat 124549

                                                                          
Query: 253    cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
              |||| |||||| ||||||||||||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 124548 cctctagaagcaccgcacgctccccgtgtggcagcagaaggacgatttcctcgccgtcct 124489

                                                                        
Query: 313    ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcag 370
              ||| |||||||||||||||||||| |||||||||||||||||  ||||||||||||||
Sbjct: 124488 ccgtgacaaccagaccctcatcctcgtcggagaaaccggaagcagcaagaccactcag 124431



 Score = 89.7 bits (45), Expect = 5e-14
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                          
Query: 83     atggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacctccgta 142
              |||||||||||||||||||||| ||| ||||||||||||||||| ||  ||| |||||| 
Sbjct: 124718 atggggacggagcggaagcgcatggtgagcctcttcgacgtggtcgatgagagctccgtc 124659

                                       
Query: 143    tcctccaagctcggccgcgccggca 167
              ||  |||||||||||| ||||||||
Sbjct: 124658 tctaccaagctcggccacgccggca 124634



to top

>dbj|AP004589.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0556A11
          Length = 138096

 Score =  186 bits (94), Expect = 3e-43
 Identities = 157/178 (88%)
 Strand = Plus / Minus

                                                                         
Query: 193   ggccaatccgtccatcaaccggtggaacggccggccctactcggcgcggtacctggagat 252
             |||||| |||||||||||  ||||||  ||  |||||||||||||  ||||||| |||||
Sbjct: 24128 ggccaacccgtccatcaattggtggacggggaggccctactcggcaaggtacctcgagat 24069

                                                                         
Query: 253   cctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttct 312
             |||| |||||| ||||||||||||||||||||||||||| ||||| ||||||  ||| ||
Sbjct: 24068 cctctagaagcaccgcacgctccccgtgtggcagcagaaggacgatttcctcgccgtcct 24009

                                                                       
Query: 313   ccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccactcag 370
             ||| |||||||||||||||||||| |||||||||||||||||  ||||||||||||||
Sbjct: 24008 ccgtgacaaccagaccctcatcctcgtcggagaaaccggaagcagcaagaccactcag 23951



 Score = 89.7 bits (45), Expect = 5e-14
 Identities = 75/85 (88%)
 Strand = Plus / Minus

                                                                         
Query: 83    atggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacctccgta 142
             |||||||||||||||||||||| ||| ||||||||||||||||| ||  ||| |||||| 
Sbjct: 24238 atggggacggagcggaagcgcatggtgagcctcttcgacgtggtcgatgagagctccgtc 24179

                                      
Query: 143   tcctccaagctcggccgcgccggca 167
             ||  |||||||||||| ||||||||
Sbjct: 24178 tctaccaagctcggccacgccggca 24154



to top

>gb|AC135398.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0079N13, complete sequence
          Length = 140946

 Score =  180 bits (91), Expect = 2e-41
 Identities = 130/143 (90%)
 Strand = Plus / Plus

                                                                         
Query: 225   ggccctactcggcgcggtacctggagatcctcgagaagcgccgcacgctccccgtgtggc 284
             |||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||
Sbjct: 38024 ggccctactcggcgaggtacctcgagatcctccagaagcgccgcacgctccccgtgtggc 38083

                                                                         
Query: 285   agcagaaagacgagttcctccgcgttctccgcgacaaccagaccctcatccttgtcggag 344
             ||||||| ||||| ||||||  ||| ||||| |||||||||||||||||||| |||| ||
Sbjct: 38084 agcagaaggacgatttcctcgccgtcctccgtgacaaccagaccctcatcctcgtcgtag 38143

                                    
Query: 345   aaaccggaagtggcaagaccact 367
             ||||||||||  |||||||||||
Sbjct: 38144 aaaccggaagcagcaagaccact 38166



 Score =  101 bits (51), Expect = 1e-17
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                         
Query: 77    gccgccatggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacc 136
             ||||| ||||||||||||| |||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 36971 gccgcgatggggacggagcagaagcgcaaggtgagcctcttcgacgtggtcgacgagacc 37030

                                            
Query: 137   tccgtatcctccaagctcggccgcgccggca 167
             ||| | ||| |||| ||||||| ||||||||
Sbjct: 37031 tccatctccgccaacctcggccacgccggca 37061



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score =  180 bits (91), Expect = 2e-41
 Identities = 130/143 (90%)
 Strand = Plus / Plus

                                                                            
Query: 225      ggccctactcggcgcggtacctggagatcctcgagaagcgccgcacgctccccgtgtggc 284
                |||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||
Sbjct: 15786330 ggccctactcggcgaggtacctcgagatcctccagaagcgccgcacgctccccgtgtggc 15786389

                                                                            
Query: 285      agcagaaagacgagttcctccgcgttctccgcgacaaccagaccctcatccttgtcggag 344
                ||||||| ||||| ||||||  ||| ||||| |||||||||||||||||||| |||| ||
Sbjct: 15786390 agcagaaggacgatttcctcgccgtcctccgtgacaaccagaccctcatcctcgtcgtag 15786449

                                       
Query: 345      aaaccggaagtggcaagaccact 367
                ||||||||||  |||||||||||
Sbjct: 15786450 aaaccggaagcagcaagaccact 15786472



 Score =  127 bits (64), Expect = 2e-25
 Identities = 97/108 (89%)
 Strand = Plus / Minus

                                                                            
Query: 254      ctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttctc 313
                |||||||||||||||||||||||||||||||||| ||| ||||| ||||||   || |||
Sbjct: 17897780 ctcgagaagcgccgcacgctccccgtgtggcagctgaaggacgatttcctcgctgtcctc 17897721

                                                                
Query: 314      cgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaag 361
                | |||||||||| |||||||||| ||||||||||||||||| ||||||
Sbjct: 17897720 cacgacaaccaggccctcatcctcgtcggagaaaccggaagcggcaag 17897673



 Score =  101 bits (51), Expect = 1e-17
 Identities = 81/91 (89%)
 Strand = Plus / Plus

                                                                            
Query: 77       gccgccatggggacggagcggaagcgcaaggtaagcctcttcgacgtggttgacaagacc 136
                ||||| ||||||||||||| |||||||||||| ||||||||||||||||| ||| |||||
Sbjct: 15785277 gccgcgatggggacggagcagaagcgcaaggtgagcctcttcgacgtggtcgacgagacc 15785336

                                               
Query: 137      tccgtatcctccaagctcggccgcgccggca 167
                ||| | ||| |||| ||||||| ||||||||
Sbjct: 15785337 tccatctccgccaacctcggccacgccggca 15785367



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 81/95 (85%), Gaps = 7/95 (7%)
 Strand = Plus / Minus

                                                                            
Query: 77       gccgccatggggacggagcggaagcgcaaggtaagcc-------tcttcgacgtggttga 129
                ||||| |||||||||||| ||||||||||||| ||||       ||||||||||||| ||
Sbjct: 17897951 gccgcgatggggacggagaggaagcgcaaggtgagccgtgagcctcttcgacgtggtcga 17897892

                                                   
Query: 130      caagacctccgtatcctccaagctcggccgcgccg 164
                |||||||||||| ||| ||||||||||| ||||||
Sbjct: 17897891 caagacctccgtctccgccaagctcggcggcgccg 17897857



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 1263     gagctggtcgtgctggaagaacgcagcctgggaagtgct 1301
                ||||||| || ||||||||||| | ||||||||||||||
Sbjct: 11815906 gagctgggcgagctggaagaactcggcctgggaagtgct 11815944



to top

>gb|AC172877.1| Brassica rapa subsp. pekinensis clone KBrH042F19, complete sequence
          Length = 108651

 Score =  165 bits (83), Expect = 1e-36
 Identities = 389/491 (79%)
 Strand = Plus / Plus

                                                                         
Query: 563   ttgacagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtacaag 622
             ||||| ||||||||||| ||||||||||||||||| ||||| ||| |||| || ||||| 
Sbjct: 15627 ttgactgatggtatgctactgagagaagcaatggcggacccgcttctagagagatacaaa 15686

                                                                         
Query: 623   gtgattgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgggctt 682
             || ||| |||| ||||||||||| ||| | ||  | || || ||||| || ||||| |||
Sbjct: 15687 gttattattctcgacgaggctcacgagaggactctcgccacggatgtgctctttggtctt 15746

                                                                         
Query: 683   ctgaaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctactctt 742
             |||||||| ||  | | ||| || |||||  | ||||| ||||| |||||||| ||||| 
Sbjct: 15747 ctgaaagaggtgttgaggaatagacctgatctcaagctggttgtcatgagtgcaactctg 15806

                                                                         
Query: 743   gaggcagagaagtttcagggttatttcagtggggcaccattgatgaaggttcctggtaga 802
             || || || ||||||||||  ||||| || || || ||  ||||||||||||| ||||| 
Sbjct: 15807 gaagccgaaaagtttcaggagtattttagcggcgcgcctctgatgaaggttcccggtagg 15866

                                                                         
Query: 803   cttcatccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgct 862
             ||||| || || ||||||||||| || ||||| || || || ||||| || || || |||
Sbjct: 15867 cttcaccccgtggagatcttctacactcaggagcctgagagagactacctcgaggctgct 15926

                                                                         
Query: 863   atcaggacagttgtgcagatacatatgtgtgaacctgctggtgatatccttgtattcctc 922
             || ||||| ||||| |||||||| ||||| || ||| |||||||||| ||||| ||| | 
Sbjct: 15927 attaggactgttgtccagatacacatgtgcgagcctcctggtgatattcttgtcttctta 15986

                                                                         
Query: 923   actggagaagaggagattgaggatgcatgtcgaaaaataaacaaggaagttaataacatg 982
             || ||||| |||||||| || || ||||| || || || ||||| || ||   |||  | 
Sbjct: 15987 accggagaggaggagatcgaagacgcatgccgcaagatcaacaaagaggtcggtaatctc 16046

                                                                         
Query: 983   ggtgatcaggttggcccagttaaagtcgtgccattgtactctactctcccccctgcaatg 1042
             || ||||| || || || || || ||||||||| ||||||| |||||||| || || |||
Sbjct: 16047 ggggatcaagtggggcctgtcaaggtcgtgccactgtactccactctcccaccagcgatg 16106

                        
Query: 1043  cagcagaagat 1053
             |||||||||||
Sbjct: 16107 cagcagaagat 16117



 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 1106  attgttgtgtccacaaacattgccgagacatccttaaccattgatgg 1152
             ||||||||||| || |||||||||||||| |||||||| ||||||||
Sbjct: 16170 attgttgtgtcgactaacattgccgagacttccttaactattgatgg 16216



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 81/100 (81%)
 Strand = Plus / Plus

                                                                         
Query: 417   tggttgcctgcacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcgg 476
             ||||||| ||||| ||||| || || ||||| || ||||| ||||| || ||||| || |
Sbjct: 15400 tggttgcttgcacacagcctcgtagagttgcagccatgtctgtctcccgccgtgttgctg 15459

                                                     
Query: 477   aggagatggatgtcacaatcggggaggaagttggttacag 516
             | |||||||||||  | || || || ||||||||||||||
Sbjct: 15460 atgagatggatgttgctattggagaagaagttggttacag 15499



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 2009  tagtacccaattgctttctccggcctag 2036
             ||||||||||||||||||| ||||||||
Sbjct: 17064 tagtacccaattgctttctacggcctag 17091



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 2416  ccggagtgggtcatctacaatgaatatgttctgaccaccaggaa 2459
             ||||||||||| |||||||| || |||||| |||| ||||||||
Sbjct: 17637 ccggagtgggttatctacaacgagtatgttttgactaccaggaa 17680



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 92/115 (80%)
 Strand = Plus / Plus

                                                                         
Query: 1532  ggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgcttgtcatcagt 1591
             ||||| || ||||| ||||||||||| || ||||||||| | ||||||||  |  | |||
Sbjct: 16596 ggtgagataatgagcgagttccccttggatccacagatggcgaagatgctcatagtgagt 16655

                                                                    
Query: 1592  ccaaggtacaactgttcaaatgagatcctctcaatatctgccatgctatcaggta 1646
             ||   || |||||| ||||| |||||||||||  | || || |||||||||||||
Sbjct: 16656 cctgagttcaactgctcaaacgagatcctctccgtttcagcaatgctatcaggta 16710



to top

>emb|CT962504.10| M.truncatula DNA sequence from clone MTH2-38L12 on chromosome 3,
             complete sequence
          Length = 126177

 Score =  147 bits (74), Expect = 3e-31
 Identities = 332/418 (79%)
 Strand = Plus / Plus

                                                                         
Query: 1226  ttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaacg 1285
             |||||||||||||| || ||||| ||||||  ||| ||| |||| |||||||||||||| 
Sbjct: 90379 ttggtgtctccaatatcaaaggctagtgcggttcagagatctgggcgtgctggaagaaca 90438

                                                                         
Query: 1286  cagcctgggaagtgcttcaggttgtacacagagaagagttttaatggtgatttacagccg 1345
             || || ||||| ||||| ||  | || || || |  ||||| |||  |||| | ||||||
Sbjct: 90439 caaccagggaaatgctttagactttatacggaaagaagtttcaataatgatcttcagccg 90498

                                                                         
Query: 1346  cagacctacccagaaatccttcggtcaaacctcgcaaacacagttcttactctgaagaag 1405
             |||||||| || |||||  |  | || || ||||| ||||||||||||||| ||||||| 
Sbjct: 90499 cagacctatcctgaaattttgagatctaatctcgccaacacagttcttactttgaagaaa 90558

                                                                         
Query: 1406  cttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactcta 1465
              | || || || |||||||| ||||||||||| ||||| ||||||||||| |||||  ||
Sbjct: 90559 ttgggtatagacgatttagtacattttgactttatggaccctcctgcaccagaaacctta 90618

                                                                         
Query: 1466  atgagggccttggaagttctgaactatttgggggcactcgacgatgaaggcaacctaaca 1525
             ||| | || ||||||||  |||| || ||||| ||| | || |||||||| ||| |||||
Sbjct: 90619 atgcgcgctttggaagtgttgaattacttgggtgcaatggatgatgaaggtaacttaaca 90678

