ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf30o15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001070200.1| Oryza sativa (japonica cultivar-group) Os09g... 704 0.0
2dbj|AK104212.1| Oryza sativa (japonica cultivar-group) cDNA clon... 704 0.0
3dbj|AK103975.1| Oryza sativa (japonica cultivar-group) cDNA clon... 704 0.0
4dbj|AK071380.1| Oryza sativa (japonica cultivar-group) cDNA clon... 704 0.0
5dbj|AB026568.1| Oryza sativa (japonica cultivar-group) OsPBG1 mR... 696 0.0
6gb|AY736120.1| Triticum aestivum 20S proteasome beta 7 subunit m... 664 0.0
7gb|BT018203.1| Zea mays clone EL01N0560A08.c mRNA sequence 569 e-159
8gb|AY104193.1| Zea mays PCO143176 mRNA sequence 531 e-147
9gb|AC108755.2| Oryza sativa (japonica cultivar-group) chromosome... 260 9e-66
10dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 260 9e-66
11dbj|AP006756.2| Oryza sativa (japonica cultivar-group) genomic D... 260 9e-66
12gb|AC189496.1| Brassica rapa subsp. pekinensis clone KBrB086C10,... 62 4e-06
13gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome... 50 0.016
14ref|XM_854103.1| PREDICTED: Canis familiaris similar to nischari... 50 0.016
15ref|XM_533798.2| PREDICTED: Canis familiaris similar to nischari... 50 0.016
16gb|AC134862.4| Mus musculus BAC clone RP24-91P2 from 5, complete... 50 0.016
17ref|XM_520802.2| PREDICTED: Pan troglodytes cancer susceptibilit... 48 0.064
18gb|BC117283.1| Homo sapiens cancer susceptibility candidate 1, m... 48 0.064
19gb|BC117281.1| Homo sapiens cancer susceptibility candidate 1, m... 48 0.064
20ref|XR_012635.1| PREDICTED: Macaca mulatta similar to cancer sus... 48 0.064
21gb|BC047415.1| Homo sapiens cancer susceptibility candidate 1, m... 48 0.064
22gb|AC157610.2| Mus musculus chromosome 15, clone RP23-77H12, com... 48 0.064
23gb|AC121365.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.064
24ref|NM_018272.2| Homo sapiens cancer susceptibility candidate 1 ... 48 0.064
25gb|AC131781.3| Mus musculus BAC clone RP24-344J9 from chromosome... 48 0.064
26gb|AY423543.1| Homo sapiens lung adenoma susceptibility 1-like p... 48 0.064
27gb|AC163027.5| Mus musculus chromosome 5, clone RP23-396H22, com... 48 0.064
28gb|BC057795.1| Homo sapiens cancer susceptibility candidate 1, m... 48 0.064
29dbj|AK093358.1| Homo sapiens cDNA FLJ36039 fis, clone TESTI2017311 48 0.064
30dbj|AK093102.1| Homo sapiens cDNA FLJ35783 fis, clone TESTI20055... 48 0.064
31dbj|AK001783.1| Homo sapiens cDNA FLJ10921 fis, clone OVARC1000411 48 0.064
32gb|BC028415.1| Homo sapiens cancer susceptibility candidate 1, m... 48 0.064
33gb|BC031047.1| Homo sapiens cancer susceptibility candidate 1, m... 48 0.064
34dbj|AB168925.1| Macaca fascicularis testis cDNA, clone: QtsA-158... 48 0.064
35emb|AJ291743.1|NTA291743 Nicotiana tabacum partial mRNA for puta... 48 0.064
36ref|XM_813279.1| Trypanosoma cruzi strain CL Brener hypothetical... 48 0.064
37dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.064
38gb|AC002091.2| Homo sapiens chromosome 17, clone CTB-41I6, compl... 48 0.064
39emb|AL953889.9| Human DNA sequence from clone RP11-7G23 on chrom... 48 0.064
40emb|AL645608.30| Human DNA sequence from clone RP11-54O7 on chro... 48 0.064
41emb|AL627230.15| Human DNA sequence from clone RP11-12A20 on chr... 48 0.064
42emb|AL391987.15| Human DNA sequence from clone RP11-374M1 on chr... 48 0.064
43emb|AL596182.28| Mouse DNA sequence from clone RP23-303F24 on ch... 48 0.064
44gb|AC118598.8| Mus musculus chromosome 5, clone RP23-446M13, com... 48 0.064
45gb|AC161198.5| Mus musculus chromosome 15, clone RP23-34E23, com... 48 0.064
46gb|AC137764.6| Mus musculus chromosome 3, clone RP24-512E12, com... 48 0.064
47gb|AC003695.1|AC003695 Homo sapiens chromosome 17, clone hRPC.85... 48 0.064
48emb|AL118524.25|HSJ1059A9 Human DNA sequence from clone RP5-1059... 48 0.064
49gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 46 0.25
50gb|AC112706.2| Homo sapiens chromosome 19 clone CTD-3195E18, com... 46 0.25
51gb|AC010768.10| Homo sapiens chromosome 11, clone RP11-58K22, co... 46 0.25
52gb|AC011199.22| Homo sapiens chromosome 3 clone RP11-61K12, comp... 46 0.25
53gb|AC130566.7| Homo sapiens 3 BAC RP11-61K12 (Roswell Park Cance... 46 0.25
54emb|AL355836.3|CNS05TCQ Human chromosome 14 DNA sequence BAC R-8... 46 0.25
55emb|AL805960.10| Mouse DNA sequence from clone RP23-20P17 on chr... 46 0.25
56ref|XM_001219879.1| Chaetomium globosum CBS 148.51 hypothetical ... 44 1.0
57gb|AC162448.10| Mus musculus chromosome 1, clone RP24-405F23, co... 44 1.0
58ref|XM_875888.1| PREDICTED: Bos taurus similar to vesicle amine ... 44 1.0
59ref|XM_587873.2| PREDICTED: Bos taurus similar to vesicle amine ... 44 1.0
60gb|AC139039.9| Mus musculus chromosome 16, clone RP23-300H4, com... 44 1.0
61ref|XM_855468.1| PREDICTED: Canis familiaris similar to archain,... 44 1.0
62ref|XM_536552.2| PREDICTED: Canis familiaris similar to archain,... 44 1.0
63gb|AC131961.1| Drosophila pseudoobscura FOSMID DPSF1-548A3 (Chi... 44 1.0
64gb|AC114930.2| Homo sapiens chromosome 5 clone CTD-2017A19, comp... 44 1.0
65gb|AC118456.2| Homo sapiens chromosome 5 clone CTD-2288B6, compl... 44 1.0
66dbj|AK083019.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 44 1.0
67dbj|AK078512.1| Mus musculus 12 days embryo female mullerian duc... 44 1.0
68gb|AF092915.1|AF092915 Nicotiana tabacum cytochrome P450-depende... 44 1.0
69emb|AL390198.17| Human DNA sequence from clone RP13-401N8 on chr... 44 1.0
70emb|AL359873.11| Human DNA sequence from clone RP4-704D23 on chr... 44 1.0
71emb|AL356215.11| Human DNA sequence from clone RP4-607I7 on chro... 44 1.0
72gb|AC127285.4| Mus musculus BAC clone RP23-336P20 from chromosom... 44 1.0
73gb|AF250504.1|AF250504 Treponema pallidum clone N(UNC)#5 TprK (t... 44 1.0
74gb|AC092275.3| Homo sapiens chromosome 16 clone CTC-786C10, comp... 44 1.0
75emb|AL805980.28| Mouse DNA sequence from clone RP23-49C8 on chro... 44 1.0
76gb|AC007993.15|AC007993 Homo sapiens chromosome 17, clone RP11-5... 44 1.0
77emb|AM157181.1| Sus scrofa RETN gene for resistin, exons 1-4 44 1.0
78emb|AM157180.1| Sus scrofa RETN gene for resistin 44 1.0
79emb|AL845521.9| Mouse DNA sequence from clone RP23-359C5 on chro... 44 1.0
80gb|AC004490.1|AC004490 Homo sapiens chromosome 19, cosmid R29381... 44 1.0
81emb|AL663028.12| Mouse DNA sequence from clone RP23-23J11 on chr... 44 1.0
82ref|NM_013370.3| Homo sapiens oxidative stress induced growth in... 42 4.0
83gb|CP000481.1| Acidothermus cellulolyticus 11B, complete genome 42 4.0
84ref|XM_001223183.1| Chaetomium globosum CBS 148.51 hypothetical ... 42 4.0
85ref|XM_001219966.1| Chaetomium globosum CBS 148.51 hypothetical ... 42 4.0
86ref|XM_778933.2| PREDICTED: Strongylocentrotus purpuratus simila... 42 4.0
87ref|XM_001203148.1| PREDICTED: Strongylocentrotus purpuratus sim... 42 4.0
88dbj|AK235184.1| Sus scrofa mRNA, clone:OVRM10056C05, expressed i... 42 4.0
89gb|CP000441.1| Burkholderia cepacia AMMD chromosome 2, complete ... 42 4.0
90ref|XM_001149613.1| PREDICTED: Pan troglodytes hypothetical prot... 42 4.0
91ref|XM_001165487.1| PREDICTED: Pan troglodytes hypothetical LOC4... 42 4.0
92ref|XM_516684.2| PREDICTED: Pan troglodytes hypothetical LOC4606... 42 4.0
93ref|XM_001165524.1| PREDICTED: Pan troglodytes hypothetical LOC4... 42 4.0
94gb|DQ893844.1| Homo sapiens clone FLH164895.01L; RZPDo839D05157D... 42 4.0
95gb|DQ890664.1| Synthetic construct Homo sapiens clone FLH164899.... 42 4.0
96gb|AC187575.2| Pongo pygmaeus abelii BAC clone CH276-12H12 from ... 42 4.0
97gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete s... 42 4.0
98gb|BC113623.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA ... 42 4.0
99gb|BC113625.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA ... 42 4.0
100ref|XM_001077332.1| PREDICTED: Rattus norvegicus adenylate cycla... 42 4.0
101ref|XM_220178.4| PREDICTED: Rattus norvegicus adenylate cyclase ... 42 4.0
102ref|XM_001102247.1| PREDICTED: Macaca mulatta similar to Atonal ... 42 4.0
103gb|CP000386.1| Rubrobacter xylanophilus DSM 9941, complete genome 42 4.0
104emb|CR376840.30| Zebrafish DNA sequence from clone CH211-185M11 ... 42 4.0
105ref|NM_148507.1| Arabidopsis thaliana unknown protein (AT1G34315... 42 4.0
106ref|NM_001012432.1| Pan troglodytes atonal homolog 1 (Drosophila... 42 4.0
107gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, comp... 42 4.0
108ref|NM_005172.1| Homo sapiens atonal homolog 1 (Drosophila) (ATO... 42 4.0
109gb|AY360386.1| Oryza sativa (japonica cultivar-group) chromosome... 42 4.0
110ref|NM_028227.2| Mus musculus BRCA1 associated protein (Brap), mRNA 42 4.0
111ref|XM_881285.1| PREDICTED: Bos taurus hypothetical protein LOC6... 42 4.0
112gb|BC069578.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA ... 42 4.0
113gb|AC092222.2| Drosophila melanogaster clone BACR16I01, complete... 42 4.0
114gb|AC102745.10| Mus musculus chromosome 17, clone RP24-371L2, co... 42 4.0
115gb|AC091454.2| Mus musculus chromosome X, clones RP21-438P10, RP... 42 4.0
116gb|BC069145.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA ... 42 4.0
117ref|NM_010729.2| Mus musculus lysyl oxidase-like 1 (Loxl1), mRNA... 42 4.0
118ref|NM_005335.3| Homo sapiens hematopoietic cell-specific Lyn su... 42 4.0
