>gb|AC121589.3| Mus musculus BAC clone RP23-281G14 from chromosome 3, complete sequence
          Length = 215395
 Score = 46.1 bits (23), Expect = 0.36
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 278    ggtgtaagggaaagggcaagggg 300
              |||||||||||||||||||||||
Sbjct: 190108 ggtgtaagggaaagggcaagggg 190130

>gb|AC120559.10| Mus musculus chromosome 9, clone RP24-566A4, complete sequence
          Length = 141300

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 283   aagggaaagggcaaggggaacgggaa 308
             ||||||||||| ||||||||||||||
Sbjct: 62286 aagggaaagggaaaggggaacgggaa 62311

>gb|AC140465.2| Mus musculus BAC clone RP24-389J3 from chromosome 16, complete
            sequence
          Length = 189550

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 295  aaggggaacgggaatgagagaagaaa 320
            |||||||| |||||||||||||||||
Sbjct: 1434 aaggggaaagggaatgagagaagaaa 1459

>gb|AC117197.3| Mus musculus BAC clone RP23-127A21 from 16, complete sequence
          Length = 211410

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 295   aaggggaacgggaatgagagaagaaa 320
             |||||||| |||||||||||||||||
Sbjct: 15917 aaggggaaagggaatgagagaagaaa 15892

>gb|AC165156.3| Mus musculus BAC clone RP23-298I7 from chromosome 9, complete
            sequence
          Length = 198962

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 283  aagggaaagggcaaggggaacgggaa 308
            ||||||||||| ||||||||||||||
Sbjct: 8594 aagggaaagggaaaggggaacgggaa 8569

>dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111
          Length = 2356219

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 788     atcccagaggatgataaccgga 809
               ||||||||||||||||||||||
Sbjct: 1049683 atcccagaggatgataaccgga 1049704

>emb|AL157884.9| Human DNA sequence from clone RP11-462B18 on chromosome 9p13.1-21.1
              Contains a pseudogene similar to part of membrane guanylyl
              cyclase, a ribosomal protein S11 (RPS11) pseudogene, a
              novel gene and a CpG island, complete sequence
          Length = 176932

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 1181   tgtgtttttactaattctggccatgt 1206
              |||||||||||| |||||||||||||
Sbjct: 110481 tgtgtttttactcattctggccatgt 110456

>gb|AC158626.6| Mus musculus 6 BAC RP23-4F16 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 240079

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 179   agtgccatcttctgctctctgcaggc 204
             |||||| |||||||||||||||||||
Sbjct: 48903 agtgccctcttctgctctctgcaggc 48928

>gb|AC015553.21|AC015553 Homo sapiens 9 BAC RP11-100N10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 162063

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 1181  tgtgtttttactaattctggccatgt 1206
             |||||||||||| |||||||||||||
Sbjct: 49916 tgtgtttttactcattctggccatgt 49891

>dbj|AK173116.1| Mus musculus mRNA for mKIAA1160 protein
          Length = 5755

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 179  agtgccatcttctgctctctgcaggc 204
            |||||| |||||||||||||||||||
Sbjct: 5488 agtgccctcttctgctctctgcaggc 5513

>emb|CT009720.16| Mouse DNA sequence from clone RP23-21J17 on chromosome 9, complete
              sequence
          Length = 216098

 Score = 44.1 bits (22), Expect = 1.4
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 283    aagggaaagggcaaggggaacgggaa 308
              ||||||||||| ||||||||||||||
Sbjct: 149969 aagggaaagggaaaggggaacgggaa 149944

>gb|BC123997.1| Xenopus tropicalis cDNA clone IMAGE:7863132
          Length = 2001

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 286 ggaaagggcaaggggaacggg 306
           |||||||||||||||||||||
Sbjct: 912 ggaaagggcaaggggaacggg 892

>gb|AC189034.2| Gallus gallus BAC clone CH261-83E11 from chromosome z, complete sequence
          Length = 184964

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 204    cctgcatctctgagcccatta 224
              |||||||||||||||||||||
Sbjct: 179599 cctgcatctctgagcccatta 179579

>gb|AC187592.3| Gallus gallus BAC clone CH261-124L19 from chromosome z, complete
            sequence
          Length = 197526

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 204  cctgcatctctgagcccatta 224
            |||||||||||||||||||||
Sbjct: 9967 cctgcatctctgagcccatta 9947

>emb|CU075400.1| Xenopus tropicalis finished cDNA, clone TTbA017m12
          Length = 1959

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 286 ggaaagggcaaggggaacggg 306
           |||||||||||||||||||||
Sbjct: 943 ggaaagggcaaggggaacggg 923