                                                                         
Query: 1526  tctttaggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgcttgtc 1585
                || ||| | || ||||||||||| || || ||||| |||||||||||||||||||| 
Sbjct: 90679 aagttgggtaagattatgagtgagtttccgttggaccctcagatgtcaaagatgcttgtt 90738

                                                                       
Query: 1586  atcagtccaaggtacaactgttcaaatgagatcctctcaatatctgccatgctatcag 1643
              | || ||   || |||||||||||||||||| || ||||| ||||| ||||| ||||
Sbjct: 90739 gttagccctgagttcaactgttcaaatgagattctgtcaatttctgcgatgctgtcag 90796



 Score =  127 bits (64), Expect = 2e-25
 Identities = 160/192 (83%)
 Strand = Plus / Plus

                                                                         
Query: 566   acagatggtatgcttctgagagaagcaatggcagacccacttttagaaaggtacaaggtg 625
             ||||||||||||||| |||||||||||||| | || |||||||| ||| | ||||| |||
Sbjct: 89719 acagatggtatgcttttgagagaagcaatgacggatccacttttggaacgatacaaagtg 89778

                                                                         
Query: 626   attgttcttgacgaggctcatgagcgcacgttggcaacagatgttctgtttgggcttctg 685
             ||| ||||||| ||||| |||||  | || ||||| |||||||| || ||||| ||||| 
Sbjct: 89779 attattcttgatgaggcacatgaaaggactttggctacagatgtgctatttggccttctt 89838

                                                                         
Query: 686   aaagaagttctaaagaacaggcctgacttgaagcttgttgttatgagtgctactcttgag 745
             || |||||||| || ||||| || ||||||||| | |||||||||||||| || ||||| 
Sbjct: 89839 aaggaagttcttaaaaacagacccgacttgaagttggttgttatgagtgcaacacttgaa 89898

                         
Query: 746   gcagagaagttt 757
             || || ||||||
Sbjct: 89899 gctgaaaagttt 89910



 Score = 95.6 bits (48), Expect = 9e-16
 Identities = 114/136 (83%)
 Strand = Plus / Plus

                                                                         
Query: 2010  agtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggc 2069
             |||||||||||||||| ||||||||| |||||||||||  ||||| ||||| ||||| ||
Sbjct: 90795 agtacccaattgctttatccggcctaaggaggcacaaatagctgcggatgaagcgaaagc 90854

                                                                         
Query: 2070  tcgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
             | | |||   ||| | || || ||||||||||||||  ||||||| || ||||| |||||
Sbjct: 90855 taggtttatacacgttgatggagatcatctcacactcttgaatgtatatcatgcctacaa 90914

                             
Query: 2130  gcaaaacaatgaggat 2145
             ||||||||| ||||||
Sbjct: 90915 gcaaaacaacgaggat 90930



 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 137/171 (80%)
 Strand = Plus / Plus

                                                                         
Query: 995   ggcccagttaaagtcgtgccattgtactctactctcccccctgcaatgcagcagaagatt 1054
             ||||| || ||||| || || ||||| |||||||| ||||| || ||||| || | ||||
Sbjct: 90148 ggccctgtgaaagttgtaccgttgtattctactcttcccccggctatgcaacacaggatt 90207

                                                                         
Query: 1055  tttgaccctgccccacctccattgaaagagggaggccctgctggaaggaaaattgttgtg 1114
             ||||| || || ||||||||| | | ||||||||||| | |||||||||| ||| | || 
Sbjct: 90208 tttgagccagctccacctccagttagagagggaggccttcctggaaggaagattttggta 90267

                                                                
Query: 1115  tccacaaacattgccgagacatccttaaccattgatggtatagtgtatgtt 1165
             || |||||||| || || || || || |||||  |||||||||| ||||||
Sbjct: 90268 tcaacaaacatagcagaaacttcattgaccatcaatggtatagtctatgtt 90318



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 98/122 (80%)
 Strand = Plus / Plus

                                                                         
Query: 420   ttgcctgcacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcggagg 479
             |||| ||||| |||||||| || || ||||||||||| || || || || || || || |
Sbjct: 89118 ttgcatgcactcagccacgtagagtggctgcaatgtctgtttcccgccgcgtggctgaag 89177

                                                                         
Query: 480   agatggatgtcacaatcggggaggaagttggttacagtatccgattcgaagattgcagca 539
             |||||||||| |  || ||||| || |||||||| || ||| |||| |||||||| ||||
Sbjct: 89178 agatggatgtgagtattggggaagaggttggttatagcatcagatttgaagattgtagca 89237

               
Query: 540   gt 541
             ||
Sbjct: 89238 gt 89239



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 2405  tggaccataagccggagtgggtcatctacaatgaatatgttct 2447
             ||||||| ||||| || ||||| ||||| ||||||||||||||
Sbjct: 91193 tggaccacaagcctgaatgggttatctataatgaatatgttct 91235



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 58/70 (82%)
 Strand = Plus / Plus

                                                                         
Query: 892   tgaacctgctggtgatatccttgtattcctcactggagaagaggagattgaggatgcatg 951
             |||||||||||| ||  | ||||| || || |||||||| || ||||| || ||||||||
Sbjct: 90045 tgaacctgctggagacgtacttgtttttcttactggagaggaagagatagaagatgcatg 90104

                       
Query: 952   tcgaaaaata 961
             ||| ||||||
Sbjct: 90105 tcgcaaaata 90114



to top

>gb|AC136449.21| Medicago truncatula clone mth2-11k13, complete sequence
          Length = 112369

 Score =  143 bits (72), Expect = 4e-30
 Identities = 346/436 (79%), Gaps = 1/436 (0%)
 Strand = Plus / Minus

                                                                         
Query: 2011  gtacccaattgctttctccggcctagggaggcacaaaaggctgctgatgaggcgaaggct 2070
             ||||||||||||||| | ||||||||||| |||||| | ||||| ||||| || || |||
Sbjct: 25447 gtacccaattgctttattcggcctagggatgcacaagaagctgcagatgaagcaaaagct 25388

                                                                         
Query: 2071  cgatttgggcacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaag 2130
              | ||||  ||||| || || ||||||||||||||  |||| || |||||||| ||||||
Sbjct: 25387 aggtttgcacacattgatggagatcatctcacactattgaacgtataccatgcctacaag 25328

                                                                         
Query: 2131  caaaacaatgaggatcctacatggtgttatgagaattttgtcaatgcccgggcgatgaag 2190
             |||||||||||||||||  | ||||| ||||| || ||||| |||  | ||||| |||| 
Sbjct: 25327 caaaacaatgaggatccatcttggtgctatgaaaactttgttaatcacagggcgctgaaa 25268

                                                                         
Query: 2191  tctgctgataatgttagacaacaacttgtccgcatcatgaccagattcaacctcaagatg 2250
             || |||||||||||| ||||||| || || || |||||| |  | || ||||| ||| | 
Sbjct: 25267 tcagctgataatgttcgacaacagctagtgcgaatcatggctcggtttaacctgaagtta 25208

                                                                         
Query: 2251  tgcagtacagacttcaacagtcgtgagtactatgtcaatatcaggaaagcaatgctttcg 2310
             ||||| ||  ||||||| ||||| || ||||||||||| || |  || ||||||||  | 
Sbjct: 25207 tgcagcacttacttcaatagtcgcgactactatgtcaacattaaaaaggcaatgctagca 25148

                                                                         
Query: 2311  gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
             || ||||| |||||||| |||||| | ||||| || || || |||||||| || || |||
Sbjct: 25147 ggatacttcatgcaggtggctcatcttgagcggacaggacactacttgacagtgaaagat 25088

                                                                         
Query: 2371  aatcaggttgtccatcttcatccctcgaattgtatggaccataag-ccggagtgggtcat 2429
             || ||| | || ||  | ||||| || |||||  ||||||  ||| || |||||||| ||
Sbjct: 25087 aaccagatggtacaattgcatccatcaaattgcctggaccccaagccccgagtgggttat 25028

                             
Query: 2430  ctacaatgaatatgtt 2445
             ||| ||||||||||||
Sbjct: 25027 ctataatgaatatgtt 25012



 Score =  115 bits (58), Expect = 9e-22
 Identities = 205/254 (80%)
 Strand = Plus / Minus

                                                                         
Query: 1379  gcaaacacagttcttactctgaagaagcttggaattgatgatttagtgcattttgacttc 1438
             |||||||| ||||||||  |||||||  | || || ||||||||||| ||||||||||||
Sbjct: 25711 gcaaacacggttcttacattgaagaaattgggtatagatgatttagttcattttgacttc 25652

                                                                         
Query: 1439  atggatcctcctgcacctgaaactctaatgagggccttggaagttctgaactatttgggg 1498
             ||||| |||||||| ||||||||  ||||| | || ||||||||  |||| || || || 
Sbjct: 25651 atggaccctcctgctcctgaaaccttaatgcgtgctttggaagtgttgaattacttaggt 25592

                                                                         
Query: 1499  gcactcgacgatgaaggcaacctaacatctttaggtgaaatgatgagtgagttcccctta 1558
             ||| | || |||||||| ||| |||||    | ||||| || ||||||||||| || || 
Sbjct: 25591 gcaattgatgatgaaggtaacttaacaaagctgggtgagattatgagtgagtttccattg 25532

                                                                         
Query: 1559  gacccacagatgtcaaagatgcttgtcatcagtccaaggtacaactgttcaaatgagatc 1618
             ||||| |||||||||||||||||| |  | ||||||  || |||||||||||| ||||| 
Sbjct: 25531 gaccctcagatgtcaaagatgcttattgttagtccagagttcaactgttcaaacgagatt 25472

                           
Query: 1619  ctctcaatatctgc 1632
             || ||||| |||||
Sbjct: 25471 ctttcaatttctgc 25458



 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 152/187 (81%)
 Strand = Plus / Minus

                                                                         
Query: 1017  tgtactctactctcccccctgcaatgcagcagaagatttttgaccctgccccacctccat 1076
             |||| ||||| || ||||| || |||||||||||||||||||| || || || |||||| 
Sbjct: 26073 tgtattctacccttcccccagctatgcagcagaagatttttgagccagctccgcctccag 26014

                                                                         
Query: 1077  tgaaagagggaggccctgctggaaggaaaattgttgtgtccacaaacattgccgagacat 1136
             | || ||||||||||   ||||||| || ||||| || || |||||||| || || || |
Sbjct: 26013 ttaaggagggaggcctccctggaagaaagattgtggtatcaacaaacatagcagaaactt 25954

                                                                         
Query: 1137  ccttaaccattgatggtatagtgtatgttatagatccagggttttccaaacagaaggttt 1196
             | || || |||||||||||||| |||||||| || || || ||| |||| ||||||||||
Sbjct: 25953 ctttgactattgatggtatagtatatgttattgaccctggatttgccaagcagaaggttt 25894

                    
Query: 1197  acaatcc 1203
             | |||||
Sbjct: 25893 ataatcc 25887



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 152/194 (78%)
 Strand = Plus / Minus

                                                                         
Query: 416   atggttgcctgcacccagccacggagggttgctgcaatgtcggtctctcggcgtgtcgcg 475
             |||||||| ||||| || || || || ||||||||| |||| || || || || || || 
Sbjct: 26674 atggttgcatgcactcaacctcgtagagttgctgcactgtctgtttcacgccgcgtggct 26615

                                                                         
Query: 476   gaggagatggatgtcacaatcggggaggaagttggttacagtatccgattcgaagattgc 535
             || ||||||||||| |  || ||||| || |||||||| |||||| |||| |||||||| 
Sbjct: 26614 gaagagatggatgtaagtattggggaagaggttggttatagtatcagatttgaagattgt 26555

                                                                         
Query: 536   agcagtcacaaaactgttctcaaatatttgacagatggtatgcttctgagagaagcaatg 595
             || |||   |  || ||| | || ||| | ||||||||||||||| |||||||||| |||
Sbjct: 26554 agtagttcaaggacagttttgaagtatctaacagatggtatgcttttgagagaagcgatg 26495

                           
Query: 596   gcagacccactttt 609
              | || ||||||||
Sbjct: 26494 acggatccactttt 26481



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 63/76 (82%)
 Strand = Plus / Minus

                                                                         
Query: 1226  ttggtgtctccaatttccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaacg 1285
             |||||||||||||| || ||||| ||||| || || ||| | |||||||| |||||||| 
Sbjct: 25864 ttggtgtctccaatatcaaaggctagtgcacaccagagatcaggtcgtgccggaagaact 25805

                             
Query: 1286  cagcctgggaagtgct 1301
             || || ||||| ||||
Sbjct: 25804 caaccggggaaatgct 25789



to top

>gb|AC133710.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0002A19, complete sequence
          Length = 139052

 Score =  127 bits (64), Expect = 2e-25
 Identities = 97/108 (89%)
 Strand = Plus / Minus

                                                                         
Query: 254   ctcgagaagcgccgcacgctccccgtgtggcagcagaaagacgagttcctccgcgttctc 313
             |||||||||||||||||||||||||||||||||| ||| ||||| ||||||   || |||
Sbjct: 58065 ctcgagaagcgccgcacgctccccgtgtggcagctgaaggacgatttcctcgctgtcctc 58006

                                                             
Query: 314   cgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaag 361
             | |||||||||| |||||||||| ||||||||||||||||| ||||||
Sbjct: 58005 cacgacaaccaggccctcatcctcgtcggagaaaccggaagcggcaag 57958



 Score = 81.8 bits (41), Expect = 1e-11
 Identities = 81/95 (85%), Gaps = 7/95 (7%)
 Strand = Plus / Minus

                                                                         
Query: 77    gccgccatggggacggagcggaagcgcaaggtaagcc-------tcttcgacgtggttga 129
             ||||| |||||||||||| ||||||||||||| ||||       ||||||||||||| ||
Sbjct: 58236 gccgcgatggggacggagaggaagcgcaaggtgagccgtgagcctcttcgacgtggtcga 58177