119gb|AC091395.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 42 4.0
120gb|AC112143.5| Mus musculus BAC clone RP23-29E2 from chromosome ... 42 4.0
121gb|AC102312.11| Mus musculus chromosome 10, clone RP24-428L4, co... 42 4.0
122gb|AC120411.9| Mus musculus chromosome 6, clone RP24-447O2, comp... 42 4.0
123gb|AY190956.1| Drosophila virilis clone DVIF01_06_H02 (D1438) ge... 42 4.0
124ref|XM_846038.1| PREDICTED: Canis familiaris hypothetical protei... 42 4.0
125ref|XM_534562.2| PREDICTED: Canis familiaris similar to kinesin ... 42 4.0
126ref|XM_851754.1| PREDICTED: Canis familiaris similar to kinesin ... 42 4.0
127gb|BC003973.1| Mus musculus lysyl oxidase-like 1, mRNA (cDNA clo... 42 4.0
128gb|AC099341.4| Homo sapiens BAC clone RP11-317C13 from 7, comple... 42 4.0
129ref|XM_848807.1| PREDICTED: Canis familiaris similar to Dedicato... 42 4.0
130gb|AY504961.1| Homo sapiens tumor necrosis factor receptor super... 42 4.0
131ref|XM_538612.2| PREDICTED: Canis familiaris similar to fibrilli... 42 4.0
132gb|AC133207.3| Mus musculus BAC clone RP23-116L23 from chromosom... 42 4.0
133gb|AC009119.10| Homo sapiens chromosome 16 clone RP11-483P21, co... 42 4.0
134gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosom... 42 4.0
135gb|AC133750.2| Homo sapiens 3 BAC RP11-619K22 (Roswell Park Canc... 42 4.0
136gb|AC023141.6| Homo sapiens BAC clone RP11-548K12 from 7, comple... 42 4.0
137gb|BC038490.1| Mus musculus BRCA1 associated protein, mRNA (cDNA... 42 4.0
138gb|BC017145.1| Mus musculus arrestin 3, retinal, mRNA (cDNA clon... 42 4.0
139gb|AC160976.2| Mus musculus BAC clone RP24-67M24 from chromosome... 42 4.0
140gb|AC103627.6| Mus musculus chromosome 1, clone RP24-241N3, comp... 42 4.0
141gb|AC091624.3| Canis familiaris clone RP81-117B1, complete sequence 42 4.0
142dbj|AK124015.1| Homo sapiens cDNA FLJ42021 fis, clone SPLEN20344... 42 4.0
143gb|AC093572.18| Pan troglodytes clone rp43-25g23, complete sequence 42 4.0
144gb|BT008130.1| Synthetic construct Homo sapiens hematopoietic ce... 42 4.0
145gb|BT006824.1| Homo sapiens hematopoietic cell-specific Lyn subs... 42 4.0
146gb|AY573556.1| Sus scrofa delta-5 fatty acid desaturase gene, pa... 42 4.0
147gb|AC136191.5| Rattus norvegicus BAC CH230-52I17 (Children's Ho... 42 4.0
148ref|NR_001464.1| Bos taurus X (inactive)-specific transcript (XI... 42 4.0
149dbj|AK143718.1| Mus musculus 6 days neonate spleen cDNA, RIKEN f... 42 4.0
150dbj|AK138861.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 42 4.0
151gb|AC129805.7| Homo sapiens 12 BAC RP11-125N22 (Roswell Park Can... 42 4.0
152gb|AC091495.4| Homo sapiens chromosome 18, clone RP11-894D23, co... 42 4.0
153gb|AC009899.12| Homo sapiens chromosome 18, clone RP11-19F9, com... 42 4.0
154gb|AC034259.7| Homo sapiens chromosome 11, clone RP11-138N3, com... 42 4.0
155gb|AC009879.8| Homo sapiens, clone RP11-346I3, complete sequence 42 4.0
156gb|AC087889.15| Mus Musculus Strain C57BL6/J Chromosome 10 BAC, ... 42 4.0
157emb|CT010480.10| Mouse DNA sequence from clone RP23-313E11 on ch... 42 4.0
158gb|AC108487.2| Homo sapiens chromosome 3 clone RP11-733E24, comp... 42 4.0
159dbj|AK034212.1| Mus musculus adult male diencephalon cDNA, RIKEN... 42 4.0
160gb|AC091784.8| Genomic sequence for Mus musculus, clone RP23-213... 42 4.0
161dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 4.0
162gb|AC087413.5| Homo sapiens BAC clone RP11-680J17 from 4, comple... 42 4.0
163gb|AC011711.8| Homo sapiens chromosome 11, clone RP11-309J20, co... 42 4.0
164emb|AL935212.11| Human DNA sequence from clone RP11-160N1 on chr... 42 4.0
165gb|AF357006.1|AF357006 Mus musculus lysyl oxidase-like 1 (Loxl1)... 42 4.0
166emb|AL590989.15| Human DNA sequence from clone RP11-149P14 on ch... 42 4.0
167emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on ch... 42 4.0
168emb|AL365274.17| Human DNA sequence from clone RP11-298A17 on ch... 42 4.0
169gb|AF424820.1|AF424820 Macaca mulatta neurexophilin 4 mRNA, part... 42 4.0
170gb|AC018375.8| Homo sapiens, clone RP11-3P24, complete sequence 42 4.0
171emb|AL121895.26|HSA234K24 Human DNA sequence from clone RP11-234... 42 4.0
172emb|AL132655.13|HSJ806M20 Human DNA sequence from clone RP4-806M... 42 4.0
173gb|AC157950.2| Mus musculus BAC clone RP23-128A23 from chromosom... 42 4.0
174gb|AC157996.2| Mus musculus BAC clone RP24-194J17 from chromosom... 42 4.0
175emb|Z92546.2|HS65A6 Human DNA sequence from clone CTA-65A6 on ch... 42 4.0
176emb|X16663.1|HSHEAM Human HS1 gene for heamatopoietic lineage ce... 42 4.0
177emb|CR456794.1| Homo sapiens full open reading frame cDNA clone ... 42 4.0
178emb|AL513025.13| Mouse DNA sequence from clone RP23-235O1 on chr... 42 4.0
179gb|BC030384.1| Mus musculus BRCA1 associated protein, mRNA (cDNA... 42 4.0
180emb|BX000359.7| Mouse DNA sequence from clone RP23-343C18 on chr... 42 4.0
181emb|AL773510.5| Mouse DNA sequence from clone RP24-200F10 on chr... 42 4.0
182gb|AC116104.7| Mus musculus chromosome 5, clone RP23-18K20, comp... 42 4.0
183gb|AC004923.2| Homo sapiens PAC clone RP5-901A4 from 11, complet... 42 4.0
184gb|AF321921.1|AF321921 Mus musculus BRAP2 variant 2 mRNA, comple... 42 4.0
185gb|AC154576.2| Mus musculus BAC clone RP23-372B6 from chromosome... 42 4.0
186gb|AC093798.3| Homo sapiens BAC clone RP11-306N14 from 2, comple... 42 4.0
187gb|AC079776.5| Homo sapiens BAC clone RP11-315H12 from 2, comple... 42 4.0
188gb|AC093802.3| Homo sapiens BAC clone RP11-315F22 from 2, comple... 42 4.0
189gb|AC005840.2|AC005840 Homo sapiens complete sequence of a PAC c... 42 4.0
190gb|AC025812.11|AC025812 Homo sapiens chromosome 3 clone RP11-182... 42 4.0
191gb|AC006064.10| Homo sapiens 12 PAC RP5-940J5 (Roswell Park Canc... 42 4.0
192dbj|AP005832.2| Oryza sativa (japonica cultivar-group) genomic D... 42 4.0
193dbj|AP004228.2| Oryza sativa (japonica cultivar-group) genomic D... 42 4.0
194dbj|AP006623.1| Homo sapiens genomic DNA, chromosome 11, clone:R... 42 4.0
195dbj|AP006621.1| Homo sapiens genomic DNA, chromosome 11, clone:C... 42 4.0
196gb|AC040169.7| Homo sapiens chromosome 16 clone RP11-505K9, comp... 42 4.0
197gb|AC132936.9| Homo sapiens chromosome 11, clone RP13-569C6, com... 42 4.0
198gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, co... 42 4.0
199gb|AC004148.1|AC004148 Homo sapiens chromosome 17, clone HCIT524... 42 4.0
200gb|AY892681.1| Synthetic construct Homo sapiens clone FLH026836.... 42 4.0
201gb|AY892680.1| Synthetic construct Homo sapiens clone FLH026835.... 42 4.0
202gb|AY890192.1| Synthetic construct Homo sapiens clone FLH026840.... 42 4.0
203gb|AY890191.1| Synthetic construct Homo sapiens clone FLH026839.... 42 4.0
204gb|AC118614.12| Mus musculus chromosome 18, clone RP23-477B20, c... 42 4.0
205gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, co... 42 4.0
206emb|AL928537.12| Mouse DNA sequence from clone RP23-236E7 on chr... 42 4.0
207gb|AC155931.2| Mus musculus BAC clone RP23-289D4 from 9, complet... 42 4.0
208gb|BC069604.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA ... 42 4.0
209gb|BC069594.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA ... 42 4.0
210gb|AY107914.1| Zea mays PCO063920 mRNA sequence 42 4.0
211ref|NM_001012066.1| Rattus norvegicus sphingosine kinase 2 (Sphk... 42 4.0
212gb|AF152365.1|AF152365 Homo sapiens constitutive fragile region ... 42 4.0
213emb|CT033785.8| Mouse DNA sequence from clone RP23-445G17 on chr... 42 4.0
214gb|BC062932.1| Mus musculus cDNA clone IMAGE:30355188, containin... 42 4.0
215emb|BX276129.7| Mouse DNA sequence from clone RP23-213F21 on chr... 42 4.0
216gb|AC139320.4| Mus musculus BAC clone RP24-410G8 from 9, complet... 42 4.0
217emb|CT030730.7| Mouse DNA sequence from clone RP24-252L17 on chr... 42 4.0
218gb|AC004546.1|AC004546 Drosophila melanogaster DNA sequence (P1s... 42 4.0
219gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, comple... 42 4.0
220gb|AC140324.3| Mus musculus BAC clone RP23-402K14 from 6, comple... 42 4.0
221emb|CT030196.9| Mouse DNA sequence from clone RP23-282B14 on chr... 42 4.0
222gb|U61148.1|HSU61148 Human atonal homolog 1 (Hath1) gene, comple... 42 4.0
223emb|AL833776.9| Mouse DNA sequence from clone RP23-478M17 on chr... 42 4.0
224emb|AL731682.20| Mouse DNA sequence from clone RP23-123F7 on chr... 42 4.0
225emb|AL671492.12| Mouse DNA sequence from clone RP23-286H11 on ch... 42 4.0
226emb|AL627093.17| Mouse DNA sequence from clone RP23-450P8 on chr... 42 4.0
227emb|AL596258.15| Mouse DNA sequence from clone RP23-226P4 on chr... 42 4.0
228emb|AL772213.7| Mouse DNA sequence from clone RP23-104G16 on chr... 42 4.0
229emb|AL589652.13| Mouse DNA sequence from clone RP23-369L6 on chr... 42 4.0
230emb|AJ421481.1| Bos taurus X-inactivation center region, Jpx and... 42 4.0
231emb|AL359087.17| Human DNA sequence from clone RP5-900A3, comple... 42 4.0
232gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Ca... 42 4.0
233gb|AC117665.6| Mus musculus chromosome 8, clone RP23-360I9, comp... 42 4.0
234dbj|AP000353.2| Homo sapiens genomic DNA, chromosome 22q11.2, IG... 42 4.0
235gb|AF489555.1| Mus musculus chromosome 11 genomic sequence 42 4.0
236emb|AL645484.14| Mouse DNA sequence from clone RP23-38A10 on chr... 42 4.0