>gb|BC088763.1| Xenopus tropicalis cDNA clone IMAGE:7000373
          Length = 1487

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 286 ggaaagggcaaggggaacggg 306
           |||||||||||||||||||||
Sbjct: 469 ggaaagggcaaggggaacggg 449

>gb|AC093473.6| Mus musculus chromosome 5, clone RP23-54H12, complete sequence
          Length = 208876

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 184   catcttctgctctctgcaggc 204
             |||||||||||||||||||||
Sbjct: 46219 catcttctgctctctgcaggc 46199

>gb|AE007224.1| Sinorhizobium meliloti 1021 plasmid pSymA section 30 of 121 of the
            complete plasmid sequence
          Length = 12146

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 147  gcgttgccgccgaacccgaaa 167
            |||||||||||||||||||||
Sbjct: 5269 gcgttgccgccgaacccgaaa 5249

>gb|AC113285.9| Mus musculus chromosome 5, clone RP23-407I6, complete sequence
          Length = 283052

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 184    catcttctgctctctgcaggc 204
              |||||||||||||||||||||
Sbjct: 267070 catcttctgctctctgcaggc 267050

>gb|AC159892.2| Mus musculus BAC clone RP23-313P23 from chromosome 9, complete sequence
          Length = 199351

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 181    tgccatcttctgctctctgcaggcc 205
              ||||||||||||| |||||||||||
Sbjct: 141875 tgccatcttctgccctctgcaggcc 141851

>gb|AC104641.11| Homo sapiens 3 BAC RP11-786O7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 182114

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1171  gctgaacctttgtgtttttac 1191
             |||||||||||||||||||||
Sbjct: 61223 gctgaacctttgtgtttttac 61203

>gb|AC119041.6| Homo sapiens X BAC RP11-585K14 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 100000

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 278   ggtgtaagggaaagggcaaggggaa 302
             |||||||||||||||| ||||||||
Sbjct: 78228 ggtgtaagggaaaggggaaggggaa 78252

>gb|AC090857.8| Homo sapiens chromosome 11, clone RP11-670N15, complete sequence
          Length = 180120

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 354    aaaactctcctgctgcagatgatga 378
              |||| ||||||||||||||||||||
Sbjct: 154527 aaaaatctcctgctgcagatgatga 154551

>emb|AL592504.6| Human DNA sequence from clone RP11-320J16 on chromosome X Contains part
              of a novel gene, complete sequence
          Length = 173828

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 275    agaggtgtaagggaaagggca 295
              |||||||||||||||||||||
Sbjct: 130646 agaggtgtaagggaaagggca 130626

>gb|AC067794.5| Homo sapiens chromosome 11, clone RP11-558L11, complete sequence
          Length = 190489

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 354    aaaactctcctgctgcagatgatga 378
              |||| ||||||||||||||||||||
Sbjct: 178778 aaaaatctcctgctgcagatgatga 178754

>emb|AL132967.1|ATT2J13 Arabidopsis thaliana DNA chromosome 3, BAC clone T2J13
          Length = 85109

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 798   atgataaccggattgacatag 818
             |||||||||||||||||||||
Sbjct: 28627 atgataaccggattgacatag 28647

>gb|AF217235.1|AF217235 Staphylococcus aureus pathogenicity island SaPIbov, complete sequence
          Length = 15891

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1072 tggacaagatgataaggcaga 1092
            |||||||||||||||||||||
Sbjct: 7260 tggacaagatgataaggcaga 7240

>emb|CT476806.2| Pan troglodytes chromosome X BAC RP43-032D14, complete sequence
          Length = 145919

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 275   agaggtgtaagggaaagggca 295
             |||||||||||||||||||||
Sbjct: 53164 agaggtgtaagggaaagggca 53184

>emb|AJ938182.1| Staphylococcus aureus RF122 complete genome
          Length = 2742531

 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1072   tggacaagatgataaggcaga 1092
              |||||||||||||||||||||
Sbjct: 397436 tggacaagatgataaggcaga 397456



 Score = 42.1 bits (21), Expect = 5.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 1072    tggacaagatgataaggcaga 1092
               |||||||||||||||||||||
Sbjct: 2029739 tggacaagatgataaggcaga 2029719


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 251,706,203
Number of extensions: 12705425
Number of successful extensions: 230097
Number of sequences better than 10.0: 29
Number of HSP's gapped: 230097
Number of HSP's successfully gapped: 30
Length of query: 1470
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1447
Effective length of database: 18,503,978,556
Effective search space: 26775256970532
Effective search space used: 26775256970532
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)