                                                
Query: 130   caagacctccgtatcctccaagctcggccgcgccg 164
             |||||||||||| ||| ||||||||||| ||||||
Sbjct: 58176 caagacctccgtctccgccaagctcggcggcgccg 58142



to top

>ref|XM_859190.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 18 (LOC488856), mRNA
          Length = 2849

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1540 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1599

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1600 aaactctgatgagagcctt 1618



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2085 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2144

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2145 aaccaggt 2152



to top

>ref|XM_859167.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 17 (LOC488856), mRNA
          Length = 2882

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1558 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1617

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1618 aaactctgatgagagcctt 1636



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2118 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2177

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2178 aaccaggt 2185



to top

>ref|XM_859144.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 16 (LOC488856), mRNA
          Length = 2879

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1558 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1617

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1618 aaactctgatgagagcctt 1636



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2115 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2174

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2175 aaccaggt 2182



to top

>ref|XM_545974.2| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 1 (LOC488856), mRNA
          Length = 2933

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1624 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1683

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1684 aaactctgatgagagcctt 1702



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2169 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2228

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2229 aaccaggt 2236



to top

>ref|XM_859091.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 15 (LOC488856), mRNA
          Length = 2870

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1561 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1620

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1621 aaactctgatgagagcctt 1639



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2106 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2165

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2166 aaccaggt 2173



to top

>ref|XM_859050.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 13 (LOC488856), mRNA
          Length = 2882

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1573 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1632

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1633 aaactctgatgagagcctt 1651



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2118 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2177

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2178 aaccaggt 2185



to top

>ref|XM_859028.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 12 (LOC488856), mRNA
          Length = 2689

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1558 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1617

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1618 aaactctgatgagagcctt 1636



to top

>ref|XM_859010.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 11 (LOC488856), mRNA
          Length = 2777

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1468 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1527

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1528 aaactctgatgagagcctt 1546



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2013 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2072

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2073 aaccaggt 2080



to top

>ref|XM_858909.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 6 (LOC488856), mRNA
          Length = 2309

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1558 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1617

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1618 aaactctgatgagagcctt 1636



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2121 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2180

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2181 aaccaggt 2188



to top

>ref|XM_858894.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 5 (LOC488856), mRNA
          Length = 2267

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1534 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1593

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1594 aaactctgatgagagcctt 1612



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2079 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2138

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2139 aaccaggt 2146



to top

>ref|XM_846442.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 2 (LOC488856), mRNA
          Length = 3005

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1696 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1755

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1756 aaactctgatgagagcctt 1774



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2241 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2300

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2301 aaccaggt 2308



to top

>ref|XM_858830.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 3 (LOC488856), mRNA
          Length = 2056

 Score = 93.7 bits (47), Expect = 3e-15
 Identities = 71/79 (89%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| ||||||||||| |||||||||||||| |||||||| || || ||||
Sbjct: 1558 tgaagaagcttggtattgatgatttggtgcattttgactttatggatccaccagctcctg 1617

                               
Query: 1458 aaactctaatgagggcctt 1476
            ||||||| ||||| |||||
Sbjct: 1618 aaactctgatgagagcctt 1636



to top

>ref|XM_961271.1| PREDICTED: Tribolium castaneum similar to CG11107-PA (LOC654855),
            mRNA
          Length = 2559

 Score = 85.7 bits (43), Expect = 8e-13
 Identities = 73/83 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| || |||||||||||||| || |||||||||||||||||||| || || ||||
Sbjct: 1412 tgaagaaactgggaattgatgatttggttcattttgacttcatggatccaccggcgcctg 1471

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||  | |||||||||||||||
Sbjct: 1472 aaaccttgatgagggccttggaa 1494



to top

>ref|XM_716671.1| Candida albicans SC5314 putative spliceosomal RNA helicase
            (CaO19_1687), mRNA
          Length = 2304

 Score = 79.8 bits (40), Expect = 5e-11
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1118 acaaacattgccgagacatccttaaccattgatggtatagtgtatgttatagatccaggg 1177
            |||||||||||||| || || || || |||||||| ||||| |||||  | |||||||| 
Sbjct: 1135 acaaacattgccgaaacttctttgactattgatgggatagtatatgtggtcgatccagga 1194

                                                                        
Query: 1178 ttttccaaacagaaggtttacaatccaaggataagggtggaatcccttttggtgtctcca 1237
            ||||| ||||| || |||||||| |||||  |||| || ||||| |||||||||||||| 
Sbjct: 1195 ttttcaaaacaaaaagtttacaacccaagagtaagagttgaatcacttttggtgtctcct 1254

                    
Query: 1238 atttccaa 1245
            || |||||
Sbjct: 1255 atatccaa 1262



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1412 attgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgagg 1471
            ||||| ||||| || ||||||||||| ||||| ||||| || || |||||| | ||||| 
Sbjct: 1429 attgacgatttggttcattttgactttatggaccctccagctccagaaactatgatgaga 1488

                      
Query: 1472 gccttggaag 1481
            ||||||||||
Sbjct: 1489 gccttggaag 1498



to top

>ref|XM_716551.1| Candida albicans SC5314 putative spliceosomal RNA helicase
            (CaO19_9255), mRNA
          Length = 2304

 Score = 79.8 bits (40), Expect = 5e-11
 Identities = 106/128 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1118 acaaacattgccgagacatccttaaccattgatggtatagtgtatgttatagatccaggg 1177
            |||||||||||||| || || || || |||||||| ||||| |||||  | |||||||| 
Sbjct: 1135 acaaacattgccgaaacttctttgactattgatgggatagtatatgtggtcgatccagga 1194

                                                                        
Query: 1178 ttttccaaacagaaggtttacaatccaaggataagggtggaatcccttttggtgtctcca 1237
            ||||| ||||| || |||||||| |||||  |||| || ||||| |||||||||||||| 
Sbjct: 1195 ttttcaaaacaaaaagtttacaacccaagagtaagagttgaatcacttttggtgtctcct 1254

                    
Query: 1238 atttccaa 1245
            || |||||
Sbjct: 1255 atatccaa 1262



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1412 attgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgagg 1471
            ||||| ||||| || ||||||||||| ||||| ||||| || || |||||| | ||||| 
Sbjct: 1429 attgacgatttggttcattttgactttatggaccctccagctccagaaactatgatgaga 1488

                      
Query: 1472 gccttggaag 1481
            ||||||||||
Sbjct: 1489 gccttggaag 1498



to top

>ref|XM_859069.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 14 (LOC488856), mRNA
          Length = 2675

 Score = 77.8 bits (39), Expect = 2e-10
 Identities = 63/71 (88%)
 Strand = Plus / Plus

                                                                        
Query: 1406 cttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactcta 1465
            ||||| ||||||||||| |||||||||||||| |||||||| || || ||||||||||| 
Sbjct: 1374 cttggtattgatgatttggtgcattttgactttatggatccaccagctcctgaaactctg 1433

                       
Query: 1466 atgagggcctt 1476
            ||||| |||||
Sbjct: 1434 atgagagcctt 1444



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 1911 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 1970

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 1971 aaccaggt 1978



to top

>ref|XM_627301.1| Cryptosporidium parvum Iowa II PRP43 involved in spliceosome
            disassembly mRNA splicing (cgd8_4100), partial mRNA
          Length = 2145

 Score = 77.8 bits (39), Expect = 2e-10
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1416 atgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgag 1470
            |||||||||| ||||||||||| ||||||||||| |||||||||||| |||||||
Sbjct: 1295 atgatttagttcattttgactttatggatcctccagcacctgaaactttaatgag 1349



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 1145 attgatggtatagtgtatgttatagatccagggttttccaaaca 1188
            |||||||| ||||| ||||| ||||||||||| ||||| |||||
Sbjct: 1024 attgatggaatagtttatgtaatagatccaggattttcaaaaca 1067



to top

>ref|XM_662242.1| Cryptosporidium hominis TU502 RNA helicase (Chro.80471) partial mRNA
          Length = 2145

 Score = 77.8 bits (39), Expect = 2e-10
 Identities = 51/55 (92%)
 Strand = Plus / Plus

                                                                   
Query: 1416 atgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgag 1470
            |||||||||| ||||||||||| ||||||||||| |||||||||||| |||||||
Sbjct: 1295 atgatttagttcattttgactttatggatcctccagcacctgaaactttaatgag 1349



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                        
Query: 1145 attgatggtatagtgtatgttatagatccagggttttccaaaca 1188
            |||||||| ||||| ||||| ||||||||||| ||||| |||||
Sbjct: 1024 attgatggaatagtttatgtaatagatccaggattttcaaaaca 1067



to top

>ref|XM_001176826.1| PREDICTED: Strongylocentrotus purpuratus putative RNA-dependent
            ATPase, transcript variant 1 (PRP1), mRNA
          Length = 2188

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 133/165 (80%)
 Strand = Plus / Plus

                                                                        
Query: 2320 atgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatcaggtt 2379
            |||||||||||||| |||||  | ||||| || ||  |||| || |||||||| ||||||
Sbjct: 2009 atgcaggttgctcacttggaaaggactggtcactatctgacggtcaaggataaccaggtt 2068

                                                                        
Query: 2380 gtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatctacaatgaa 2439
            ||||| |||||||| || |  ||| | ||||||||||| || |||||  |||||||||| 
Sbjct: 2069 gtccagcttcatccatccacctgtcttgaccataagcctgaatgggttctctacaatgag 2128

                                                         
Query: 2440 tatgttctgaccaccaggaatttcatccgtacagtcaccgatatc 2484
            | ||| |||||||| | ||| | | |||| |||||||| ||||||
Sbjct: 2129 tttgtactgaccactaagaactacgtccgaacagtcacagatatc 2173



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 1019 tactctactctcccccctgcaatgcagcagaagatttttgaccctgcccc 1068
            ||||| || ||||||||||| |||||||||| ||| ||||| | ||||||
Sbjct: 1055 tactccaccctcccccctgccatgcagcagaggatctttgagcatgcccc 1104



to top

>ref|XM_001176970.1| PREDICTED: Strongylocentrotus purpuratus putative RNA-dependent
            ATPase, transcript variant 2 (PRP1), mRNA
          Length = 2869

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 133/165 (80%)
 Strand = Plus / Plus

                                                                        
Query: 2320 atgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatcaggtt 2379
            |||||||||||||| |||||  | ||||| || ||  |||| || |||||||| ||||||
Sbjct: 1985 atgcaggttgctcacttggaaaggactggtcactatctgacggtcaaggataaccaggtt 2044

                                                                        
Query: 2380 gtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatctacaatgaa 2439
            ||||| |||||||| || |  ||| | ||||||||||| || |||||  |||||||||| 
Sbjct: 2045 gtccagcttcatccatccacctgtcttgaccataagcctgaatgggttctctacaatgag 2104

                                                         
Query: 2440 tatgttctgaccaccaggaatttcatccgtacagtcaccgatatc 2484
            | ||| |||||||| | ||| | | |||| |||||||| ||||||
Sbjct: 2105 tttgtactgaccactaagaactacgtccgaacagtcacagatatc 2149



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 1019 tactctactctcccccctgcaatgcagcagaagatttttgaccctgcccc 1068
            ||||| || ||||||||||| |||||||||| ||| ||||| | ||||||
Sbjct: 1055 tactccaccctcccccctgccatgcagcagaggatctttgagcatgcccc 1104



to top

>ref|XM_796883.2| PREDICTED: Strongylocentrotus purpuratus putative RNA-dependent
            ATPase, transcript variant 7 (PRP1), mRNA
          Length = 2188

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 133/165 (80%)
 Strand = Plus / Plus

                                                                        
Query: 2320 atgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatcaggtt 2379
            |||||||||||||| |||||  | ||||| || ||  |||| || |||||||| ||||||
Sbjct: 2009 atgcaggttgctcacttggaaaggactggtcactatctgacggtcaaggataaccaggtt 2068

                                                                        
Query: 2380 gtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatctacaatgaa 2439
            ||||| |||||||| || |  ||| | ||||||||||| || |||||  |||||||||| 
Sbjct: 2069 gtccagcttcatccatccacctgtcttgaccataagcctgaatgggttctctacaatgag 2128

                                                         
Query: 2440 tatgttctgaccaccaggaatttcatccgtacagtcaccgatatc 2484
            | ||| |||||||| | ||| | | |||| |||||||| ||||||
Sbjct: 2129 tttgtactgaccactaagaactacgtccgaacagtcacagatatc 2173



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 1019 tactctactctcccccctgcaatgcagcagaagatttttgaccctgcccc 1068
            ||||| || ||||||||||| |||||||||| ||| ||||| | ||||||
Sbjct: 1055 tactccaccctcccccctgccatgcagcagaggatctttgagcatgcccc 1104



to top

>ref|XM_775329.2| PREDICTED: Strongylocentrotus purpuratus putative RNA-dependent
            ATPase, transcript variant 1 (PRP1), mRNA
          Length = 2869

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 133/165 (80%)
 Strand = Plus / Plus

                                                                        
Query: 2320 atgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatcaggtt 2379
            |||||||||||||| |||||  | ||||| || ||  |||| || |||||||| ||||||
Sbjct: 1985 atgcaggttgctcacttggaaaggactggtcactatctgacggtcaaggataaccaggtt 2044

                                                                        
Query: 2380 gtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatctacaatgaa 2439
            ||||| |||||||| || |  ||| | ||||||||||| || |||||  |||||||||| 
Sbjct: 2045 gtccagcttcatccatccacctgtcttgaccataagcctgaatgggttctctacaatgag 2104

                                                         
Query: 2440 tatgttctgaccaccaggaatttcatccgtacagtcaccgatatc 2484
            | ||| |||||||| | ||| | | |||| |||||||| ||||||
Sbjct: 2105 tttgtactgaccactaagaactacgtccgaacagtcacagatatc 2149



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 1019 tactctactctcccccctgcaatgcagcagaagatttttgaccctgcccc 1068
            ||||| || ||||||||||| |||||||||| ||| ||||| | ||||||
Sbjct: 1055 tactccaccctcccccctgccatgcagcagaggatctttgagcatgcccc 1104



to top

>ref|NM_001074418.1| Oryza sativa (japonica cultivar-group) Os11g0474400 (Os11g0474400)
           mRNA, complete cds
          Length = 1221