>ref|NM_001070200.1| Oryza sativa (japonica cultivar-group) Os09g0515200 (Os09g0515200)
           mRNA, complete cds
          Length = 1091
 Score =  704 bits (355), Expect = 0.0
 Identities = 577/651 (88%)
 Strand = Plus / Plus

                                                                       
Query: 236 attgcaatgaaatacaaggatggtgtgatcatggcatgtgatactggagcctcttatggg 295
           |||||| ||||||||||||||||||| ||||||||||  || ||||||||||| ||||| 
Sbjct: 225 attgcactgaaatacaaggatggtgtcatcatggcatccgacactggagcctcatatggc 284

                                                                       
Query: 296 tcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaagcatagccttatt 355
           ||||| |||||||||||||| |||||||| || ||||  ||||| |||||||||||||||
Sbjct: 285 tcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaagcatagccttatt 344

                                                                       
Query: 356 ggagggagtggggagttcagtgatttccaggagattttgcgctatctggatgaattaact 415
           ||||  ||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 345 ggagcaagtggggagttcagtgatttccaggagattttgcgctatttggatgaattaacc 404

                                                                       
Query: 416 ttgaacgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctac 475
            ||  ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  ||||
Sbjct: 405 ctgtccgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctac 464

                                                                       
Query: 476 ctgacaagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtg 535
           ||||| ||||| ||||||||||||||||| |||||||| || || ||||||||||| || 
Sbjct: 465 ctgacgagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgta 524

                                                                       
Query: 536 cttggtggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggttaacatg 595
            ||||||| ||||||||||| |||||||| || ||||| |||||||||||||||||||||
Sbjct: 525 attggtggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggttaacatg 584

                                                                       
Query: 596 attggtacacactttgaggagaatcacattgccactggatttgggaaccatatggcaatc 655
           |||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 585 attggtacacactttgaggaaaaccacattgccactgggtttgggaaccatatggcaatc 644

                                                                       
Query: 656 ccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgttaagctcatt 715
           ||||| ||||||  ||||||||| ||||||||||| ||||| |||||||| |||||  ||
Sbjct: 645 ccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgtcaagcttgtt 704

                                                                       
Query: 716 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaaattccagatt 775
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 705 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaagttccagatt 764

                                                                       
Query: 776 gccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagaccaactgg 835
           ||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  |||||
Sbjct: 765 gccaagatcacaactgagggagcgaccatctacccgccatactcattgaagacttactgg 824

                                                              
Query: 836 gggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
           || || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 825 ggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 875



to top

>dbj|AK104212.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-305-D09, full
           insert sequence
          Length = 1005

 Score =  704 bits (355), Expect = 0.0
 Identities = 577/651 (88%)
 Strand = Plus / Plus

                                                                       
Query: 236 attgcaatgaaatacaaggatggtgtgatcatggcatgtgatactggagcctcttatggg 295
           |||||| ||||||||||||||||||| ||||||||||  || ||||||||||| ||||| 
Sbjct: 139 attgcactgaaatacaaggatggtgtcatcatggcatccgacactggagcctcatatggc 198

                                                                       
Query: 296 tcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaagcatagccttatt 355
           ||||| |||||||||||||| |||||||| || ||||  ||||| |||||||||||||||
Sbjct: 199 tcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaagcatagccttatt 258

                                                                       
Query: 356 ggagggagtggggagttcagtgatttccaggagattttgcgctatctggatgaattaact 415
           ||||  ||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 259 ggagcaagtggggagttcagtgatttccaggagattttgcgctatttggatgaattaacc 318

                                                                       
Query: 416 ttgaacgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctac 475
            ||  ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  ||||
Sbjct: 319 ctgtccgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctac 378

                                                                       
Query: 476 ctgacaagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtg 535
           ||||| ||||| ||||||||||||||||| |||||||| || || ||||||||||| || 
Sbjct: 379 ctgacgagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgta 438

                                                                       
Query: 536 cttggtggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggttaacatg 595
            ||||||| ||||||||||| |||||||| || ||||| |||||||||||||||||||||
Sbjct: 439 attggtggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggttaacatg 498

                                                                       
Query: 596 attggtacacactttgaggagaatcacattgccactggatttgggaaccatatggcaatc 655
           |||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 499 attggtacacactttgaggaaaaccacattgccactgggtttgggaaccatatggcaatc 558

                                                                       
Query: 656 ccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgttaagctcatt 715
           ||||| ||||||  ||||||||| ||||||||||| ||||| |||||||| |||||  ||
Sbjct: 559 ccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgtcaagcttgtt 618

                                                                       
Query: 716 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaaattccagatt 775
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 619 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaagttccagatt 678

                                                                       
Query: 776 gccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagaccaactgg 835
           ||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  |||||
Sbjct: 679 gccaagatcacaactgagggagcgaccatctacccgccatactcattgaagacttactgg 738

                                                              
Query: 836 gggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
           || || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 739 ggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 789



to top

>dbj|AK103975.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-F06, full
           insert sequence
          Length = 985

 Score =  704 bits (355), Expect = 0.0
 Identities = 577/651 (88%)
 Strand = Plus / Plus

                                                                       
Query: 236 attgcaatgaaatacaaggatggtgtgatcatggcatgtgatactggagcctcttatggg 295
           |||||| ||||||||||||||||||| ||||||||||  || ||||||||||| ||||| 
Sbjct: 206 attgcactgaaatacaaggatggtgtcatcatggcatccgacactggagcctcatatggc 265

                                                                       
Query: 296 tcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaagcatagccttatt 355
           ||||| |||||||||||||| |||||||| || ||||  ||||| |||||||||||||||
Sbjct: 266 tcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaagcatagccttatt 325

                                                                       
Query: 356 ggagggagtggggagttcagtgatttccaggagattttgcgctatctggatgaattaact 415
           ||||  ||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 326 ggagcaagtggggagttcagtgatttccaggagattttgcgctatttggatgaattaacc 385

                                                                       
Query: 416 ttgaacgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctac 475
            ||  ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  ||||
Sbjct: 386 ctgtccgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctac 445

                                                                       
Query: 476 ctgacaagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtg 535
           ||||| ||||| ||||||||||||||||| |||||||| || || ||||||||||| || 
Sbjct: 446 ctgacgagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgta 505

                                                                       
Query: 536 cttggtggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggttaacatg 595
            ||||||| ||||||||||| |||||||| || ||||| |||||||||||||||||||||
Sbjct: 506 attggtggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggttaacatg 565

                                                                       
Query: 596 attggtacacactttgaggagaatcacattgccactggatttgggaaccatatggcaatc 655
           |||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 566 attggtacacactttgaggaaaaccacattgccactgggtttgggaaccatatggcaatc 625

                                                                       
Query: 656 ccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgttaagctcatt 715
           ||||| ||||||  ||||||||| ||||||||||| ||||| |||||||| |||||  ||
Sbjct: 626 ccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgtcaagcttgtt 685

                                                                       
Query: 716 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaaattccagatt 775
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 686 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaagttccagatt 745

                                                                       
Query: 776 gccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagaccaactgg 835
           ||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  |||||
Sbjct: 746 gccaagatcacaactgagggagcgaccatctacccgccatactcattgaagacttactgg 805

                                                              
Query: 836 gggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
           || || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 806 ggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 856



to top

>dbj|AK071380.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091G01, full
           insert sequence
          Length = 1090

 Score =  704 bits (355), Expect = 0.0
 Identities = 577/651 (88%)
 Strand = Plus / Plus

                                                                       
Query: 236 attgcaatgaaatacaaggatggtgtgatcatggcatgtgatactggagcctcttatggg 295
           |||||| ||||||||||||||||||| ||||||||||  || ||||||||||| ||||| 
Sbjct: 224 attgcactgaaatacaaggatggtgtcatcatggcatccgacactggagcctcatatggc 283

                                                                       
Query: 296 tcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaagcatagccttatt 355
           ||||| |||||||||||||| |||||||| || ||||  ||||| |||||||||||||||
Sbjct: 284 tcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaagcatagccttatt 343

                                                                       
Query: 356 ggagggagtggggagttcagtgatttccaggagattttgcgctatctggatgaattaact 415
           ||||  ||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 344 ggagcaagtggggagttcagtgatttccaggagattttgcgctatttggatgaattaacc 403

                                                                       
Query: 416 ttgaacgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctac 475
            ||  ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  ||||
Sbjct: 404 ctgtccgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctac 463

                                                                       
Query: 476 ctgacaagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtg 535
           ||||| ||||| ||||||||||||||||| |||||||| || || ||||||||||| || 
Sbjct: 464 ctgacgagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgta 523

                                                                       
Query: 536 cttggtggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggttaacatg 595
            ||||||| ||||||||||| |||||||| || ||||| |||||||||||||||||||||
Sbjct: 524 attggtggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggttaacatg 583

                                                                       
Query: 596 attggtacacactttgaggagaatcacattgccactggatttgggaaccatatggcaatc 655
           |||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 584 attggtacacactttgaggaaaaccacattgccactgggtttgggaaccatatggcaatc 643

                                                                       
Query: 656 ccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgttaagctcatt 715
           ||||| ||||||  ||||||||| ||||||||||| ||||| |||||||| |||||  ||
Sbjct: 644 ccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgtcaagcttgtt 703

                                                                       
Query: 716 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaaattccagatt 775
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 704 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaagttccagatt 763

                                                                       
Query: 776 gccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagaccaactgg 835
           ||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  |||||
Sbjct: 764 gccaagatcacaactgagggagcgaccatctacccgccatactcattgaagacttactgg 823

                                                              
Query: 836 gggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
           || || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 824 ggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 874



to top

>dbj|AB026568.1| Oryza sativa (japonica cultivar-group) OsPBG1 mRNA for beta 7
           subunit of 20S proteasome, complete cds
          Length = 1118

 Score =  696 bits (351), Expect = 0.0
 Identities = 576/651 (88%)
 Strand = Plus / Plus

                                                                       
Query: 236 attgcaatgaaatacaaggatggtgtgatcatggcatgtgatactggagcctcttatggg 295
           |||||| ||||||||||||||||||| ||||||||||  || ||||||||||| ||||| 
Sbjct: 225 attgcactgaaatacaaggatggtgtcatcatggcatccgacactggagcctcatatggc 284

                                                                       
Query: 296 tcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaagcatagccttatt 355
           ||||| |||||||||||||| |||||||| || ||||  ||||| |||||||||||||||
Sbjct: 285 tcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaagcatagccttatt 344

                                                                       
Query: 356 ggagggagtggggagttcagtgatttccaggagattttgcgctatctggatgaattaact 415
           ||||  ||||||||||||||||||||||||||||||||||||||| ||||||||||||| 
Sbjct: 345 ggagcaagtggggagttcagtgatttccaggagattttgcgctatttggatgaattaacc 404

                                                                       
Query: 416 ttgaacgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctac 475
            ||  ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  ||||
Sbjct: 405 ctgtccgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctac 464

                                                                       
Query: 476 ctgacaagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtg 535
           ||||| ||||| ||||||||||||||||| |||||||| || || ||||||||||| || 
Sbjct: 465 ctgacgagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgta 524

                                                                       
Query: 536 cttggtggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggttaacatg 595
            ||||||| ||||||||||| |||||||| || ||||| |||||||||||||||||||||
Sbjct: 525 attggtggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggttaacatg 584

                                                                       
Query: 596 attggtacacactttgaggagaatcacattgccactggatttgggaaccatatggcaatc 655
           ||||||||||| |||||||| || |||||||||||||| |||||||||||||||||||||
Sbjct: 585 attggtacacattttgaggaaaaccacattgccactgggtttgggaaccatatggcaatc 644

                                                                       
Query: 656 ccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgttaagctcatt 715
           ||||| ||||||  ||||||||| ||||||||||| ||||| |||||||| |||||  ||
Sbjct: 645 ccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgtcaagcttgtt 704

                                                                       
Query: 716 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaaattccagatt 775
           |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 705 gagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaagttccagatt 764

                                                                       
Query: 776 gccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagaccaactgg 835
           ||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  |||||
Sbjct: 765 gccaagatcacaactgagggagcgaccatctacccgccatactcattgaagacttactgg 824

                                                              
Query: 836 gggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
           || || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 825 ggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 875



to top

>gb|AY736120.1| Triticum aestivum 20S proteasome beta 7 subunit mRNA, complete cds
          Length = 694

 Score =  664 bits (335), Expect = 0.0
 Identities = 374/387 (96%)
 Strand = Plus / Plus

                                                                       
Query: 499 gcgcaataagtttgaccctctatggaactccctggtgcttggtggagtgaaaaagggccc 558
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 302 gcgcaataagtttgaccctctatggaactccctggtgcttggtggagtgaaaaagggccc 361

                                                                       
Query: 559 aaagggcgatgagaagtatcttggcatggttaacatgattggtacacactttgaggagaa 618
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 362 aaagggcgatgagaagtatcttggcatggttaacatgattggtacacactttgaggaaaa 421

                                                                       
Query: 619 tcacattgccactggatttgggaaccatatggcaatcccaatccttcgtggtgaatggcg 678
            ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 422 ccacattgccactggatttgggaaccatatggcaatcccaatacttcgtggtgaatggcg 481

                                                                       
Query: 679 tgaggacatgacttttgaagaagctgttaagctcattgagaagtgcttgcttgtcctgct 738
            |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 482 cgaggacatgacttttgaagaagctgttaagctgattgagaagtgcttgctggtcctgct 541

                                                                       
Query: 739 gtaccgtgaccgatcatctatcaacaaattccagattgccaagatcacgaccgagggatc 798
           |||||||||||| ||||| ||||||||||||||||||||||||||||| |||||||||||
Sbjct: 542 gtaccgtgaccggtcatccatcaacaaattccagattgccaagatcacaaccgagggatc 601

                                                                       
Query: 799 gaccatctacccaccgtatgccctgaagaccaactgggggtttgctgcctttgagaaccc 858
            ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 602 aaccatctacccgccgtatgccctgaagaccaactgggggtttgccgcctttgagaaccc 661

                                      
Query: 859 gtccaagggtgctgtaggaacatggta 885
            ||||||||||||||||||||||||||
Sbjct: 662 atccaagggtgctgtaggaacatggta 688



 Score =  391 bits (197), Expect = e-105
 Identities = 224/233 (96%)
 Strand = Plus / Plus

                                                                       
Query: 182 ggaggggacggaacgcagaggacactgaacccttatgtgactggtaactcggtgattgca 241
           ||||| ||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||
Sbjct: 69  ggaggagacgggacgcagaggacactgaatccttatgtgactggtaattcggtgattgca 128

                                                                       
Query: 242 atgaaatacaaggatggtgtgatcatggcatgtgatactggagcctcttatgggtcaacc 301
           |||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||| 
Sbjct: 129 atgaaatacaaggacggtgtgatcatggcatgtgacactggagcctcctatgggtcaact 188

                                                                       
Query: 302 ttgcgatacaagagtgtggagcgtatcaaggaggttggaaagcatagccttattggaggg 361
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 189 ttgcgatacaagagtgtggagcgtatcaaggaggttggaaagcatagccttattggaggg 248

                                                                
Query: 362 agtggggagttcagtgatttccaggagattttgcgctatctggatgaattaac 414
           ||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 249 agtggggagttcagtgatttccaggagattttgcggtatctggatgaattaac 301



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 44/47 (93%), Gaps = 1/47 (2%)
 Strand = Plus / Plus

                                                          
Query: 112 acgagcgaaac-aaagccgcatcaaccccccacgcgaaccgatggac 157
           ||||||||||| ||||||||||||| |||||||||| ||||||||||
Sbjct: 1   acgagcgaaaccaaagccgcatcaagcccccacgcgcaccgatggac 47



to top

>gb|BT018203.1| Zea mays clone EL01N0560A08.c mRNA sequence
          Length = 946

 Score =  569 bits (287), Expect = e-159
 Identities = 539/623 (86%)
 Strand = Plus / Plus

                                                                       
Query: 215 tatgtgactggtaactcggtgattgcaatgaaatacaaggatggtgtgatcatggcatgt 274
           |||||||||||||| || || |||||  ||||||||||||||||||||||||||||||||
Sbjct: 221 tatgtgactggtaattcagtcattgccttgaaatacaaggatggtgtgatcatggcatgt 280

                                                                       
Query: 275 gatactggagcctcttatgggtcaaccttgcgatacaagagtgtggagcgtatcaaggag 334
           || ||||||||||||||||| ||||| ||| |||||||||||||||| |  || ||||  
Sbjct: 281 gacactggagcctcttatggatcaactttgagatacaagagtgtggaactcattaaggca 340

                                                                       
Query: 335 gttggaaagcatagccttattggagggagtggggagttcagtgatttccaggagattttg 394
           ||||| ||||||||| | |||||||  || || ||||||||||| |||||||||||||||
Sbjct: 341 gttggcaagcatagcatcattggagcaagcggagagttcagtgacttccaggagattttg 400

                                                                       
Query: 395 cgctatctggatgaattaactttgaacgatcatatgtgggatgatgggaactcattgggc 454
           |||||| |||||||| ||||| ||   |||||||||||||||||||| |||||  |||||
Sbjct: 401 cgctatttggatgaactaactctgtctgatcatatgtgggatgatggaaactcgctgggc 460

                                                                       
Query: 455 cccaaggaaatccatgcctacctgacaagagtaatgtacaacaggcgcaataagtttgac 514
           ||||| || |||||   |||  |||||||||| ||||||||| ||||||| |||||||| 
Sbjct: 461 cccaaagagatccacagctatttgacaagagtgatgtacaaccggcgcaacaagtttgat 520

                                                                       
Query: 515 cctctatggaactccctggtgcttggtggagtgaaaaagggcccaaagggcgatgagaag 574
           ||||| |||||||| || || |||||||| ||||||||||| |||||||| |||||||||
Sbjct: 521 cctctctggaactcacttgtacttggtggggtgaaaaagggtccaaagggtgatgagaag 580

                                                                       
Query: 575 tatcttggcatggttaacatgattggtacacactttgaggagaatcacattgccactgga 634
           |||||||| |||||||||||||||||||| ||||| ||||| || ||  | || ||||||
Sbjct: 581 tatcttgggatggttaacatgattggtacccacttcgaggaaaaccatgtcgctactgga 640

                                                                       
Query: 635 tttgggaaccatatggcaatcccaatccttcgtggtgaatggcgtgaggacatgactttt 694
           ||||| || |||||||||||||| || || |||| ||||||||| ||||| |||||||||
Sbjct: 641 tttggaaatcatatggcaatcccgatactccgtgctgaatggcgcgaggatatgactttt 700

                                                                       
Query: 695 gaagaagctgttaagctcattgagaagtgcttgcttgtcctgctgtaccgtgaccgatca 754
           |||||||||||||||||  |||||||||||||| | ||| |||||||||| ||| |||||
Sbjct: 701 gaagaagctgttaagctggttgagaagtgcttggtggtcttgctgtaccgagacagatca 760

                                                                       
Query: 755 tctatcaacaaattccagattgccaagatcacgaccgagggatcgaccatctacccaccg 814
           |||||||||||||||||||||||||||||||| |  || ||||| ||||||||||| || 
Sbjct: 761 tctatcaacaaattccagattgccaagatcacaagggaaggatcaaccatctacccccca 820

                                  
Query: 815 tatgccctgaagaccaactgggg 837
           ||| || |||||||| |||||||
Sbjct: 821 tattccttgaagacctactgggg 843



to top

>gb|AY104193.1| Zea mays PCO143176 mRNA sequence
          Length = 1187

 Score =  531 bits (268), Expect = e-147
 Identities = 571/672 (84%)
 Strand = Plus / Plus

                                                                       
Query: 215 tatgtgactggtaactcggtgattgcaatgaaatacaaggatggtgtgatcatggcatgt 274
           |||||||||||||  || || |||||  ||||||||||||||||||||||||||||||||
Sbjct: 323 tatgtgactggtacttcagtcattgccttgaaatacaaggatggtgtgatcatggcatgt 382

                                                                       
Query: 275 gatactggagcctcttatgggtcaaccttgcgatacaagagtgtggagcgtatcaaggag 334
           || |||||||| || ||||| ||||| ||| |||||||||||||||| || || ||||  
Sbjct: 383 gacactggagcatcctatggatcaactttgagatacaagagtgtggaacgcattaaggct 442

                                                                       
Query: 335 gttggaaagcatagccttattggagggagtggggagttcagtgatttccaggagattttg 394
           ||||| ||||||||| | |||||||  || || |||||||| ||||||||||||||  ||
Sbjct: 443 gttggcaagcatagcatcattggagcaagcggagagttcagcgatttccaggagatcctg 502

                                                                       
Query: 395 cgctatctggatgaattaactttgaacgatcatatgtgggatgatgggaactcattgggc 454
           ||||||||||||||| ||||| |    |||||||||||||||||||| || ||  |||||
Sbjct: 503 cgctatctggatgaactaactctttctgatcatatgtgggatgatggaaattctctgggc 562

                                                                       
Query: 455 cccaaggaaatccatgcctacctgacaagagtaatgtacaacaggcgcaataagtttgac 514
           ||||| || |||||    ||  |||||||||| ||||||||||| ||||| |||||||| 
Sbjct: 563 cccaaagagatccacagttatttgacaagagtgatgtacaacagacgcaacaagtttgat 622

                                                                       
Query: 515 cctctatggaactccctggtgcttggtggagtgaaaaagggcccaaagggcgatgagaag 574
           ||||| |||||||| || || |||||||||||||||||||| |||||||| |||||||||
Sbjct: 623 cctctctggaactcacttgtacttggtggagtgaaaaagggtccaaagggtgatgagaag 682

                                                                       
Query: 575 tatcttggcatggttaacatgattggtacacactttgaggagaatcacattgccactgga 634
           ||||||||||||||||| ||||||||||| ||||| ||||| || ||  | || ||||||
Sbjct: 683 tatcttggcatggttaatatgattggtacccacttcgaggaaaaccatgtcgcaactgga 742