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 311 ctccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccact 367
           ||||| |||||||||||||||||||| |||| ||||||||||||  |||||||||||
Sbjct: 16  ctccgtgacaaccagaccctcatcctcgtcgtagaaaccggaagcagcaagaccact 72



to top

>ref|XM_874839.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 16
            (LOC512327), mRNA
          Length = 2444

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1705 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1764

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1765 aaactctgatgag 1777



to top

>ref|XM_864986.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 2
            (LOC512327), mRNA
          Length = 2629

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1712 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1771

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1772 aaactctgatgag 1784



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2257 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2303



to top

>ref|XM_874665.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 15
            (LOC512327), mRNA
          Length = 2626

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1705 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1764

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1765 aaactctgatgag 1777



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2262 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2308



to top

>ref|XM_874579.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 14
            (LOC512327), mRNA
          Length = 2604

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1687 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1746

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1747 aaactctgatgag 1759



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2232 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2278



to top

>ref|XM_874495.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 13
            (LOC512327), mRNA
          Length = 2600

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1687 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1746

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1747 aaactctgatgag 1759



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2235 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2281



to top

>ref|XM_874418.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 12
            (LOC512327), mRNA
          Length = 2600

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1687 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1746

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1747 aaactctgatgag 1759



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2235 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2281



to top

>ref|XM_874337.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 11
            (LOC512327), mRNA
          Length = 2664

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1747 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1806

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1807 aaactctgatgag 1819



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2292 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2338



to top

>ref|XM_874254.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 10
            (LOC512327), mRNA
          Length = 2625

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1708 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1767

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1768 aaactctgatgag 1780



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2253 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2299



to top

>ref|XM_874078.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 8
            (LOC512327), mRNA
          Length = 2430

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1513 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1572

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1573 aaactctgatgag 1585



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2058 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2104



to top

>ref|XM_873988.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 7
            (LOC512327), mRNA
          Length = 2583

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1666 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1725

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1726 aaactctgatgag 1738



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2211 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2257



to top

>ref|XM_873894.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 6
            (LOC512327), mRNA
          Length = 2414

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1681 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1740

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1741 aaactctgatgag 1753



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2226 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2272



to top

>ref|XM_873606.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 4
            (LOC512327), mRNA
          Length = 2535

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 64/73 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| ||||||||||| || |||||||| || || ||||
Sbjct: 1618 tgaagaaacttggtattgatgatttggtgcattttgattttatggatccaccagctcctg 1677

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1678 aaactctgatgag 1690



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2163 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2209



to top

>ref|XM_858986.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 10 (LOC488856), mRNA
          Length = 3077

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                             
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcc 1446
            ||||||||||||| ||||||||||| |||||||||||||| ||||||||
Sbjct: 1678 tgaagaagcttggtattgatgatttggtgcattttgactttatggatcc 1726



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2313 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2372

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2373 aaccaggt 2380



to top

>ref|NM_001031159.1| Gallus gallus DEAH (Asp-Glu-Ala-His) box polypeptide 15 (DHX15), mRNA
 emb|AJ851741.1| Gallus gallus mRNA for hypothetical protein, clone 24b10
          Length = 2892

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 67/77 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
            ||||||||||| || |||||||| ||||| ||||| || ||||||||||| || ||||||
Sbjct: 1586 aagaagcttggtatagatgatttggtgcactttgattttatggatcctccagctcctgaa 1645

                             
Query: 1460 actctaatgagggcctt 1476
            ||||| ||||| |||||
Sbjct: 1646 actctcatgagagcctt 1662



 Score = 50.1 bits (25), Expect = 0.047
 Identities = 79/97 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1107 ttgttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgtta 1166
            ||||||||||||| |||||||| ||||| || ||||| || |||||| | |||| ||| |
Sbjct: 1293 ttgttgtgtccactaacattgctgagacgtcattaacaatagatggtgttgtgtttgtga 1352

                                                 
Query: 1167 tagatccagggttttccaaacagaaggtttacaatcc 1203
            | ||||| || ||| | ||||| ||||| || |||||
Sbjct: 1353 ttgatcctggctttgcaaaacaaaaggtatataatcc 1389



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1295 aagtgcttcaggttgtacacagagaag 1321
            |||||||||||| ||||||||||||||
Sbjct: 1481 aagtgcttcaggctgtacacagagaag 1507



to top

>dbj|AK067929.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013126E13, full
           insert sequence
          Length = 1222

 Score = 73.8 bits (37), Expect = 3e-09
 Identities = 52/57 (91%)
 Strand = Plus / Plus

                                                                    
Query: 311 ctccgcgacaaccagaccctcatccttgtcggagaaaccggaagtggcaagaccact 367
           ||||| |||||||||||||||||||| |||| ||||||||||||  |||||||||||
Sbjct: 17  ctccgtgacaaccagaccctcatcctcgtcgtagaaaccggaagcagcaagaccact 73



to top

>gb|BC068766.1| Xenopus laevis hypothetical protein MGC81281, mRNA (cDNA clone
            MGC:81281 IMAGE:6631829), complete cds
          Length = 3614

 Score = 71.9 bits (36), Expect = 1e-08
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
            ||||| ||||| ||||||||||| || |||||||| |||||||| ||||| || ||||||
Sbjct: 1520 aagaaacttggcattgatgatttggttcattttgatttcatggaccctccagctcctgaa 1579

                                            
Query: 1460 actctaatgagggccttggaagttctgaacta 1491
            ||| ||||| | ||| ||||| || |||||||
Sbjct: 1580 actttaatgcgtgccctggaacttttgaacta 1611



to top

>ref|XM_456737.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0A09581g)
            partial mRNA
          Length = 2292

 Score = 71.9 bits (36), Expect = 1e-08
 Identities = 132/164 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1121 aacattgccgagacatccttaaccattgatggtatagtgtatgttatagatccagggttt 1180
            ||||||||||| || || || |||||||| || || || |||||  | || || || |||
Sbjct: 1129 aacattgccgaaacttcgttgaccattgacggaattgtctatgtggttgaccctggtttt 1188

                                                                        
Query: 1181 tccaaacagaaggtttacaatccaaggataagggtggaatcccttttggtgtctccaatt 1240
            ||||| || ||||||||||||||||| || || || |||||  | |||||||| ||||||
Sbjct: 1189 tccaagcaaaaggtttacaatccaagaatcagagttgaatcgttattggtgtcgccaatt 1248

                                                        
Query: 1241 tccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaac 1284
            || || |||  |||||| |||||||||||| | ||||| |||||
Sbjct: 1249 tcaaaagcatctgcgcaacaaagagctggtagagctggtagaac 1292



to top

>emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS767 of Debaryomyces
              hansenii
          Length = 1249565

 Score = 71.9 bits (36), Expect = 1e-08
 Identities = 132/164 (80%)
 Strand = Plus / Minus

                                                                          
Query: 1121   aacattgccgagacatccttaaccattgatggtatagtgtatgttatagatccagggttt 1180
              ||||||||||| || || || |||||||| || || || |||||  | || || || |||
Sbjct: 785666 aacattgccgaaacttcgttgaccattgacggaattgtctatgtggttgaccctggtttt 785607

                                                                          
Query: 1181   tccaaacagaaggtttacaatccaaggataagggtggaatcccttttggtgtctccaatt 1240
              ||||| || ||||||||||||||||| || || || |||||  | |||||||| ||||||
Sbjct: 785606 tccaagcaaaaggtttacaatccaagaatcagagttgaatcgttattggtgtcgccaatt 785547

                                                          
Query: 1241   tccaaggcaagtgcgcatcaaagagctggtcgtgctggaagaac 1284
              || || |||  |||||| |||||||||||| | ||||| |||||
Sbjct: 785546 tcaaaagcatctgcgcaacaaagagctggtagagctggtagaac 785503



to top

>ref|XM_001164560.1| PREDICTED: Pan troglodytes similar to Putative pre-mRNA-splicing
            factor ATP-dependent RNA helicase DHX15 (DEAH box protein
            15), transcript variant 1 (LOC461142), mRNA
          Length = 2953

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1646 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1705

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1706 aaactctgatgagagccctggaa 1728



 Score = 54.0 bits (27), Expect = 0.003
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| |||||| ||| || 
Sbjct: 1357 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtagtgtttgtgatt 1416

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1417 gatcctggatttgcgaaacagaaggtctacaatcc 1451



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||||||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1054 catcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaatt 1113

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1114 cgaacagttatccagattcatatgtgtgaa 1143



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2191 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2250

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2251 aaccaggt 2258



to top

>ref|XM_001164599.1| PREDICTED: Pan troglodytes similar to Putative pre-mRNA-splicing
            factor ATP-dependent RNA helicase DHX15 (DEAH box protein
            15), transcript variant 2 (LOC461142), mRNA
          Length = 3058

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1751 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1810

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1811 aaactctgatgagagccctggaa 1833



 Score = 54.0 bits (27), Expect = 0.003
 Identities = 78/95 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| |||||| ||| || 
Sbjct: 1462 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtagtgtttgtgatt 1521

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1522 gatcctggatttgcgaaacagaaggtctacaatcc 1556



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||||||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1159 catcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaatt 1218

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1219 cgaacagttatccagattcatatgtgtgaa 1248



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2296 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2355

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2356 aaccaggt 2363



to top

>ref|XM_001105716.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-His) box polypeptide 15,
            transcript variant 1 (DHX15), mRNA
          Length = 2953

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1646 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1705

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1706 aaactctgatgagagccctggaa 1728



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2191 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2250

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2251 aaccaggt 2258



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| | |||| ||| || 
Sbjct: 1357 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtggtgtttgtgatt 1416

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1417 gatcctggatttgcgaaacagaaggtctacaatcc 1451



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1054 catcctgttgagatcttttatactccagaaccagagagagattatcttgaagcagcaatt 1113

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1114 cgaacagttatccagattcatatgtgtgaa 1143



to top

>ref|XM_001105991.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-His) box polypeptide 15,
            transcript variant 4 (DHX15), mRNA
          Length = 3040

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1733 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1792

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1793 aaactctgatgagagccctggaa 1815



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2278 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2337

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2338 aaccaggt 2345



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| | |||| ||| || 
Sbjct: 1444 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtggtgtttgtgatt 1503

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1504 gatcctggatttgcgaaacagaaggtctacaatcc 1538



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1159 catcctgttgagatcttttatactccagaaccagagagagattatcttgaagcagcaatt 1218

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1219 cgaacagttatccagattcatatgtgtgaa 1248



to top

>ref|XM_001105914.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-His) box polypeptide 15,
            transcript variant 3 (DHX15), mRNA
          Length = 3067

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1751 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1810

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1811 aaactctgatgagagccctggaa 1833



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2305 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2364

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2365 aaccaggt 2372



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| | |||| ||| || 
Sbjct: 1462 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtggtgtttgtgatt 1521

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1522 gatcctggatttgcgaaacagaaggtctacaatcc 1556



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1159 catcctgttgagatcttttatactccagaaccagagagagattatcttgaagcagcaatt 1218

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1219 cgaacagttatccagattcatatgtgtgaa 1248



to top

>ref|XM_001106067.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-His) box polypeptide 15,
            transcript variant 5 (DHX15), mRNA
          Length = 3058

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1751 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1810

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1811 aaactctgatgagagccctggaa 1833



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2296 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2355

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2356 aaccaggt 2363



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| | |||| ||| || 
Sbjct: 1462 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtggtgtttgtgatt 1521

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1522 gatcctggatttgcgaaacagaaggtctacaatcc 1556



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1159 catcctgttgagatcttttatactccagaaccagagagagattatcttgaagcagcaatt 1218

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1219 cgaacagttatccagattcatatgtgtgaa 1248



to top

>ref|XM_001105781.1| PREDICTED: Macaca mulatta DEAH (Asp-Glu-Ala-His) box polypeptide 15,
            transcript variant 2 (DHX15), mRNA
          Length = 2690

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1751 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1810

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1811 aaactctgatgagagccctggaa 1833



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2296 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2355

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2356 aaccaggt 2363



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| | |||| ||| || 
Sbjct: 1462 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtggtgtttgtgatt 1521

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1522 gatcctggatttgcgaaacagaaggtctacaatcc 1556



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1159 catcctgttgagatcttttatactccagaaccagagagagattatcttgaagcagcaatt 1218

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1219 cgaacagttatccagattcatatgtgtgaa 1248



to top

>ref|NM_121494.1| Arabidopsis thaliana helicase (AT5G14900) mRNA, complete cds
          Length = 906

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 47/51 (92%)
 Strand = Plus / Plus

                                                               
Query: 1531 aggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgct 1581
            |||||| |||||||||||||| || ||||||||||||||| ||||||||||
Sbjct: 165  aggtgagatgatgagtgagtttcctttagacccacagatggcaaagatgct 215



to top

>ref|XM_740796.1| Plasmodium chabaudi chabaudi ATP-dependant RNA helicase
            (PC000370.02.0) partial mRNA
          Length = 2112

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1412 attgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgag 1470
            |||||||||||||||||||| || || |||||||| ||||| ||||||||| |||||||
Sbjct: 1285 attgatgatttagtgcatttcgattttatggatccacctgctcctgaaactttaatgag 1343



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 540 gtcacaaaactgttctcaaatatttgacagatggtatgcttctgagagaa 589
           ||||||||||  || | |||||||| ||||||||||||||| | ||||||
Sbjct: 416 gtcacaaaacaattataaaatatttaacagatggtatgcttttaagagaa 465



to top

>emb|CR926098.1| Pongo pygmaeus mRNA; cDNA DKFZp459N1310 (from clone DKFZp459N1310)
          Length = 2959

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1647 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1706

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1707 aaactctgatgagagccctggaa 1729



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| |  |||||||| || || ||||| |||||||| || 
Sbjct: 1055 catcctgttgagatcttttatactccagaaccagagagagattatcttgaagccgcaatt 1114

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1115 cgaacagttatccagattcatatgtgtgaa 1144



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2192 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2251

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2252 aaccaggt 2259



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| | |||| ||| || 
Sbjct: 1358 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtggtgtttgtgatt 1417