                                                                       
Query: 635 tttgggaaccatatggcaatcccaatccttcgtggtgaatggcgtgaggacatgactttt 694
           ||||  || ||| |||| ||||| || || |||| ||||||||| ||||| |||||||||
Sbjct: 743 tttgcaaatcatctggcgatcccgatactccgtgctgaatggcgcgaggatatgactttt 802

                                                                       
Query: 695 gaagaagctgttaagctcattgagaagtgcttgcttgtcctgctgtaccgtgaccgatca 754
           |||||||||||||||||  |||||||||||||||| ||| |||||||||||||| | |||
Sbjct: 803 gaagaagctgttaagctggttgagaagtgcttgctggtcttgctgtaccgtgacaggtca 862

                                                                       
Query: 755 tctatcaacaaattccagattgccaagatcacgaccgagggatcgaccatctacccaccg 814
           |||||||||||||||||||||||||||||||| || || ||||| |||||||||||||| 
Sbjct: 863 tctatcaacaaattccagattgccaagatcacaactgaaggatcaaccatctacccacca 922

                                                                       
Query: 815 tatgccctgaagaccaactgggggtttgctgcctttgagaacccgtccaagggtgctgta 874
           ||| || |||||||| ||||||| ||  ||  |||||| |||||  || |||| ||||| 
Sbjct: 923 tattccttgaagacctactggggcttctctcactttgaaaacccagcccagggcgctgtg 982

                       
Query: 875 ggaacatggtag 886
           ||| ||||||||
Sbjct: 983 ggatcatggtag 994



to top

>gb|AC108755.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
             OSJNBa0028C22, complete sequence
          Length = 154228

 Score =  260 bits (131), Expect = 9e-66
 Identities = 173/187 (92%)
 Strand = Plus / Minus

                                                                         
Query: 586   ggttaacatgattggtacacactttgaggagaatcacattgccactggatttgggaacca 645
             |||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 99775 ggttaacatgattggtacacactttgaggaaaaccacattgccactgggtttgggaacca 99716

                                                                         
Query: 646   tatggcaatcccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgt 705
             ||||||||||||||| ||||||  ||||||||| ||||||||||| ||||| ||||||||
Sbjct: 99715 tatggcaatcccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgt 99656

                                                                         
Query: 706   taagctcattgagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaa 765
              |||||  |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 99655 caagcttgttgagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaa 99596

                    
Query: 766   attccag 772
              ||||||
Sbjct: 99595 gttccag 99589



 Score =  167 bits (84), Expect = 1e-37
 Identities = 147/168 (87%)
 Strand = Plus / Minus

                                                                          
Query: 421    cgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctacctgac 480
              ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  |||||||||
Sbjct: 100028 cgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctacctgac 99969

                                                                          
Query: 481    aagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtgcttgg 540
               ||||| ||||||||||||||||| |||||||| || || ||||||||||| ||  ||||
Sbjct: 99968  gagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgtaattgg 99909

                                                              
Query: 541    tggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggt 588
              ||| ||||||||||| |||||||| || ||||| ||||||||||||||
Sbjct: 99908  tggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggt 99861



 Score =  167 bits (84), Expect = 1e-37
 Identities = 120/132 (90%)
 Strand = Plus / Minus

                                                                          
Query: 283    agcctcttatgggtcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaa 342
              |||||| ||||| ||||| |||||||||||||| |||||||| || ||||  ||||| ||
Sbjct: 100252 agcctcatatggctcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaa 100193

                                                                          
Query: 343    gcatagccttattggagggagtggggagttcagtgatttccaggagattttgcgctatct 402
              |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||| |
Sbjct: 100192 gcatagccttattggagcaagtggggagttcagtgatttccaggagattttgcgctattt 100133

                          
Query: 403    ggatgaattaac 414
              ||||||||||||
Sbjct: 100132 ggatgaattaac 100121



 Score = 87.7 bits (44), Expect = 7e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                         
Query: 771   agattgccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagacca 830
             |||||||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  
Sbjct: 99493 agattgccaagatcacaactgagggagcgaccatctacccgccatactcattgaagactt 99434

                                                                     
Query: 831   actgggggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
             ||||||| || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 99433 actggggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 99378



 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                   
Query: 236    attgcaatgaaatacaaggatggtgtgatcatggcat 272
              |||||| ||||||||||||||||||| ||||||||||
Sbjct: 100375 attgcactgaaatacaaggatggtgtcatcatggcat 100339



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9
          Length = 22696651

 Score =  260 bits (131), Expect = 9e-66
 Identities = 173/187 (92%)
 Strand = Plus / Minus

                                                                            
Query: 586      ggttaacatgattggtacacactttgaggagaatcacattgccactggatttgggaacca 645
                |||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 19772508 ggttaacatgattggtacacactttgaggaaaaccacattgccactgggtttgggaacca 19772449

                                                                            
Query: 646      tatggcaatcccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgt 705
                ||||||||||||||| ||||||  ||||||||| ||||||||||| ||||| ||||||||
Sbjct: 19772448 tatggcaatcccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgt 19772389

                                                                            
Query: 706      taagctcattgagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaa 765
                 |||||  |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 19772388 caagcttgttgagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaa 19772329

                       
Query: 766      attccag 772
                 ||||||
Sbjct: 19772328 gttccag 19772322



 Score =  167 bits (84), Expect = 1e-37
 Identities = 147/168 (87%)
 Strand = Plus / Minus

                                                                            
Query: 421      cgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctacctgac 480
                ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  |||||||||
Sbjct: 19772761 cgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctacctgac 19772702

                                                                            
Query: 481      aagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtgcttgg 540
                 ||||| ||||||||||||||||| |||||||| || || ||||||||||| ||  ||||
Sbjct: 19772701 gagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgtaattgg 19772642

                                                                
Query: 541      tggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggt 588
                ||| ||||||||||| |||||||| || ||||| ||||||||||||||
Sbjct: 19772641 tggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggt 19772594



 Score =  167 bits (84), Expect = 1e-37
 Identities = 120/132 (90%)
 Strand = Plus / Minus

                                                                            
Query: 283      agcctcttatgggtcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaa 342
                |||||| ||||| ||||| |||||||||||||| |||||||| || ||||  ||||| ||
Sbjct: 19772985 agcctcatatggctcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaa 19772926

                                                                            
Query: 343      gcatagccttattggagggagtggggagttcagtgatttccaggagattttgcgctatct 402
                |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||| |
Sbjct: 19772925 gcatagccttattggagcaagtggggagttcagtgatttccaggagattttgcgctattt 19772866

                            
Query: 403      ggatgaattaac 414
                ||||||||||||
Sbjct: 19772865 ggatgaattaac 19772854



 Score = 87.7 bits (44), Expect = 7e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                            
Query: 771      agattgccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagacca 830
                |||||||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  
Sbjct: 19772226 agattgccaagatcacaactgagggagcgaccatctacccgccatactcattgaagactt 19772167

                                                                        
Query: 831      actgggggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
                ||||||| || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 19772166 actggggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 19772111



 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                     
Query: 236      attgcaatgaaatacaaggatggtgtgatcatggcat 272
                |||||| ||||||||||||||||||| ||||||||||
Sbjct: 19773108 attgcactgaaatacaaggatggtgtcatcatggcat 19773072



to top

>dbj|AP006756.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0450E05
          Length = 176553

 Score =  260 bits (131), Expect = 9e-66
 Identities = 173/187 (92%)
 Strand = Plus / Minus

                                                                          
Query: 586    ggttaacatgattggtacacactttgaggagaatcacattgccactggatttgggaacca 645
              |||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||
Sbjct: 118194 ggttaacatgattggtacacactttgaggaaaaccacattgccactgggtttgggaacca 118135

                                                                          
Query: 646    tatggcaatcccaatccttcgtggtgaatggcgtgaggacatgacttttgaagaagctgt 705
              ||||||||||||||| ||||||  ||||||||| ||||||||||| ||||| ||||||||
Sbjct: 118134 tatggcaatcccaatacttcgtactgaatggcgcgaggacatgacatttgaggaagctgt 118075

                                                                          
Query: 706    taagctcattgagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctatcaacaa 765
               |||||  |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 118074 caagcttgttgagaagtgcttgcttgtcctgctgtaccgtgaccgatcatctattaacaa 118015

                     
Query: 766    attccag 772
               ||||||
Sbjct: 118014 gttccag 118008



 Score =  167 bits (84), Expect = 1e-37
 Identities = 147/168 (87%)
 Strand = Plus / Minus

                                                                          
Query: 421    cgatcatatgtgggatgatgggaactcattgggccccaaggaaatccatgcctacctgac 480
              ||||||||||||||||||||| ||||| ||||| ||||||||  |||||  |||||||||
Sbjct: 118447 cgatcatatgtgggatgatggaaactccttgggtcccaaggaggtccatagctacctgac 118388

                                                                          
Query: 481    aagagtaatgtacaacaggcgcaataagtttgaccctctatggaactccctggtgcttgg 540
               ||||| ||||||||||||||||| |||||||| || || ||||||||||| ||  ||||
Sbjct: 118387 gagagtgatgtacaacaggcgcaacaagtttgatcccctctggaactcccttgtaattgg 118328

                                                              
Query: 541    tggagtgaaaaagggcccaaagggcgatgagaagtatcttggcatggt 588
              ||| ||||||||||| |||||||| || ||||| ||||||||||||||
Sbjct: 118327 tggggtgaaaaagggtccaaagggtgaagagaaatatcttggcatggt 118280



 Score =  167 bits (84), Expect = 1e-37
 Identities = 120/132 (90%)
 Strand = Plus / Minus

                                                                          
Query: 283    agcctcttatgggtcaaccttgcgatacaagagtgtggagcgtatcaaggaggttggaaa 342
              |||||| ||||| ||||| |||||||||||||| |||||||| || ||||  ||||| ||
Sbjct: 118671 agcctcatatggctcaactttgcgatacaagagcgtggagcgcattaaggctgttggtaa 118612

                                                                          
Query: 343    gcatagccttattggagggagtggggagttcagtgatttccaggagattttgcgctatct 402
              |||||||||||||||||  ||||||||||||||||||||||||||||||||||||||| |
Sbjct: 118611 gcatagccttattggagcaagtggggagttcagtgatttccaggagattttgcgctattt 118552

                          
Query: 403    ggatgaattaac 414
              ||||||||||||
Sbjct: 118551 ggatgaattaac 118540



 Score = 87.7 bits (44), Expect = 7e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                          
Query: 771    agattgccaagatcacgaccgagggatcgaccatctacccaccgtatgccctgaagacca 830
              |||||||||||||||| || |||||| ||||||||||||| || ||  |  |||||||  
Sbjct: 117912 agattgccaagatcacaactgagggagcgaccatctacccgccatactcattgaagactt 117853

                                                                      
Query: 831    actgggggtttgctgcctttgagaacccgtccaagggtgctgtaggaacatggtag 886
              ||||||| || ||||||||||| || ||| || |||||||||||||| ||||||||
Sbjct: 117852 actggggcttcgctgcctttgaaaatccggcccagggtgctgtaggatcatggtag 117797