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1418 gatcctggatttgcaaaacagaaggtctacaatcc 1452



to top

>emb|AL391146.1|ATF2G14 Arabidopsis thaliana DNA chromosome 5, BAC clone F2G14 (ESSA project)
          Length = 85992

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                               
Query: 1531 aggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgct 1581
            |||||| |||||||||||||| || ||||||||||||||| ||||||||||
Sbjct: 8166 aggtgagatgatgagtgagtttcctttagacccacagatggcaaagatgct 8116



to top

>emb|CR858867.1| Pongo pygmaeus mRNA; cDNA DKFZp469J2426 (from clone DKFZp469J2426)
          Length = 3007

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 71/83 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || |||||||| || || ||||
Sbjct: 1698 tgaagaaacttggtattgatgatttggtacattttgattttatggatccaccagctcctg 1757

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1758 aaactctgatgagagccctggaa 1780



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| |  |||||||| || || ||||| |||||||| || 
Sbjct: 1106 catcctgttgagatcttttatactccagaaccagagagagattatcttgaagccgcaatt 1165

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1166 cgaacagttatccagattcatatgtgtgaa 1195



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2243 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2302

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2303 aaccaggt 2310



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 77/95 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1109 gttgtgtccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttata 1168
            |||||||| || ||||| || |||||||| || || || |||||| | |||| ||| || 
Sbjct: 1409 gttgtgtcaactaacatagcagagacatctttgacaatagatggtgtggtgtttgtgatt 1468

                                               
Query: 1169 gatccagggttttccaaacagaaggtttacaatcc 1203
            ||||| || ||| | ||||||||||| ||||||||
Sbjct: 1469 gatcctggatttgcaaaacagaaggtctacaatcc 1503



to top

>ref|XM_721572.1| Plasmodium yoelii yoelii str. 17XNL ATP-dependent RNA helicase
            protein (PY06080) partial mRNA
          Length = 2358

 Score = 69.9 bits (35), Expect = 5e-08
 Identities = 53/59 (89%)
 Strand = Plus / Plus

                                                                       
Query: 1412 attgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgag 1470
            |||||||||||||| ||||| || || |||||||||||||||||||||||  |||||||
Sbjct: 1531 attgatgatttagtacatttcgattttatggatcctcctgcacctgaaacattaatgag 1589



to top

>ref|XM_451555.1| Kluyveromyces lactis NRRL Y-1140, KLLA0B00561g predicted mRNA
          Length = 2304

 Score = 67.9 bits (34), Expect = 2e-07
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1145 attgatggtatagtgtatgttatagatccagggttttccaaacagaaggtttacaatcca 1204
            ||||| ||||| ||||||||| | ||||| || || || || || || |||||||| |||
Sbjct: 1150 attgacggtattgtgtatgttgttgatcctggtttctctaagcaaaaagtttacaaccca 1209

                                                                        
Query: 1205 aggataagggtggaatcccttttggtgtctccaatttccaaggcaagtgcgcatcaaaga 1264
            || || || || |||||||||||||| ||||||||||| ||||||   || || ||||||
Sbjct: 1210 agaattagagttgaatcccttttggtctctccaatttcaaaggcatcagctcaacaaaga 1269

                  
Query: 1265 gctggt 1270
            ||||||
Sbjct: 1270 gctggt 1275



to top

>gb|AY815802.1| Schistosoma japonicum SJCHGC04007 protein mRNA, complete cds
          Length = 580

 Score = 67.9 bits (34), Expect = 2e-07
 Identities = 64/74 (86%)
 Strand = Plus / Plus

                                                                        
Query: 2320 atgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatcaggtt 2379
            ||||||||||||||||| || || ||||| ||||| || || ||||| || |||||||||
Sbjct: 8    atgcaggttgctcattttgaacgtactggacattatttaactgttaaagacaatcaggtt 67

                          
Query: 2380 gtccatcttcatcc 2393
            ||||| ||||||||
Sbjct: 68   gtccagcttcatcc 81



to top

>emb|CR382122.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome B of strain NRRL
             Y-1140 of Kluyveromyces lactis
          Length = 1320834

 Score = 67.9 bits (34), Expect = 2e-07
 Identities = 103/126 (81%)
 Strand = Plus / Plus

                                                                         
Query: 1145  attgatggtatagtgtatgttatagatccagggttttccaaacagaaggtttacaatcca 1204
             ||||| ||||| ||||||||| | ||||| || || || || || || |||||||| |||
Sbjct: 43433 attgacggtattgtgtatgttgttgatcctggtttctctaagcaaaaagtttacaaccca 43492

                                                                         
Query: 1205  aggataagggtggaatcccttttggtgtctccaatttccaaggcaagtgcgcatcaaaga 1264
             || || || || |||||||||||||| ||||||||||| ||||||   || || ||||||
Sbjct: 43493 agaattagagttgaatcccttttggtctctccaatttcaaaggcatcagctcaacaaaga 43552

                   
Query: 1265  gctggt 1270
             ||||||
Sbjct: 43553 gctggt 43558



to top

>gb|AC189295.1| Brassica rapa subsp. pekinensis clone KBrB026G01, complete sequence
          Length = 122209

 Score = 65.9 bits (33), Expect = 8e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                         
Query: 1262  agagctggtcgtgctggaagaacgcagcctgggaagtgcttcaggttgtacacagagaag 1321
             |||||||||||||| || ||||| | ||||||||| || |||||| | ||||||||||||
Sbjct: 19201 agagctggtcgtgcaggtagaacacggcctgggaaatgtttcaggctttacacagagaag 19142

                  
Query: 1322  agttt 1326
             |||||
Sbjct: 19141 agttt 19137



 Score = 54.0 bits (27), Expect = 0.003
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                                
Query: 2416  ccggagtgggtcatctacaatgaatatgttctgac 2450
             |||||||||||  ||||||||||||||||||||||
Sbjct: 18412 ccggagtgggtagtctacaatgaatatgttctgac 18378



 Score = 50.1 bits (25), Expect = 0.047
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                              
Query: 563   ttgacagatggtatgcttctgagagaagcaatg 595
             ||||| |||||||||||| ||||||||||||||
Sbjct: 19861 ttgaccgatggtatgcttatgagagaagcaatg 19829



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 90/112 (80%)
 Strand = Plus / Minus

                                                                         
Query: 1532  ggtgaaatgatgagtgagttccccttagacccacagatgtcaaagatgcttgtcatcagt 1591
             ||||| |||||||||||||| || || || || |||||| ||||||||||| |  |||||
Sbjct: 18931 ggtgagatgatgagtgagtttcctttggatccgcagatggcaaagatgcttatagtcagt 18872

                                                                 
Query: 1592  ccaaggtacaactgttcaaatgagatcctctcaatatctgccatgctatcag 1643
             || |  | |||||| || || ||||| |||||||| || || ||| ||||||
Sbjct: 18871 cctaaattcaactgctccaacgagattctctcaatttcagctatgttatcag 18820



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 138/176 (78%)
 Strand = Plus / Minus

                                                                         
Query: 785   atgaaggttcctggtagacttcatccggttgagatcttctatacccaggaaccagaaagg 844
             ||||| ||||| || || || ||||| || |||||||| || || || ||||| || || 
Sbjct: 19639 atgaaagttccgggaaggctccatcccgtagagatcttgtacacgcaagaacctgagaga 19580

                                                                         
Query: 845   gactatctagaagccgctatcaggacagttgtgcagatacatatgtgtgaacctgctggt 904
             |||||||| || || |||||  |||||||||| ||||| || |||| ||| ||  | |||
Sbjct: 19579 gactatcttgacgctgctattcggacagttgttcagattcacatgtctgagccgcccggt 19520

                                                                     
Query: 905   gatatccttgtattcctcactggagaagaggagattgaggatgcatgtcgaaaaat 960
             ||| | ||||| ||| | || || || ||||||||||| ||||||||  |||||||
Sbjct: 19519 gatgttcttgttttcttaaccggcgaggaggagattgaagatgcatgcagaaaaat 19464



to top

>ref|XM_001123240.1| PREDICTED: Apis mellifera similar to CG11107-PA (LOC727531), partial
            mRNA
          Length = 635

 Score = 65.9 bits (33), Expect = 8e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| |||||||| || || |||||||| || ||||||||||||||||| |
Sbjct: 207  tgaagaaacttggcattgatgacttggtacattttgattttatggatcctcctgcaccag 266

                         
Query: 1458 aaactctaatgag 1470
            |||| || |||||
Sbjct: 267  aaacacttatgag 279



to top

>ref|XM_392081.3| PREDICTED: Apis mellifera similar to CG11107-PA, transcript variant 1
            (LOC408535), mRNA
          Length = 2623

 Score = 65.9 bits (33), Expect = 8e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| |||||||| || || |||||||| || ||||||||||||||||| |
Sbjct: 1388 tgaagaaacttggcattgatgacttggtacattttgattttatggatcctcctgcaccag 1447

                         
Query: 1458 aaactctaatgag 1470
            |||| || |||||
Sbjct: 1448 aaacacttatgag 1460



to top

>ref|XM_674162.1| Plasmodium berghei strain ANKA ATP-dependant RNA helicase,
            (PB000897.02.0) partial mRNA
          Length = 2112

 Score = 65.9 bits (33), Expect = 8e-07
 Identities = 57/65 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1412 attgatgatttagtgcattttgacttcatggatcctcctgcacctgaaactctaatgagg 1471
            ||||| |||||||| ||||| || || |||||||||||||| ||||||||| ||||||| 
Sbjct: 1285 attgacgatttagtacatttcgattttatggatcctcctgcccctgaaactttaatgaga 1344

                 
Query: 1472 gcctt 1476
            |||||
Sbjct: 1345 gcctt 1349



to top

>emb|CR380952.1| Candida glabrata strain CBS138 chromosome F complete sequence
          Length = 927101

 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 125/156 (80%)
 Strand = Plus / Minus

                                                                          
Query: 1115   tccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttatagatcca 1174
              |||||||| ||||| || ||||| || |||||||| ||||| || |||||| | || |||
Sbjct: 699538 tccacaaatattgcagaaacatcgttgaccattgacggtattgtttatgttgttgaccca 699479

                                                                          
Query: 1175   gggttttccaaacagaaggtttacaatccaaggataagggtggaatcccttttggtgtct 1234
              || || || ||||| ||||| || ||||| || |||||||| |||||  | ||||| || 
Sbjct: 699478 ggtttctcaaaacaaaaggtgtataatcctagaataagggtcgaatctttgttggtttca 699419

                                                  
Query: 1235   ccaatttccaaggcaagtgcgcatcaaagagctggt 1270
              |||||||| |||||   ||| || ||||||||||||
Sbjct: 699418 ccaatttctaaggcttctgctcaacaaagagctggt 699383



to top

>ref|XM_446279.1| Candida glabrata CBS138, CAGL0F07139g partial mRNA
          Length = 2307

 Score = 63.9 bits (32), Expect = 3e-06
 Identities = 125/156 (80%)
 Strand = Plus / Plus

                                                                        
Query: 1115 tccacaaacattgccgagacatccttaaccattgatggtatagtgtatgttatagatcca 1174
            |||||||| ||||| || ||||| || |||||||| ||||| || |||||| | || |||
Sbjct: 1132 tccacaaatattgcagaaacatcgttgaccattgacggtattgtttatgttgttgaccca 1191

                                                                        
Query: 1175 gggttttccaaacagaaggtttacaatccaaggataagggtggaatcccttttggtgtct 1234
            || || || ||||| ||||| || ||||| || |||||||| |||||  | ||||| || 
Sbjct: 1192 ggtttctcaaaacaaaaggtgtataatcctagaataagggtcgaatctttgttggtttca 1251

                                                
Query: 1235 ccaatttccaaggcaagtgcgcatcaaagagctggt 1270
            |||||||| |||||   ||| || ||||||||||||
Sbjct: 1252 ccaatttctaaggcttctgctcaacaaagagctggt 1287



to top

>ref|NM_001358.2| Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 15 (DHX15), mRNA
          Length = 3019

 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| |||||||| || || |||||||| || |||||||| || || ||||
Sbjct: 1709 tgaagaaacttggtattgatgacttggtacattttgattttatggatccaccagctcctg 1768

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1769 aaactctgatgagagccctggaa 1791



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||||||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1117 catcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaatt 1176

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1177 cgaacagttatccagattcatatgtgtgaa 1206



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2254 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2313

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2314 aaccaggt 2321



to top

>gb|BC035974.1| Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 15, mRNA (cDNA
            clone MGC:32617 IMAGE:4806964), complete cds
          Length = 3018

 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| |||||||| || || |||||||| || |||||||| || || ||||
Sbjct: 1696 tgaagaaacttggtattgatgacttggtacattttgattttatggatccaccagctcctg 1755

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1756 aaactctgatgagagccctggaa 1778



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||||||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1104 catcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaatt 1163

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1164 cgaacagttatccagattcatatgtgtgaa 1193



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2241 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2300

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2301 aaccaggt 2308



to top

>ref|XM_752152.1| Ustilago maydis 521 hypothetical protein (UM01098.1) partial mRNA
          Length = 4212

 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 908 atccttgtattcctcactggagaagaggagattgaggatgcatgtcg 954
           |||||||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 925 atccttgtcttcctcaccggtgaagaggagattgaggatgcctgtcg 971



to top

>emb|CR605943.1| full-length cDNA clone CS0DL005YA19 of B cells (Ramos cell line) Cot
            25-normalized of Homo sapiens (human)
          Length = 1814

 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| |||||||| || || |||||||| || |||||||| || || ||||
Sbjct: 550  tgaagaaacttggtattgatgacttggtacattttgattttatggatccaccagctcctg 609

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 610  aaactctgatgagagccctggaa 632



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 1095 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 1154

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 1155 aaccaggt 1162



to top

>gb|AF279891.1| Homo sapiens dead box protein 15 mRNA, complete cds
          Length = 2441

 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| |||||||| || || |||||||| || |||||||| || || ||||
Sbjct: 1541 tgaagaaacttggtattgatgacttggtacattttgattttatggatccaccagctcctg 1600