 Score = 58.0 bits (29), Expect = 7e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                   
Query: 236    attgcaatgaaatacaaggatggtgtgatcatggcat 272
              |||||| ||||||||||||||||||| ||||||||||
Sbjct: 118794 attgcactgaaatacaaggatggtgtcatcatggcat 118758



to top

>gb|AC189496.1| Brassica rapa subsp. pekinensis clone KBrB086C10, complete sequence
          Length = 130811

 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 115/143 (80%)
 Strand = Plus / Plus

                                                                         
Query: 611   gaggagaatcacattgccactggatttgggaaccatatggcaatcccaatccttcgtggt 670
             ||||| |||||  ||||||||||||||||||||||  | || |  ||||||||||||| |
Sbjct: 11682 gaggacaatcatgttgccactggatttgggaaccacctagctaggccaatccttcgtgat 11741

                                                                         
Query: 671   gaatggcgtgaggacatgacttttgaagaagctgttaagctcattgagaagtgcttgctt 730
             || ||||||| |||| |||  || ||||| | ||| |||||| ||||||| ||  ||| |
Sbjct: 11742 gagtggcgtgcggacctgagcttcgaagatggtgtcaagctccttgagaaatgtatgcgt 11801

                                    
Query: 731   gtcctgctgtaccgtgaccgatc 753
             || || || ||||||||| ||||
Sbjct: 11802 gtgcttctttaccgtgacagatc 11824



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 416   ttgaacgatcatatgtgggatgatgggaactcattggg 453
             ||||||||| | |||||||||||||| ||||| |||||
Sbjct: 11414 ttgaacgataacatgtgggatgatggtaactctttggg 11451



to top

>gb|AC164103.5| Mus musculus BAC clone RP23-427D2 from chromosome 5, complete sequence
          Length = 188588

 Score = 50.1 bits (25), Expect = 0.016
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                           
Query: 69     ccatccccagccccagccccagccgagcc 97
              |||||||||||||||||||||||| ||||
Sbjct: 175827 ccatccccagccccagccccagcccagcc 175855



to top

>ref|XM_854103.1| PREDICTED: Canis familiaris similar to nischarin, transcript variant
            3 (LOC476594), mRNA
          Length = 4618

 Score = 50.1 bits (25), Expect = 0.016
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||||||||
Sbjct: 3311 ccccagccccagccccagccgagcc 3335



to top

>ref|XM_533798.2| PREDICTED: Canis familiaris similar to nischarin, transcript variant
            1 (LOC476594), mRNA
          Length = 5208

 Score = 50.1 bits (25), Expect = 0.016
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||||||||
Sbjct: 3311 ccccagccccagccccagccgagcc 3335



to top

>gb|AC134862.4| Mus musculus BAC clone RP24-91P2 from 5, complete sequence
          Length = 205726

 Score = 50.1 bits (25), Expect = 0.016
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 69    ccatccccagccccagccccagccgagcc 97
             |||||||||||||||||||||||| ||||
Sbjct: 85220 ccatccccagccccagccccagcccagcc 85248



to top

>ref|XM_520802.2| PREDICTED: Pan troglodytes cancer susceptibility candidate 1 (CASC1),
            mRNA
          Length = 4339

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 2523 aactgtgctgctgaaacagtttca 2500



to top

>gb|BC117283.1| Homo sapiens cancer susceptibility candidate 1, mRNA (cDNA clone
           MGC:150892 IMAGE:40125834), complete cds
          Length = 2118

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 910 aactgtgctgctgaaacagtttca 933
           ||||||||||||||||||||||||
Sbjct: 984 aactgtgctgctgaaacagtttca 961



to top

>gb|BC117281.1| Homo sapiens cancer susceptibility candidate 1, mRNA (cDNA clone
           MGC:150890 IMAGE:40125832), complete cds
          Length = 2115

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 910 aactgtgctgctgaaacagtttca 933
           ||||||||||||||||||||||||
Sbjct: 984 aactgtgctgctgaaacagtttca 961



to top

>ref|XR_012635.1| PREDICTED: Macaca mulatta similar to cancer susceptibility candidate
            1 (LOC707753), mRNA
          Length = 3045

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1244 aactgtgctgctgaaacagtttca 1221



to top

>gb|BC047415.1| Homo sapiens cancer susceptibility candidate 1, mRNA (cDNA clone
            IMAGE:5269578), partial cds
          Length = 2578

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1205 aactgtgctgctgaaacagtttca 1182



to top

>gb|AC157610.2| Mus musculus chromosome 15, clone RP23-77H12, complete sequence
          Length = 164913

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 38388 ccatccccagccccagccccagcc 38411



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 38416 ccccagccccagccccagcccagcc 38440



to top

>gb|AC121365.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0053E05,
              complete sequence
          Length = 196284

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 236    attgcaatgaaatacaaggatggtgtga 263
              |||||| |||||||||||||||||||||
Sbjct: 107591 attgcactgaaatacaaggatggtgtga 107618



to top

>ref|NM_018272.2| Homo sapiens cancer susceptibility candidate 1 (CASC1), mRNA
          Length = 2550

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1205 aactgtgctgctgaaacagtttca 1182



to top

>gb|AC131781.3| Mus musculus BAC clone RP24-344J9 from chromosome 15, complete sequence
          Length = 139338

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 53529 ccatccccagccccagccccagcc 53552



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 53557 ccccagccccagccccagcccagcc 53581



to top

>gb|AY423543.1| Homo sapiens lung adenoma susceptibility 1-like protein (LAS1) mRNA,
            complete cds
          Length = 2151

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1067 aactgtgctgctgaaacagtttca 1044



to top

>gb|AC163027.5| Mus musculus chromosome 5, clone RP23-396H22, complete sequence
          Length = 216377

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 87905 ccatccccagccccagccccagcc 87882



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    ccatccccagccccagcccca 89
             |||||||||||||||||||||
Sbjct: 87923 ccatccccagccccagcccca 87903



to top

>gb|BC057795.1| Homo sapiens cancer susceptibility candidate 1, mRNA (cDNA clone
            MGC:71648 IMAGE:5266518), complete cds
          Length = 2376

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1149 aactgtgctgctgaaacagtttca 1126



to top

>dbj|AK093358.1| Homo sapiens cDNA FLJ36039 fis, clone TESTI2017311
          Length = 2483

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 69  ccatccccagccccagccccagcc 92
           ||||||||||||||||||||||||
Sbjct: 419 ccatccccagccccagccccagcc 442



to top

>dbj|AK093102.1| Homo sapiens cDNA FLJ35783 fis, clone TESTI2005568, weakly similar to
            TRANSLATION INITIATION FACTOR IF-2
          Length = 2347

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1137 aactgtgctgctgaaacagtttca 1114



to top

>dbj|AK001783.1| Homo sapiens cDNA FLJ10921 fis, clone OVARC1000411
          Length = 1784

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 910 aactgtgctgctgaaacagtttca 933
           ||||||||||||||||||||||||
Sbjct: 574 aactgtgctgctgaaacagtttca 551



to top

>gb|BC028415.1| Homo sapiens cancer susceptibility candidate 1, mRNA (cDNA clone
            MGC:33578 IMAGE:4823620), complete cds
          Length = 2464

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1300 aactgtgctgctgaaacagtttca 1277



to top

>gb|BC031047.1| Homo sapiens cancer susceptibility candidate 1, mRNA (cDNA clone
            IMAGE:5270474)
          Length = 2377

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1150 aactgtgctgctgaaacagtttca 1127



to top

>dbj|AB168925.1| Macaca fascicularis testis cDNA, clone: QtsA-15847, similar to human
            cancer susceptibility candidate 1 (CASC1), mRNA, RefSeq:
            NM_018272.2
          Length = 2384

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 910  aactgtgctgctgaaacagtttca 933
            ||||||||||||||||||||||||
Sbjct: 1148 aactgtgctgctgaaacagtttca 1125



to top

>emb|AJ291743.1|NTA291743 Nicotiana tabacum partial mRNA for putative beta7 proteasome
           subunit (b7 gene)
          Length = 389

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 428 atgtgggatgatgggaactcattgggccccaa 459
           |||||||||||||||||||| ||||| |||||
Sbjct: 149 atgtgggatgatgggaactccttgggtcccaa 180



to top

>ref|XM_813279.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053506859.240) partial mRNA
          Length = 1575

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 65   accaccatccccagccccagccccagcc 92
            ||||||| ||||||||||||||||||||
Sbjct: 1086 accaccagccccagccccagccccagcc 1059



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 236      attgcaatgaaatacaaggatggtgtga 263
                |||||| |||||||||||||||||||||
Sbjct: 26256543 attgcactgaaatacaaggatggtgtga 26256570



to top

>gb|AC002091.2| Homo sapiens chromosome 17, clone CTB-41I6, complete sequence
          Length = 161816

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 18078 ccatccccagccccagccccagcc 18101



to top

>emb|AL953889.9| Human DNA sequence from clone RP11-7G23 on chromosome 9 Contains six
             novel pseudogenes, the FAM27A gene for  family with
             sequence similarity 27, member A, a novel gene and five
             CpG islands, complete sequence
          Length = 160730

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 86895 ccatccccagccccagccccagcc 86918



to top

>emb|AL645608.30| Human DNA sequence from clone RP11-54O7 on chromosome 1 Contains three
              novel genes, a novel gene (MGC45873), a novel gene
              (DKFZP564C186), a novel gene, a novel gene (DKFZP434H2010),
              a novel gene (MGC13275), the gene for bHLH factor Hes4
              (Hes4), a ribosomal protein L39 (RPL39) pseudogene, a novel
              gene, the G1P2 gene for interferon alpha-inducible protein
              (clone IFI-15K), the AGRN gene for agrin, two novel genes
              and fifteen CpG islands, complete sequence
          Length = 186759

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 73     ccccagccccagccccagccgagc 96
              ||||||||||||||||||||||||
Sbjct: 157664 ccccagccccagccccagccgagc 157687



to top

>emb|AL627230.15| Human DNA sequence from clone RP11-12A20 on chromosome 9 Contains six
             novel pseudogenes, the FAM27B gene for family with
             sequence similarity 27, member B, a pseudogene similar to
             part of ribosomal protein L10 (RPL10) and four CpG
             islands, complete sequence
          Length = 194246

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 96335 ccatccccagccccagccccagcc 96358



to top

>emb|AL391987.15| Human DNA sequence from clone RP11-374M1 on chromosome 9 Contains the
              FAM27C gene for family with sequence similarity 27, member
              C, three novel genes, five novel pseudogenes and six CpG
              islands, complete sequence
          Length = 202081

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 69     ccatccccagccccagccccagcc 92
              ||||||||||||||||||||||||
Sbjct: 168539 ccatccccagccccagccccagcc 168562



to top

>emb|AL596182.28| Mouse DNA sequence from clone RP23-303F24 on chromosome 11 Contains a
             pseudogene similar to part of glyceraldehyde-3-phosphate
             dehydrogenase (Gapd), the Irf1 gene for interferon
             regulatory factor 1, a novel gene, the Slc22a5 gene for
             solute carrier family 22 (organic cation transporter)
             member 5, a ribosomal protein L27a (Rpl27a) pseudogene, a
             cyclin-dependent kinase 4 (Cdk4) pseudogene and two CpG
             islands, complete sequence
          Length = 191494

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 89456 ccatccccagccccagccccagcc 89433



to top

>gb|AC118598.8| Mus musculus chromosome 5, clone RP23-446M13, complete sequence
          Length = 186276

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 65621 ccatccccagccccagccccagcc 65598