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1601 aaactctgatgagagccctggaa 1623



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||||||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 949  catcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaatt 1008

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1009 cgaacagttatccagattcatatgtgtgaa 1038



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2086 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2145

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2146 aaccaggt 2153



to top

>dbj|AB001636.1| Homo sapiens mRNA for ATP-dependent RNA helicase #46, complete cds
          Length = 3028

 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| |||||||| || || |||||||| || |||||||| || || ||||
Sbjct: 1702 tgaagaaacttggtattgatgacttggtacattttgattttatggatccaccagctcctg 1761

                                   
Query: 1458 aaactctaatgagggccttggaa 1480
            ||||||| ||||| ||| |||||
Sbjct: 1762 aaactctgatgagagccctggaa 1784



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||||||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 1110 catcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaatt 1169

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             | |||||| | ||||| ||||||||||||
Sbjct: 1170 cgaacagttatccagattcatatgtgtgaa 1199



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2247 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2306

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2307 aaccaggt 2314



to top

>gb|AY813717.1| Schistosoma japonicum SJCHGC06976 protein mRNA, complete cds
          Length = 936

 Score = 60.0 bits (30), Expect = 5e-05
 Identities = 63/74 (85%)
 Strand = Plus / Plus

                                                                        
Query: 2320 atgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatcaggtt 2379
            ||||||||||||||| | || || ||||| ||||| || || ||||| || |||||||||
Sbjct: 418  atgcaggttgctcatcttgaacgtactggacattatttaactgttaaagacaatcaggtt 477

                          
Query: 2380 gtccatcttcatcc 2393
            ||||| ||||||||
Sbjct: 478  gtccagcttcatcc 491



to top

>ref|XM_001030651.1| Tetrahymena thermophila SB210 Helicase associated domain (HA2)
            (TTHERM_01044780) mRNA, complete cds
          Length = 2235

 Score = 58.0 bits (29), Expect = 2e-04
 Identities = 68/81 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1388 gttcttactctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcct 1447
            ||||||||| | || |||||||| ||| ||||||| || || || || || |||||||||
Sbjct: 1375 gttcttactttaaaaaagcttggtattaatgatttggtacacttcgattttatggatcct 1434

                                 
Query: 1448 cctgcacctgaaactctaatg 1468
            ||||| ||||||||| |||||
Sbjct: 1435 cctgctcctgaaactttaatg 1455



to top

>dbj|AK230569.1| Sus scrofa mRNA, clone:AMP010010H06, expressed in alveolar macrophage
          Length = 3036

 Score = 58.0 bits (29), Expect = 2e-04
 Identities = 62/73 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||| ||||| ||||||||||| || |||||||| || ||||| || || || ||||
Sbjct: 1710 tgaagaaacttggtattgatgatttggtacattttgattttatggacccaccagctcctg 1769

                         
Query: 1458 aaactctaatgag 1470
            ||||||| |||||
Sbjct: 1770 aaactctgatgag 1782



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2255 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2314

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2315 aaccaggt 2322



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 73/90 (81%)
 Strand = Plus / Plus

                                                                        
Query: 806  catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
            ||||| ||||||||||| ||||| | ||||||||| || || ||||| ||||| || || 
Sbjct: 1118 catcctgttgagatcttttatactccggaaccagagagagattatctcgaagcagcaatt 1177

                                          
Query: 866  aggacagttgtgcagatacatatgtgtgaa 895
             |||||||  | || || ||||||||||||
Sbjct: 1178 cggacagtgatccaaattcatatgtgtgaa 1207



to top

>ref|XM_874168.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 9
            (LOC512327), mRNA
          Length = 2604

 Score = 58.0 bits (29), Expect = 2e-04
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcc 1446
            ||||||| ||||| ||||||||||| ||||||||||| || ||||||||
Sbjct: 1687 tgaagaaacttggtattgatgatttggtgcattttgattttatggatcc 1735



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2232 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2278



to top

>ref|XM_873796.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 5
            (LOC512327), mRNA
          Length = 2832

 Score = 58.0 bits (29), Expect = 2e-04
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcc 1446
            ||||||| ||||| ||||||||||| ||||||||||| || ||||||||
Sbjct: 1816 tgaagaaacttggtattgatgatttggtgcattttgattttatggatcc 1864



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 2460 gggtattttatgcaggtggcacatttagaacgaacagggcattactt 2506



to top

>ref|NM_001042620.1| Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 15 (Dhx15),
            transcript variant 1, mRNA
          Length = 2982

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1709 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1768

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1769 gaaactctgatgagagccctagaacttttgaattatttgg 1808



to top

>ref|NM_007839.2| Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 15 (Dhx15),
            transcript variant 2, mRNA
          Length = 3009

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1709 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1768

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1769 gaaactctgatgagagccctagaacttttgaattatttgg 1808



to top

>ref|XM_652645.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0133.2), mRNA
          Length = 2310

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                           
Query: 902 ggtgatatccttgtattcctcactggagaagaggagattgaggatgca 949
           |||||||| ||| ||||| | |||||||| ||||||||||||||||||
Sbjct: 928 ggtgatattcttctattcttgactggagaggaggagattgaggatgca 975



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1253 gcgcatcaaagagctggtcgtgctgga 1279
            ||||| |||||||||||||||||||||
Sbjct: 1285 gcgcaacaaagagctggtcgtgctgga 1311



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcc 1449
            |||||| | ||||| ||||| || |||||||| ||||| |||||||||||
Sbjct: 1432 aagaagttgggaatcgatgacttggtgcatttcgacttgatggatcctcc 1481



to top

>gb|BC100343.1| Mus musculus DEAH (Asp-Glu-Ala-His) box polypeptide 15, mRNA (cDNA
            clone MGC:117685 IMAGE:30935044), complete cds
          Length = 2577

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1679 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1738

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1739 gaaactctgatgagagccctagaacttttgaattatttgg 1778



to top

>dbj|AK146441.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
            library, clone:I730098D05 product:DEAH (Asp-Glu-Ala-His)
            box polypeptide 15, full insert sequence
          Length = 2976

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1683 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1742

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1743 gaaactctgatgagagccctagaacttttgaattatttgg 1782



to top

>dbj|AK151015.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830020G10 product:DEAH (Asp-Glu-Ala-His)
            box polypeptide 15, full insert sequence
          Length = 2991

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1699 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1758

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1759 gaaactctgatgagagccctagaacttttgaattatttgg 1798



to top

>dbj|AK151757.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:I830036K10 product:DEAH (Asp-Glu-Ala-His)
            box polypeptide 15, full insert sequence
          Length = 2991

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1699 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1758

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1759 gaaactctgatgagagccctagaacttttgaattatttgg 1798



to top

>dbj|AK149869.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length enriched
            library, clone:G530024G01 product:DEAH (Asp-Glu-Ala-His)
            box polypeptide 15, full insert sequence
          Length = 2102

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1698 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1757

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1758 gaaactctgatgagagccctagaacttttgaattatttgg 1797



to top

>dbj|AK145983.1| Mus musculus 14 days pregnant adult female placenta cDNA, RIKEN
            full-length enriched library, clone:I530022B22
            product:DEAH (Asp-Glu-Ala-His) box polypeptide 15, full
            insert sequence
          Length = 2986

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1686 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1745

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1746 gaaactctgatgagagccctagaacttttgaattatttgg 1785



to top

>dbj|AK168835.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920059A12 product:DEAH (Asp-Glu-Ala-His)
            box polypeptide 15, full insert sequence
          Length = 2997

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1704 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1763

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1764 gaaactctgatgagagccctagaacttttgaattatttgg 1803



to top

>dbj|AK167927.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
            clone:I730041D07 product:DEAH (Asp-Glu-Ala-His) box
            polypeptide 15, full insert sequence
          Length = 2900

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1609 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1668

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1669 gaaactctgatgagagccctagaacttttgaattatttgg 1708



to top

>dbj|AK169174.1| Mus musculus 16 days embryo kidney cDNA, RIKEN full-length enriched
            library, clone:I920087J23 product:DEAH (Asp-Glu-Ala-His)
            box polypeptide 15, full insert sequence
          Length = 2997

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1704 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1763

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1764 gaaactctgatgagagccctagaacttttgaattatttgg 1803



to top

>gb|AE016814.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome I,
              complete sequence
          Length = 691920

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 55/64 (85%)
 Strand = Plus / Minus

                                                                          
Query: 1398   tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
              |||||||||| || ||||| || || || ||||| ||||| ||||||||||| |||||||
Sbjct: 666606 tgaagaagctgggtattgacgacttggttcatttcgactttatggatcctccagcacctg 666547

                  
Query: 1458   aaac 1461
              ||||
Sbjct: 666546 aaac 666543



to top

>ref|NM_208076.1| Eremothecium gossypii AAR180Cp (AAR180C), mRNA
          Length = 2301

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 55/64 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            |||||||||| || ||||| || || || ||||| ||||| ||||||||||| |||||||
Sbjct: 1406 tgaagaagctgggtattgacgacttggttcatttcgactttatggatcctccagcacctg 1465

                
Query: 1458 aaac 1461
            ||||
Sbjct: 1466 aaac 1469



to top

>dbj|AK115322.1| Ciona intestinalis cDNA, clone:cieg044o15, full insert sequence
          Length = 1722

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 97/120 (80%)
 Strand = Plus / Plus

                                                                        
Query: 2316 ctttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggataatca 2375
            |||||||||||| || || ||||||||||| || |||||||| ||||| || || || ||
Sbjct: 665  ctttatgcaggtggcacacttggagcgaaccggacattacttaaccgtgaaagacaacca 724

                                                                        
Query: 2376 ggttgtccatcttcatccctcgaattgtatggaccataagccggagtgggtcatctacaa 2435
            ||| || || ||||| ||||| |  ||| | |||||||| || ||||||||  |||||||
Sbjct: 725  ggtagttcaacttcacccctctacgtgtcttgaccataaacctgagtgggttctctacaa 784



 Score = 46.1 bits (23), Expect = 0.73
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1424 gtgcattttgacttcatggatcc 1446
            |||||||||||||||||||||||
Sbjct: 141  gtgcattttgacttcatggatcc 163



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 2080 cacatcgacggggatcatctcacacttctgaatgtgtaccatgcatacaa 2129
            ||||||||||| |||||||| || ||||| || || |||||||| |||||
Sbjct: 429  cacatcgacggcgatcatcttactcttctcaacgtttaccatgcgtacaa 478



to top

>gb|BC003745.1| Mus musculus cDNA clone IMAGE:3489032, containing frame-shift errors
          Length = 3012

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1679 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1738

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1739 gaaactctgatgagagccctagaacttttgaattatttgg 1778



to top

>gb|AF017153.1|AF017153 Mus musculus putative RNA helicase and RNA dependent ATPase (mDEAH9)
            mRNA, complete cds
          Length = 2877

 Score = 56.0 bits (28), Expect = 8e-04
 Identities = 82/100 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1397 ctgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacct 1456
            |||||||||||||| |||||||| || || || ||||| || ||||| || || || |||
Sbjct: 1584 ctgaagaagcttggtattgatgacttggtacactttgattttatggacccaccagctcct 1643

                                                    
Query: 1457 gaaactctaatgagggccttggaagttctgaactatttgg 1496
            |||||||| ||||| ||| | ||| || |||| |||||||
Sbjct: 1644 gaaactctgatgagagccctagaacttttgaattatttgg 1683



to top

>ref|XM_001054651.1| PREDICTED: Rattus norvegicus DEAH (Asp-Glu-Ala-His) box polypeptide
            15 (predicted) (Dhx15_predicted), mRNA
          Length = 3038

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| |||||||| || || |||||||| || ||||| || || || || |
Sbjct: 1736 tgaagaagcttggtattgatgacttggtacattttgattttatggacccaccagctcccg 1795

                                                   
Query: 1458 aaactctaatgagggccttggaagttctgaactatttgg 1496
            ||||||| ||||| ||  | ||| ||||||| |||||||
Sbjct: 1796 aaactctgatgagagcgctagaacttctgaattatttgg 1834



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2281 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2340

                          
Query: 2371 aatcaggttgtcca 2384
            || ||||| |||||
Sbjct: 2341 aaccaggtggtcca 2354



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 1289 cctgggaagtgcttcaggttgtacacagagaa 1320
            |||||||| ||||||||| |||||||||||||
Sbjct: 1627 cctgggaaatgcttcaggctgtacacagagaa 1658



to top

>ref|XM_214053.4| PREDICTED: Rattus norvegicus DEAH (Asp-Glu-Ala-His) box polypeptide
            15 (predicted) (Dhx15_predicted), mRNA
          Length = 3038

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 81/99 (81%)
 Strand = Plus / Plus

                                                                        
Query: 1398 tgaagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctg 1457
            ||||||||||||| |||||||| || || |||||||| || ||||| || || || || |
Sbjct: 1736 tgaagaagcttggtattgatgacttggtacattttgattttatggacccaccagctcccg 1795

                                                   
Query: 1458 aaactctaatgagggccttggaagttctgaactatttgg 1496
            ||||||| ||||| ||  | ||| ||||||| |||||||
Sbjct: 1796 aaactctgatgagagcgctagaacttctgaattatttgg 1834



 Score = 52.0 bits (26), Expect = 0.012
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2281 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2340

                          
Query: 2371 aatcaggttgtcca 2384
            || ||||| |||||
Sbjct: 2341 aaccaggtggtcca 2354



 Score = 48.1 bits (24), Expect = 0.18
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 1289 cctgggaagtgcttcaggttgtacacagagaa 1320
            |||||||| ||||||||| |||||||||||||
Sbjct: 1627 cctgggaaatgcttcaggctgtacacagagaa 1658



to top

>gb|U13644.1| Caenorhabditis elegans cosmid F56D2, complete sequence
          Length = 19383

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 2056  gatgaggcgaaggctcgatttgggcacatcgacggggatcatctcacacttctgaatgt 2114
             ||||||||||||||||| ||||  || || || || ||||||||||||||||| |||||
Sbjct: 11393 gatgaggcgaaggctcggtttgcacatattgatggagatcatctcacacttctcaatgt 11335



to top

>ref|NM_171131.3| Caenorhabditis elegans F56D2.6b (F56D2.6) mRNA, complete cds
          Length = 2420

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 2056 gatgaggcgaaggctcgatttgggcacatcgacggggatcatctcacacttctgaatgt 2114
            ||||||||||||||||| ||||  || || || || ||||||||||||||||| |||||
Sbjct: 1676 gatgaggcgaaggctcggtttgcacatattgatggagatcatctcacacttctcaatgt 1734



to top

>ref|NM_171130.3| Caenorhabditis elegans F56D2.6a (F56D2.6) mRNA, complete cds
          Length = 2475

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 2056 gatgaggcgaaggctcgatttgggcacatcgacggggatcatctcacacttctgaatgt 2114
            ||||||||||||||||| ||||  || || || || ||||||||||||||||| |||||
Sbjct: 1675 gatgaggcgaaggctcggtttgcacatattgatggagatcatctcacacttctcaatgt 1733



to top

>ref|XM_748395.1| Aspergillus fumigatus Af293 pre-mRNA splicing factor RNA helicase
           Prp43 (Afu5g11620) partial mRNA
          Length = 2304

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 557 aaatatttgacagatggtatgcttctgagagaagc 591
           |||||| |||| |||||||||||||||||||||||
Sbjct: 577 aaatatatgacggatggtatgcttctgagagaagc 611



 Score = 50.1 bits (25), Expect = 0.047
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 500 gaggaagttggttacagtatccgattcga 528
           ||||||||||||||||||||||| |||||
Sbjct: 520 gaggaagttggttacagtatccgtttcga 548



to top

>emb|AL929357.1|PFA929357 Plasmodium falciparum strain 3D7, chromosome 9; segment 3/5
          Length = 341050

 Score = 54.0 bits (27), Expect = 0.003
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                         
Query: 1118  acaaacattgccgagacatccttaaccattgatggtatagtgtatgttatagatccaggg 1177
             ||||| ||||| || |||||| |||| ||||||||||| || ||||| || |||||||| 
Sbjct: 65788 acaaatattgcagaaacatccataactattgatggtattgtttatgtaattgatccaggt 65729

                        
Query: 1178  ttttccaaaca 1188
             ||||| |||||
Sbjct: 65728 ttttcaaaaca 65718



to top

>ref|NM_200024.1| Danio rerio DEAH (Asp-Glu-Ala-His) box polypeptide 16 (dhx16), mRNA
 gb|BC045393.1| Danio rerio DEAH (Asp-Glu-Ala-His) box polypeptide 16, mRNA (cDNA
            clone MGC:55590 IMAGE:2643405), complete cds
          Length = 3477

 Score = 52.0 bits (26), Expect = 0.012
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 1427 cattttgacttcatggatcctcctgcacctgaaactct 1464
            |||||||||||||||||||||||| | | |||||||||
Sbjct: 2448 cattttgacttcatggatcctcctcctcatgaaactct 2485



to top

>gb|AC115110.3| Homo sapiens BAC clone RP11-192P23 from 4, complete sequence
          Length = 171128

 Score = 52.0 bits (26), Expect = 0.012
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                         
Query: 806   catccggttgagatcttctatacccaggaaccagaaagggactatctagaagccgctatc 865
             ||||| ||||||||||||||||| |  |||||||| || || ||||| ||||| || || 
Sbjct: 86446 catcctgttgagatcttctatactccagaaccagagagagattatcttgaagcagcaatt 86387

                                           
Query: 866   aggacagttgtgcagatacatatgtgtgaa 895
              | |||||| | ||||| ||||||||||||
Sbjct: 86386 cgaacagttatccagattcatatgtgtgaa 86357



to top

>ref|XM_697097.1| PREDICTED: Danio rerio hypothetical protein LOC554775 (LOC554775),
            mRNA
          Length = 2019

 Score = 52.0 bits (26), Expect = 0.012
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 1427 cattttgacttcatggatcctcctgcacctgaaactct 1464
            |||||||||||||||||||||||| | | |||||||||
Sbjct: 1009 cattttgacttcatggatcctcctcctcatgaaactct 1046



to top

>ref|XM_663301.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.10299)
            partial mRNA
          Length = 2598

 Score = 50.1 bits (25), Expect = 0.047
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                     
Query: 1406 cttggaattgatgatttagtgcattttgacttcatggatcc 1446
            ||||| |||||||||||| | |||||||| |||||||||||
Sbjct: 1819 cttgggattgatgatttactacattttgatttcatggatcc 1859



to top

>gb|BC055510.1| Danio rerio DEAH (Asp-Glu-Ala-His) box polypeptide 15, mRNA (cDNA
           clone IMAGE:5410166), containing frame-shift errors
          Length = 2417

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 630 ttcttgacgaggctcatgagcgcacgttggcaacagatgttctg 673
           ||||||||||||| || ||||||||||| || |||||| |||||
Sbjct: 710 ttcttgacgaggcccacgagcgcacgttagccacagatattctg 753



to top

>gb|BC048369.1| Danio rerio DEAH (Asp-Glu-Ala-His) box polypeptide 15, mRNA (cDNA
           clone IMAGE:2639158)
          Length = 2819

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 630 ttcttgacgaggctcatgagcgcacgttggcaacagatgttctg 673
           ||||||||||||| || ||||||||||| || |||||| |||||
Sbjct: 790 ttcttgacgaggcccacgagcgcacgttagccacagatattctg 833



to top

>ref|XM_858970.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 9 (LOC488856), mRNA
          Length = 1324

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 560  gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 619

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 620  aaccaggt 627



to top

>ref|XM_858950.1| PREDICTED: Canis familiaris similar to Putative pre-mRNA splicing
            factor RNA helicase (DEAH box protein 15), transcript
            variant 8 (LOC488856), mRNA
          Length = 2028

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 1264 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 1323

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 1324 aaccaggt 1331



to top

>dbj|AK055898.1| Homo sapiens cDNA FLJ31336 fis, clone MAMGL1000178, highly similar to
            PUTATIVE PRE-MRNA SPLICING FACTOR RNA HELICASE
          Length = 2071

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 1322 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 1381

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 1382 aaccaggt 1389



to top

>dbj|AK056726.1| Homo sapiens cDNA FLJ32164 fis, clone PLACE6000379, highly similar to
            PUTATIVE PRE-MRNA SPLICING FACTOR RNA HELICASE
          Length = 2015

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 1262 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 1321

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 1322 aaccaggt 1329



to top

>ref|XM_823555.1| Trypanosoma brucei TREU927 pre-mRNA splicing factor (Tb11.02.3460)
            partial mRNA
          Length = 3141

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 1125 ttgccgagacatccttaaccattgatggtata 1156
            |||| ||||||||||| |||||||||||||||
Sbjct: 1880 ttgcagagacatccttgaccattgatggtata 1911



to top

>gb|BC047577.1| Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 15, mRNA (cDNA
            clone IMAGE:4814516), complete cds
          Length = 3041

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 2277 gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 2336

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 2337 aaccaggt 2344



to top

>ref|XM_693517.1| PREDICTED: Danio rerio wu:fb38f09 (wu:fb38f09), mRNA
          Length = 2816

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 630 ttcttgacgaggctcatgagcgcacgttggcaacagatgttctg 673
           ||||||||||||| || ||||||||||| || |||||| |||||
Sbjct: 780 ttcttgacgaggcccacgagcgcacgttagccacagatattctg 823



to top

>emb|CR617314.1| full-length cDNA clone CS0DD009YD17 of Neuroblastoma Cot
            50-normalized of Homo sapiens (human)
          Length = 1093

 Score = 48.1 bits (24), Expect = 0.18
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattacttgaccgttaaggat 2370
            ||||| ||||||||||| || ||||| || ||||| ||||||||||| || || || |||
Sbjct: 359  gggtattttatgcaggtggcacatttagaacgaacagggcattacttaactgtgaaagat 418

                    
Query: 2371 aatcaggt 2378
            || |||||
Sbjct: 419  aaccaggt 426



to top

>ref|XM_001033091.1| Tetrahymena thermophila SB210 RNA helicase, putative
            (TTHERM_00441760) mRNA, complete cds
          Length = 5340

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 545  aaaactgttctcaaatatttgacagatggtatgct 579
            ||||||||| | |||||| ||||||||||||||||
Sbjct: 1540 aaaactgttattaaatatatgacagatggtatgct 1574



to top

>ref|NM_001074288.1| Oryza sativa (japonica cultivar-group) Os11g0310800 (Os11g0310800)
            mRNA, complete cds
          Length = 2451

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 1263 gagctggtcgtgctggaagaacgcagcctgggaagtgct 1301
            ||||||| || ||||||||||| | ||||||||||||||
Sbjct: 1070 gagctgggcgagctggaagaactcggcctgggaagtgct 1108



to top

>ref|NM_001063571.1| Oryza sativa (japonica cultivar-group) Os06g0192500 (Os06g0192500)
           mRNA, complete cds
          Length = 2689

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 336 ttgtcggagaaaccggaagtggcaagaccactcag 370
           ||||||| || ||||||||||||||||| ||||||
Sbjct: 434 ttgtcggcgagaccggaagtggcaagacaactcag 468



to top

>ref|NM_102984.3| Arabidopsis thaliana EMB2733; ATP binding / ATP-dependent RNA
            helicase/ ATP-dependent helicase/ helicase/ nucleic acid
            binding (EMB2733) mRNA, complete cds
          Length = 3583

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1258 tcaaagagctggtcgtgctggaagaac 1284
            |||| ||||||||||||||||||||||
Sbjct: 2318 tcaacgagctggtcgtgctggaagaac 2344



to top

>gb|AE014833.1| Plasmodium falciparum 3D7 chromosome 10 section 5 of 7 of the complete
              sequence
          Length = 252394

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                         
Query: 1139   ttaaccattgatggtatagtgtatgttatagatccagggtttt 1181
              ||||| |||||||||||| | | |||||| |||||||||||||
Sbjct: 218177 ttaacaattgatggtatattttttgttattgatccagggtttt 218135



to top

>gb|AC137922.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0046A04, complete sequence
          Length = 141001

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 1263  gagctggtcgtgctggaagaacgcagcctgggaagtgct 1301
             ||||||| || ||||||||||| | ||||||||||||||
Sbjct: 17636 gagctgggcgagctggaagaactcggcctgggaagtgct 17674



to top

>gb|AC135558.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0007C02, complete sequence
          Length = 148265

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 1263  gagctggtcgtgctggaagaacgcagcctgggaagtgct 1301
             ||||||| || ||||||||||| | ||||||||||||||
Sbjct: 78980 gagctgggcgagctggaagaactcggcctgggaagtgct 78942



to top

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                              
Query: 336     ttgtcggagaaaccggaagtggcaagaccac 366
               ||||||||||| |||| ||||||||||||||
Sbjct: 4584531 ttgtcggagaatccggcagtggcaagaccac 4584561



to top

>ref|XM_873509.1| PREDICTED: Bos taurus similar to Putative pre-mRNA splicing factor
            RNA helicase (DEAH box protein 15), transcript variant 3
            (LOC512327), mRNA
          Length = 1124

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                           
Query: 2311 gggtactttatgcaggttgctcatttggagcgaactgggcattactt 2357
            ||||| ||||||||||| || ||||| || ||||| |||||||||||
Sbjct: 759  gggtattttatgcaggtggcacatttagaacgaacagggcattactt 805



to top

>ref|XM_500940.1| Yarrowia lipolytica CLIB122, YALI0B15642g predicted mRNA
          Length = 2196

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1400 aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
            |||||||| || ||||| ||| | || || ||||||||||||||||| ||||| || |||
Sbjct: 1345 aagaagctgggcattgacgatctcgttcactttgacttcatggatccccctgctcccgaa 1404

               
Query: 1460 act 1462
            |||
Sbjct: 1405 act 1407



to top

>gb|AY133872.1| Arabidopsis thaliana clone U09737 putative RNA helicase (At1g32490)
            mRNA, complete cds
          Length = 3166

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1258 tcaaagagctggtcgtgctggaagaac 1284
            |||| ||||||||||||||||||||||
Sbjct: 2172 tcaacgagctggtcgtgctggaagaac 2198



to top

>gb|AY074318.1| Arabidopsis thaliana putative RNA helicase (At1g32490) mRNA, complete
            cds
          Length = 3599

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1258 tcaaagagctggtcgtgctggaagaac 1284
            |||| ||||||||||||||||||||||
Sbjct: 2318 tcaacgagctggtcgtgctggaagaac 2344



to top

>gb|AC007767.3|F5D14 Sequence of BAC F5D14 from Arabidopsis thaliana chromosome 1, complete
              sequence
          Length = 127462

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 1258   tcaaagagctggtcgtgctggaagaac 1284
              |||| ||||||||||||||||||||||
Sbjct: 105704 tcaacgagctggtcgtgctggaagaac 105678



to top

>dbj|AK101122.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033025J07, full
            insert sequence
          Length = 2451

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 1263 gagctggtcgtgctggaagaacgcagcctgggaagtgct 1301
            ||||||| || ||||||||||| | ||||||||||||||
Sbjct: 1070 gagctgggcgagctggaagaactcggcctgggaagtgct 1108



to top

>dbj|AK067746.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013120G22, full
           insert sequence
          Length = 2690

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 336 ttgtcggagaaaccggaagtggcaagaccactcag 370
           ||||||| || ||||||||||||||||| ||||||
Sbjct: 435 ttgtcggcgagaccggaagtggcaagacaactcag 469



to top

>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome
          Length = 1767403

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 2814    ctgttttagaaggtgtaggttat 2836
               |||||||||||||||||||||||
Sbjct: 1631638 ctgttttagaaggtgtaggttat 1631616



to top

>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 46.1 bits (23), Expect = 0.73
 Identities = 53/63 (84%)
 Strand = Plus / Minus

                                                                           
Query: 1400    aagaagcttggaattgatgatttagtgcattttgacttcatggatcctcctgcacctgaa 1459
               |||||||| || ||||| ||| | || || ||||||||||||||||| ||||| || |||
Sbjct: 2073221 aagaagctgggcattgacgatctcgttcactttgacttcatggatccccctgctcccgaa 2073162