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    ccatccccagccccagcccca 89
             |||||||||||||||||||||
Sbjct: 65639 ccatccccagccccagcccca 65619



to top

>gb|AC161198.5| Mus musculus chromosome 15, clone RP23-34E23, complete sequence
          Length = 237801

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 69   ccatccccagccccagccccagcc 92
            ||||||||||||||||||||||||
Sbjct: 2264 ccatccccagccccagccccagcc 2241



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||| ||||
Sbjct: 2236 ccccagccccagccccagcccagcc 2212



to top

>gb|AC137764.6| Mus musculus chromosome 3, clone RP24-512E12, complete sequence
          Length = 148074

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 65    accaccatccccagccccagccccagcc 92
             ||||||| ||||||||||||||||||||
Sbjct: 69325 accaccagccccagccccagccccagcc 69352



to top

>gb|AC003695.1|AC003695 Homo sapiens chromosome 17, clone hRPC.859_O_20, complete sequence
          Length = 115199

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 58694 ccatccccagccccagccccagcc 58671



to top

>emb|AL118524.25|HSJ1059A9 Human DNA sequence from clone RP5-1059A9 on chromosome 9. Contains two
             putative novel genes, ESTs, STSs and GSSs, complete
             sequence
          Length = 99858

 Score = 48.1 bits (24), Expect = 0.064
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 69    ccatccccagccccagccccagcc 92
             ||||||||||||||||||||||||
Sbjct: 20631 ccatccccagccccagccccagcc 20608



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 75      ccagccccagccccagccgagcc 97
               |||||||||||||||||||||||
Sbjct: 2755185 ccagccccagccccagccgagcc 2755207



to top

>gb|AC112706.2| Homo sapiens chromosome 19 clone CTD-3195E18, complete sequence
          Length = 65069

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 66    ccaccatccccagccccagccccagcc 92
             |||||| ||||||||||||||||||||
Sbjct: 30796 ccaccagccccagccccagccccagcc 30822



 Score = 46.1 bits (23), Expect = 0.25
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 66    ccaccatccccagccccagccccagcc 92
             |||||| ||||||||||||||||||||
Sbjct: 30982 ccaccagccccagccccagccccagcc 31008



 Score = 46.1 bits (23), Expect = 0.25
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 66    ccaccatccccagccccagccccagcc 92
             |||||| ||||||||||||||||||||
Sbjct: 31262 ccaccagccccagccccagccccagcc 31288



 Score = 46.1 bits (23), Expect = 0.25
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 66    ccaccatccccagccccagccccagcc 92
             |||||| ||||||||||||||||||||
Sbjct: 31386 ccaccagccccagccccagccccagcc 31412



 Score = 46.1 bits (23), Expect = 0.25
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 66    ccaccatccccagccccagccccagcc 92
             |||||| ||||||||||||||||||||
Sbjct: 31876 ccaccagccccagccccagccccagcc 31902



to top

>gb|AC010768.10| Homo sapiens chromosome 11, clone RP11-58K22, complete sequence
          Length = 192391

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 66    ccaccatccccagccccagccccagcc 92
             |||||| ||||||||||||||||||||
Sbjct: 41554 ccaccagccccagccccagccccagcc 41528



to top

>gb|AC011199.22| Homo sapiens chromosome 3 clone RP11-61K12, complete sequence
          Length = 152135

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 70    catccccagccccagccccagcc 92
             |||||||||||||||||||||||
Sbjct: 56040 catccccagccccagccccagcc 56062



to top

>gb|AC130566.7| Homo sapiens 3 BAC RP11-61K12 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 91240

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 70    catccccagccccagccccagcc 92
             |||||||||||||||||||||||
Sbjct: 34861 catccccagccccagccccagcc 34839



to top

>emb|AL355836.3|CNS05TCQ Human chromosome 14 DNA sequence BAC R-8L8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 166894

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 69    ccatccccagccccagccccagc 91
             |||||||||||||||||||||||
Sbjct: 84858 ccatccccagccccagccccagc 84880



to top

>emb|AL805960.10| Mouse DNA sequence from clone RP23-20P17 on chromosome X, complete
              sequence
          Length = 172780

 Score = 46.1 bits (23), Expect = 0.25
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 69     ccatccccagccccagccccagc 91
              |||||||||||||||||||||||
Sbjct: 151533 ccatccccagccccagccccagc 151511



to top

>ref|XM_001219879.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_00659)
           mRNA, complete cds
          Length = 720

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 67  caccatccccagccccagccccagcc 92
           ||||| ||||||||||||||||||||
Sbjct: 571 caccacccccagccccagccccagcc 546



to top

>gb|AC162448.10| Mus musculus chromosome 1, clone RP24-405F23, complete sequence
          Length = 180366

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 67    caccatccccagccccagccccagcc 92
             ||||| ||||||||||||||||||||
Sbjct: 97924 caccagccccagccccagccccagcc 97899



to top

>ref|XM_875888.1| PREDICTED: Bos taurus similar to vesicle amine transport protein 1,
           transcript variant 3 (LOC510698), mRNA
          Length = 2365

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 679 tgaggacatgacttttgaagaagctg 704
           ||||| ||||||||||||||||||||
Sbjct: 234 tgaggccatgacttttgaagaagctg 259



to top

>ref|XM_587873.2| PREDICTED: Bos taurus similar to vesicle amine transport protein 1,
           transcript variant 1 (LOC510698), mRNA
          Length = 2654

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 679 tgaggacatgacttttgaagaagctg 704
           ||||| ||||||||||||||||||||
Sbjct: 523 tgaggccatgacttttgaagaagctg 548



to top

>gb|AC139039.9| Mus musculus chromosome 16, clone RP23-300H4, complete sequence
          Length = 202308

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 67     caccatccccagccccagccccagcc 92
              ||||| ||||||||||||||||||||
Sbjct: 173427 caccagccccagccccagccccagcc 173452



to top

>ref|XM_855468.1| PREDICTED: Canis familiaris similar to archain, transcript variant
           2 (LOC479415), mRNA
          Length = 3323

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 79  ccccagccccagccgagccgag 100
           ||||||||||||||||||||||
Sbjct: 58  ccccagccccagccgagccgag 79



to top

>ref|XM_536552.2| PREDICTED: Canis familiaris similar to archain, transcript variant
           1 (LOC479415), mRNA
          Length = 3308

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 79  ccccagccccagccgagccgag 100
           ||||||||||||||||||||||
Sbjct: 58  ccccagccccagccgagccgag 79



to top

>gb|AC131961.1| Drosophila pseudoobscura  FOSMID DPSF1-548A3 (Children's Hospital
             Oakland Research Institute Drosophila pseudoobscura FOSMID
             Library) complete sequence
          Length = 39990

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 69    ccatccccagccccagccccag 90
             ||||||||||||||||||||||
Sbjct: 38857 ccatccccagccccagccccag 38836



to top

>gb|AC114930.2| Homo sapiens chromosome 5 clone CTD-2017A19, complete sequence
          Length = 100233

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 617 aatcacattgccactggatttg 638
           ||||||||||||||||||||||
Sbjct: 418 aatcacattgccactggatttg 397



to top

>gb|AC118456.2| Homo sapiens chromosome 5 clone CTD-2288B6, complete sequence
          Length = 121822

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 617   aatcacattgccactggatttg 638
             ||||||||||||||||||||||
Sbjct: 15896 aatcacattgccactggatttg 15917



to top

>dbj|AK083019.1| Mus musculus 12 days embryo spinal cord cDNA, RIKEN full-length
            enriched library, clone:C530034A12
            product:unclassifiable, full insert sequence
          Length = 3402

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 67   caccatccccagccccagccccagcc 92
            ||||| ||||||||||||||||||||
Sbjct: 1092 caccagccccagccccagccccagcc 1067



to top

>dbj|AK078512.1| Mus musculus 12 days embryo female mullerian duct includes
            surrounding region cDNA, RIKEN full-length enriched
            library, clone:6820427H12 product:lysyl oxidase-like,
            full insert sequence
          Length = 3147

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 73   ccccagccccagccccagccga 94
            ||||||||||||||||||||||
Sbjct: 1115 ccccagccccagccccagccga 1136



to top

>gb|AF092915.1|AF092915 Nicotiana tabacum cytochrome P450-dependent fatty acid hydroxylase
           (CYP94A4) mRNA, complete cds
          Length = 1722

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 690 cttttgaagaagctgttaagct 711
           ||||||||||||||||||||||
Sbjct: 686 cttttgaagaagctgttaagct 707



to top

>emb|AL390198.17| Human DNA sequence from clone RP13-401N8 on chromosome 20 Contains three
              novel genes, a vomeronasal organ phermone receptor family
              pseudogene, a novel zinc-finger pseudogene and nine CpG
              islands, complete sequence
          Length = 167717

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 67     caccatccccagccccagccccagcc 92
              ||||| ||||||||||||||||||||
Sbjct: 135361 caccagccccagccccagccccagcc 135386



to top

>emb|AL359873.11| Human DNA sequence from clone RP4-704D23 on chromosome 1p36.11-36.23
            Contains a novel gene, complete sequence
          Length = 86743

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 72   tccccagccccagccccagccgagcc 97
            ||||||||||||||||||||| ||||
Sbjct: 6714 tccccagccccagccccagcccagcc 6689



to top

>emb|AL356215.11| Human DNA sequence from clone RP4-607I7 on chromosome 11p11.2-12
             Contains the start of the CD44 (CD44 antigen (homing
             function andnIndian blood group system)) gene, ESTs, STSs,
             GSSs and a CpG island, complete sequence
          Length = 150533

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 71    atccccagccccagccccagcc 92
             ||||||||||||||||||||||
Sbjct: 18217 atccccagccccagccccagcc 18238



to top

>gb|AC127285.4| Mus musculus BAC clone RP23-336P20 from chromosome 8, complete sequence
          Length = 232127

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 71     atccccagccccagccccagcc 92
              ||||||||||||||||||||||
Sbjct: 101614 atccccagccccagccccagcc 101593



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 101559 ccccagccccagccccagcccagcc 101535



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 101594 ccccagccccagccccagcccagcc 101570



to top

>gb|AF250504.1|AF250504 Treponema pallidum clone N(UNC)#5 TprK (tprK) gene, complete cds
          Length = 1527

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 73   ccccagccccagccccagccga 94
            ||||||||||||||||||||||
Sbjct: 1199 ccccagccccagccccagccga 1220



to top

>gb|AC092275.3| Homo sapiens chromosome 16 clone CTC-786C10, complete sequence
          Length = 191996

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 67    caccatccccagccccagccccagcc 92
             ||||| ||||||||||||||||||||
Sbjct: 97831 caccagccccagccccagccccagcc 97856



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 97843 ccccagccccagccccagccg 97863



to top

>emb|AL805980.28| Mouse DNA sequence from clone RP23-49C8 on chromosome X, complete
              sequence
          Length = 172618

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 67     caccatccccagccccagccccagcc 92
              ||||| ||||||||||||||||||||
Sbjct: 147302 caccagccccagccccagccccagcc 147277



to top

>gb|AC007993.15|AC007993 Homo sapiens chromosome 17, clone RP11-527L4, complete sequence
          Length = 141704

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 71    atccccagccccagccccagcc 92
             ||||||||||||||||||||||
Sbjct: 60132 atccccagccccagccccagcc 60153



to top

>emb|AM157181.1| Sus scrofa RETN gene for resistin, exons 1-4
          Length = 2649