                  
Query: 1460    act 1462
               |||
Sbjct: 2073161 act 2073159



to top

>gb|AC146307.24| Medicago truncatula chromosome 6 clone mth2-9p17, complete sequence
          Length = 120805

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 731   agtgctactcttgaggcagagaagtt 756
             |||||||||||||| |||||||||||
Sbjct: 76421 agtgctactcttgatgcagagaagtt 76446



to top

>ref|XM_001211287.1| Aspergillus terreus NIH2624 pre-mRNA splicing factor ATP-dependent
           RNA helicase PRP43 (ATEG_02109) mRNA, complete cds
          Length = 2298

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 482 atggatgtcacaatcggggaggaagttggttacagtatccgattcgaaga 531
           |||||||||| | | || |||||||| |||||||||||||| || |||||
Sbjct: 496 atggatgtcaaacttggagaggaagtcggttacagtatccgttttgaaga 545



 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1398 tgaagaagcttggaattgatga 1419
            ||||||||||||||||||||||
Sbjct: 1418 tgaagaagcttggaattgatga 1439



to top

>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence
          Length = 21146708

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                 
Query: 2389    catccctcgaattgtatggaccataagccggagtgggtcatctacaatga 2438
               ||||| |||| |||| | ||||| ||||| || |||||||||||||||||
Sbjct: 3278027 catccgtcgacttgtctcgaccacaagcccgattgggtcatctacaatga 3278076



to top

>ref|XM_368721.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
            (MG00523.4) partial mRNA
          Length = 2412

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1116 ccacaaacattgccgagacatc 1137
            ||||||||||||||||||||||
Sbjct: 1331 ccacaaacattgccgagacatc 1352



to top

>ref|XM_633231.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0186395)
            mRNA, complete cds
          Length = 2184

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1257 atcaaagagctggtcgtgctgg 1278
            ||||||||||||||||||||||
Sbjct: 1181 atcaaagagctggtcgtgctgg 1202



to top

>gb|AC102612.14| Mus musculus chromosome 9, clone RP23-417D20, complete sequence
          Length = 202804

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 1797   acattttctcttgtttgtatat 1818
              ||||||||||||||||||||||
Sbjct: 154342 acattttctcttgtttgtatat 154321



to top

>gb|AC147775.5| Medicago truncatula clone mth2-13d20, complete sequence
          Length = 117523

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 347   accggaagtggcaagaccactc 368
             ||||||||||||||||||||||
Sbjct: 32481 accggaagtggcaagaccactc 32460



to top

>gb|AC009739.4| Drosophila melanogaster clone BACR26B18, complete sequence
          Length = 173641

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                
Query: 2389   catccctcgaattgtatggaccataagccggagtgggtcatctacaatga 2438
              ||||| |||| |||| | ||||| ||||| || |||||||||||||||||
Sbjct: 143427 catccgtcgacttgtctcgaccacaagcccgattgggtcatctacaatga 143476



to top

>gb|AC124449.3| Mus musculus BAC clone RP24-212N10 from chromosome 15, complete sequence
          Length = 165858

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 1079   aaagagggaggccctgctggaaggaa 1104
              |||||| |||||||||||||||||||
Sbjct: 151316 aaagagagaggccctgctggaaggaa 151291



to top

>gb|AC124381.4| Mus musculus BAC clone RP24-406E24 from chromosome 15, complete sequence
          Length = 176561

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 1079   aaagagggaggccctgctggaaggaa 1104
              |||||| |||||||||||||||||||
Sbjct: 150660 aaagagagaggccctgctggaaggaa 150685



to top

>ref|NM_136425.2| Drosophila melanogaster CG11107-RA (CG11107), mRNA
          Length = 2721

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 2389 catccctcgaattgtatggaccataagccggagtgggtcatctacaatga 2438
            ||||| |||| |||| | ||||| ||||| || |||||||||||||||||
Sbjct: 2277 catccgtcgacttgtctcgaccacaagcccgattgggtcatctacaatga 2326



to top

>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026
          Length = 2324132

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 1398    tgaagaagcttggaattgatga 1419
               ||||||||||||||||||||||
Sbjct: 1836385 tgaagaagcttggaattgatga 1836364



to top

>ref|XM_390933.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
           (FG10757.1) partial mRNA
          Length = 2307

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 359 aagaccactcagatcccccaat 380
           ||||||||||||||||||||||
Sbjct: 388 aagaccactcagatcccccaat 409



to top

>gb|AF178650.3| Homo sapiens chromosome 8 clone CTB-402H9 map 8cen , complete sequence
          Length = 73382

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 547   aactgttctcaaatatttgaca 568
             ||||||||||||||||||||||
Sbjct: 26625 aactgttctcaaatatttgaca 26646



to top

>ref|NM_062618.4| Caenorhabditis elegans Masculinisation Of Germline family member
            (mog-5) (mog-5) mRNA, complete cds
          Length = 3726

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 564  tgacagatggtatgcttctgagagaa 589
            |||| |||||||||||||||||||||
Sbjct: 1908 tgacggatggtatgcttctgagagaa 1933



to top

>gb|AC084750.3| Homo sapiens BAC clone RP11-215J17 from 4, complete sequence
          Length = 154693

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1103 aaaattgttgtgtccacaaaca 1124
            ||||||||||||||||||||||
Sbjct: 9219 aaaattgttgtgtccacaaaca 9240



to top

>emb|AL355986.7| Human DNA sequence from clone RP11-516G5 on chromosome 13, complete
             sequence
          Length = 87831

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 2185  atgaagtctgctgataatgtta 2206
             ||||||||||||||||||||||
Sbjct: 55546 atgaagtctgctgataatgtta 55567



to top

>emb|AL139240.9| Human DNA sequence from clone RP11-344A5 on chromosome 10q21.2-22.1
            Contains a novel gene, complete sequence
          Length = 28319

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 825  atacccaggaaccagaaaggga 846
            ||||||||||||||||||||||
Sbjct: 4547 atacccaggaaccagaaaggga 4526



to top

>gb|AY058484.1| Drosophila melanogaster GM13272 full length cDNA
          Length = 2523

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 2389 catccctcgaattgtatggaccataagccggagtgggtcatctacaatga 2438
            ||||| |||| |||| | ||||| ||||| || |||||||||||||||||
Sbjct: 2062 catccgtcgacttgtctcgaccacaagcccgattgggtcatctacaatga 2111



to top

>gb|AC151989.4| Mus musculus BAC clone RP23-298C3 from chromosome 7, complete sequence
          Length = 217239

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 1649   tcaactaacaatttctctctct 1670
              ||||||||||||||||||||||
Sbjct: 154213 tcaactaacaatttctctctct 154192



to top

>ref|NM_001021845.1| Schizosaccharomyces pombe 972h- hypothetical protein
           (SPBC16H5.10c), partial mRNA
          Length = 2208

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                         
Query: 557 aaatatttgacagatggtatgcttctgagagaagcaatggcagacc 602
           |||||| ||||||||||||||||| || | ||||| ||| ||||||
Sbjct: 511 aaatatatgacagatggtatgcttttgcgtgaagccatgacagacc 556



to top

>emb|X58681.1|SCPRP22GE S.cerevisiae DNA for PRP22 gene
          Length = 3940

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 1409 ggaattgatgatttagtgcattttgacttcatggatcc 1446
            |||||| |||||||| || | |||||||||||||||||
Sbjct: 2800 ggaattaatgatttattgaaatttgacttcatggatcc 2837



to top

>emb|BX294024.1|NC20H10 Neurospora crassa DNA linkage group V Cosmid contig 20H10
          Length = 96283

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 552   ttctcaaatatttgacagatggtatgcttctgagagaa 589
             ||||||| ||| |||| ||||| |||||||||||||||
Sbjct: 21813 ttctcaagtatatgacggatggcatgcttctgagagaa 21850



to top

>emb|AL022104.2|SPBC16H5 S.pombe chromosome II cosmid c16H5
          Length = 35660

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 40/46 (86%)
 Strand = Plus / Plus

                                                           
Query: 557   aaatatttgacagatggtatgcttctgagagaagcaatggcagacc 602
             |||||| ||||||||||||||||| || | ||||| ||| ||||||
Sbjct: 11159 aaatatatgacagatggtatgcttttgcgtgaagccatgacagacc 11204



to top

>emb|CR925780.8| Zebrafish DNA sequence from clone CH211-112B19 in linkage group 5,
             complete sequence
          Length = 166407

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1038  caatgcagcagaagatttttga 1059
             ||||||||||||||||||||||
Sbjct: 77047 caatgcagcagaagatttttga 77068



to top

>gb|AC150980.20| Medicago truncatula clone mth2-165j9, complete sequence
          Length = 119548

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 347  accggaagtggcaagaccactc 368
            ||||||||||||||||||||||
Sbjct: 5292 accggaagtggcaagaccactc 5313



to top

>gb|U18778.1|SCE9537 Saccharomyces cerevisiae chromosome V cosmids 9537, 9581, 9495, 9867,
             and lambda clone 5898
          Length = 66030

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 1409  ggaattgatgatttagtgcattttgacttcatggatcc 1446
             |||||| |||||||| || | |||||||||||||||||
Sbjct: 29490 ggaattaatgatttattgaaatttgacttcatggatcc 29527



to top

>gb|AF286899.1|AF286899 Caenorhabditis elegans sex determining protein MOG-5 mRNA, complete
            cds
          Length = 3747

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 564  tgacagatggtatgcttctgagagaa 589
            |||| |||||||||||||||||||||
Sbjct: 1915 tgacggatggtatgcttctgagagaa 1940



to top

>ref|XM_955702.1| Neurospora crassa OR74A hypothetical protein (NCU08928.1) partial
            mRNA
          Length = 2754

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 552  ttctcaaatatttgacagatggtatgcttctgagagaa 589
            ||||||| ||| |||| ||||| |||||||||||||||
Sbjct: 1091 ttctcaagtatatgacggatggcatgcttctgagagaa 1128



to top

>gb|AC105969.17| Mus musculus chromosome 15, clone RP23-477B23, complete sequence
          Length = 189238

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 1807   ttgtttgtatattgtgtattgt 1828
              ||||||||||||||||||||||
Sbjct: 141498 ttgtttgtatattgtgtattgt 141477



to top

>gb|AC136365.5| Homo sapiens chromosome 8, clone RP11-97P4, complete sequence
          Length = 143756

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 547   aactgttctcaaatatttgaca 568
             ||||||||||||||||||||||
Sbjct: 70276 aactgttctcaaatatttgaca 70297



to top

>gb|AC171133.2| Helobdella robusta clone CH306-1A4, complete sequence
          Length = 120169

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 503  gaagttggttacagtatccgattcgaagattgca 536
            ||||| ||||||||||| ||||| ||||||||||
Sbjct: 4789 gaagtcggttacagtatacgatttgaagattgca 4822



to top

>emb|AL391397.4|CNS06C87 Human chromosome 14 DNA sequence BAC R-625F13 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 165622

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 543    acaaaactgttctcaaatattt 564
              ||||||||||||||||||||||
Sbjct: 127718 acaaaactgttctcaaatattt 127697



to top

>dbj|AP005902.2| Homo sapiens genomic DNA, chromosome 8p11.21, clone: KB1582A10,
             complete sequence
          Length = 149577

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 547   aactgttctcaaatatttgaca 568
             ||||||||||||||||||||||
Sbjct: 25836 aactgttctcaaatatttgaca 25815



to top

>gb|DQ332137.1| Synthetic construct Saccharomyces cerevisiae clone FLH148160.01X
            PRP22 gene, complete sequence
          Length = 3438

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 1409 ggaattgatgatttagtgcattttgacttcatggatcc 1446
            |||||| |||||||| || | |||||||||||||||||
Sbjct: 2560 ggaattaatgatttattgaaatttgacttcatggatcc 2597



to top

>gb|AC174927.2| Mus musculus BAC clone RP24-325L16 from chromosome 9, complete sequence
          Length = 195951

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 1797   acattttctcttgtttgtatat 1818
              ||||||||||||||||||||||
Sbjct: 131949 acattttctcttgtttgtatat 131970



to top

>gb|AC005452.1|AC005452 Drosophila melanogaster, chromosome 2R, region 43B2-43C2, P1 clone
             DS07185, complete sequence
          Length = 79333

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                               
Query: 2389  catccctcgaattgtatggaccataagccggagtgggtcatctacaatga 2438
             ||||| |||| |||| | ||||| ||||| || |||||||||||||||||
Sbjct: 52086 catccgtcgacttgtctcgaccacaagcccgattgggtcatctacaatga 52037



to top

>emb|AL928904.16| Mouse DNA sequence from clone RP23-463M17 on chromosome 2, complete
             sequence
          Length = 142294

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 2578  aataagagggagagggaaagag 2599
             ||||||||||||||||||||||
Sbjct: 25276 aataagagggagagggaaagag 25255



to top

>gb|AF028244.1|AF028244 Strongylocentrotus purpuratus putative RNA helicase PRP1 mRNA,
            partial cds
          Length = 1365

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 1019 tactctactctcccccctgcaatgcagcagaagatttttgaccctgcccc 1068
            ||||| || ||||||||||| |||||||||| ||| ||||| | ||||||
Sbjct: 469  tactccaccctcccccctgccatgcagcagaggatctttgagcatgcccc 518



to top

>gb|U23484.1| Caenorhabditis elegans cosmid EEED8, complete sequence
          Length = 39496

 Score = 44.1 bits (22), Expect = 2.9
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 564   tgacagatggtatgcttctgagagaa 589
             |||| |||||||||||||||||||||
Sbjct: 19559 tgacggatggtatgcttctgagagaa 19584


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 540,425,380
Number of extensions: 28850828
Number of successful extensions: 174869
Number of sequences better than 10.0: 197
Number of HSP's gapped: 174833
Number of HSP's successfully gapped: 434
Length of query: 2969
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 2946
Effective length of database: 18,503,978,556
Effective search space: 54512720825976
Effective search space used: 54512720825976
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)
to top