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 67  caccatccccagccccagccccagcc 92
           ||||| ||||||||||||||||||||
Sbjct: 913 caccagccccagccccagccccagcc 938



to top

>emb|AM157180.1| Sus scrofa RETN gene for resistin
          Length = 2664

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 67  caccatccccagccccagccccagcc 92
           ||||| ||||||||||||||||||||
Sbjct: 914 caccagccccagccccagccccagcc 939



to top

>emb|AL845521.9| Mouse DNA sequence from clone RP23-359C5 on chromosome 2, complete
             sequence
          Length = 128641

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 67    caccatccccagccccagccccagcc 92
             ||||| ||||||||||||||||||||
Sbjct: 73000 caccagccccagccccagccccagcc 72975



to top

>gb|AC004490.1|AC004490 Homo sapiens chromosome 19, cosmid R29381, complete sequence
          Length = 39143

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 67  caccatccccagccccagccccagcc 92
           ||||| ||||||||||||||||||||
Sbjct: 578 caccagccccagccccagccccagcc 603



to top

>emb|AL663028.12| Mouse DNA sequence from clone RP23-23J11 on chromosome 2, complete
             sequence
          Length = 110275

 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 67    caccatccccagccccagccccagcc 92
             ||||| ||||||||||||||||||||
Sbjct: 17386 caccagccccagccccagccccagcc 17411



 Score = 44.1 bits (22), Expect = 1.0
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 67    caccatccccagccccagccccagcc 92
             ||||| ||||||||||||||||||||
Sbjct: 17421 caccagccccagccccagccccagcc 17446



to top

>ref|NM_013370.3| Homo sapiens oxidative stress induced growth inhibitor 1 (OSGIN1),
           transcript variant 1, mRNA
          Length = 2409

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 68  accatccccagccccagccccagcc 92
           |||| ||||||||||||||||||||
Sbjct: 484 accagccccagccccagccccagcc 508



to top

>gb|CP000481.1| Acidothermus cellulolyticus 11B, complete genome
          Length = 2443540

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 64     gaccaccatccccagccccagccccagcc 92
              |||| ||| ||||||||||||||||||||
Sbjct: 668255 gacccccagccccagccccagccccagcc 668283



to top

>ref|XM_001223183.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_03970)
            mRNA, complete cds
          Length = 5733

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 72   tccccagccccagccccagcc 92
            |||||||||||||||||||||
Sbjct: 4799 tccccagccccagccccagcc 4779



to top

>ref|XM_001219966.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_00746)
            mRNA, complete cds
          Length = 5145

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 74   cccagccccagccccagccga 94
            |||||||||||||||||||||
Sbjct: 4627 cccagccccagccccagccga 4607



to top

>ref|XM_778933.2| PREDICTED: Strongylocentrotus purpuratus similar to high mobility
           group protein 1; HMG1 (LOC578784), mRNA
          Length = 1043

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 72  tccccagccccagccccagcc 92
           |||||||||||||||||||||
Sbjct: 794 tccccagccccagccccagcc 814



to top

>ref|XM_001203148.1| PREDICTED: Strongylocentrotus purpuratus similar to high mobility
           group protein 1; HMG1 (LOC578784), mRNA
          Length = 1043

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 72  tccccagccccagccccagcc 92
           |||||||||||||||||||||
Sbjct: 794 tccccagccccagccccagcc 814



to top

>dbj|AK235184.1| Sus scrofa mRNA, clone:OVRM10056C05, expressed in ovary
          Length = 2373

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||| ||||
Sbjct: 1497 ccccagccccagccccagcccagcc 1521



to top

>gb|CP000441.1| Burkholderia cepacia AMMD chromosome 2, complete sequence
          Length = 2646969

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 73      ccccagccccagccccagccg 93
               |||||||||||||||||||||
Sbjct: 1822420 ccccagccccagccccagccg 1822400



to top

>ref|XM_001149613.1| PREDICTED: Pan troglodytes hypothetical protein LOC746152
            (LOC746152), mRNA
          Length = 3226

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 68   accatccccagccccagccccagcc 92
            |||| ||||||||||||||||||||
Sbjct: 1250 accagccccagccccagccccagcc 1274



to top

>ref|XM_001165487.1| PREDICTED: Pan troglodytes hypothetical LOC460623, transcript variant
            1 (LOC460623), mRNA
          Length = 2112

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1483 ccccagccccagccccagccg 1463



to top

>ref|XM_516684.2| PREDICTED: Pan troglodytes hypothetical LOC460623, transcript variant
            3 (LOC460623), mRNA
          Length = 2030

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1401 ccccagccccagccccagccg 1381



to top

>ref|XM_001165524.1| PREDICTED: Pan troglodytes hypothetical LOC460623, transcript variant
            2 (LOC460623), mRNA
          Length = 1996

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1367 ccccagccccagccccagccg 1347



to top

>gb|DQ893844.1| Homo sapiens clone FLH164895.01L; RZPDo839D05157D HCLS1 mRNA, partial
            sequence
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|DQ890664.1| Synthetic construct Homo sapiens clone FLH164899.01X; RZPDo839D05158D
            HCLS1 mRNA, complete sequence
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|AC187575.2| Pongo pygmaeus abelii BAC clone CH276-12H12 from chromosome unknown,
             complete sequence
          Length = 210860

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 68    accatccccagccccagccccagcc 92
             |||| ||||||||||||||||||||
Sbjct: 85076 accagccccagccccagccccagcc 85052



to top

>gb|AE014134.5| Drosophila melanogaster chromosome 2L, complete sequence
          Length = 23011544

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 74     cccagccccagccccagccga 94
              |||||||||||||||||||||
Sbjct: 858021 cccagccccagccccagccga 858001



to top

>gb|BC113623.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA (cDNA clone
           MGC:142183 IMAGE:8322675), complete cds
          Length = 1180

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 62  gagaccaccatccccagccccagcc 86
           |||||||||||| ||||||||||||
Sbjct: 86  gagaccaccatcgccagccccagcc 110



to top

>gb|BC113625.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA (cDNA clone
           MGC:142185 IMAGE:8322677), complete cds
          Length = 1180

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 62  gagaccaccatccccagccccagcc 86
           |||||||||||| ||||||||||||
Sbjct: 86  gagaccaccatcgccagccccagcc 110



to top

>ref|XM_001077332.1| PREDICTED: Rattus norvegicus adenylate cyclase 9 (predicted)
            (Adcy9_predicted), mRNA
          Length = 6399

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 72   tccccagccccagccccagcc 92
            |||||||||||||||||||||
Sbjct: 6208 tccccagccccagccccagcc 6228



to top

>ref|XM_220178.4| PREDICTED: Rattus norvegicus adenylate cyclase 9 (predicted)
            (Adcy9_predicted), mRNA
          Length = 4766

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 72   tccccagccccagccccagcc 92
            |||||||||||||||||||||
Sbjct: 4566 tccccagccccagccccagcc 4586



to top

>ref|XM_001102247.1| PREDICTED: Macaca mulatta similar to Atonal protein homolog 1
          (Helix-loop-helix protein hATH-1) (ATOH1), mRNA
          Length = 1065

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 62 gagaccaccatccccagccccagcc 86
          |||||||||||| ||||||||||||
Sbjct: 50 gagaccaccatcgccagccccagcc 74



to top

>gb|CP000386.1| Rubrobacter xylanophilus DSM 9941, complete genome
          Length = 3225748

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 71      atccccagccccagccccagc 91
               |||||||||||||||||||||
Sbjct: 1247690 atccccagccccagccccagc 1247670



to top

>emb|CR376840.30| Zebrafish DNA sequence from clone CH211-185M11 in linkage group 23,
             complete sequence
          Length = 128526

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 20    tgtcttctcttcttcacgaggaaga 44
             ||||| |||||||||||||||||||
Sbjct: 92510 tgtctactcttcttcacgaggaaga 92534



to top

>ref|NM_148507.1| Arabidopsis thaliana unknown protein (AT1G34315) mRNA, complete cds
          Length = 819

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 23  cttctcttcttcacgaggaagaaag 47
           |||||||||||| ||||||||||||
Sbjct: 114 cttctcttcttctcgaggaagaaag 90



to top

>ref|NM_001012432.1| Pan troglodytes atonal homolog 1 (Drosophila) (ATOH1), mRNA
 gb|AY665249.1| Pan troglodytes atonal 1 mRNA, complete cds
          Length = 1071

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 62 gagaccaccatccccagccccagcc 86
          |||||||||||| ||||||||||||
Sbjct: 50 gagaccaccatcgccagccccagcc 74



to top

>gb|AC122005.3| Mus musculus chromosome 5 clone RP24-340B11, complete sequence
          Length = 183264

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 84160 ccccagccccagccccagcccagcc 84136



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 84201 ccccagccccagccccagcccagcc 84177



to top

>ref|NM_005172.1| Homo sapiens atonal homolog 1 (Drosophila) (ATOH1), mRNA
          Length = 1065

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 62 gagaccaccatccccagccccagcc 86
          |||||||||||| ||||||||||||
Sbjct: 50 gagaccaccatcgccagccccagcc 74



to top

>gb|AY360386.1| Oryza sativa (japonica cultivar-group) chromosome 8 BAC OSJNBa0017M13,
              complete sequence
          Length = 161902

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 68     accatccccagccccagccccagcc 92
              |||| ||||||||||||||||||||
Sbjct: 113449 accaaccccagccccagccccagcc 113473



to top

>ref|NM_028227.2| Mus musculus BRCA1 associated protein (Brap), mRNA
          Length = 3727

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 3330 ccccagccccagccccagccg 3310



to top

>ref|XM_881285.1| PREDICTED: Bos taurus hypothetical protein LOC616146 (LOC616146),
          mRNA
          Length = 639

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 73 ccccagccccagccccagccg 93
          |||||||||||||||||||||
Sbjct: 4  ccccagccccagccccagccg 24



to top

>gb|BC069578.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA (cDNA clone
          IMAGE:7262382), partial cds
          Length = 1060

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 62 gagaccaccatccccagccccagcc 86
          |||||||||||| ||||||||||||
Sbjct: 45 gagaccaccatcgccagccccagcc 69



to top

>gb|AC092222.2| Drosophila melanogaster clone BACR16I01, complete sequence
          Length = 165697

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 74     cccagccccagccccagccga 94
              |||||||||||||||||||||
Sbjct: 108593 cccagccccagccccagccga 108613



to top

>gb|AC102745.10| Mus musculus chromosome 17, clone RP24-371L2, complete sequence
          Length = 189211

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 115048 tccccagccccagccccagcc 115028



to top

>gb|AC091454.2| Mus musculus chromosome X, clones RP21-438P10, RP21-382F2, RP21-118B24,
              Map qA7.1, complete sequences
          Length = 393632

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 146121 ccccagccccagccccagcccagcc 146097



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 146215 ccccagccccagccccagcccagcc 146191



to top

>gb|BC069145.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA (cDNA clone
          MGC:95430 IMAGE:7217005), complete cds
          Length = 1066

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 62 gagaccaccatccccagccccagcc 86
          |||||||||||| ||||||||||||
Sbjct: 51 gagaccaccatcgccagccccagcc 75



to top

>ref|NM_010729.2| Mus musculus lysyl oxidase-like 1 (Loxl1), mRNA
 gb|BC037999.1| Mus musculus lysyl oxidase-like 1, mRNA (cDNA clone MGC:46960
            IMAGE:5251968), complete cds
          Length = 2460

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1112 ccccagccccagccccagccg 1132



to top

>ref|NM_005335.3| Homo sapiens hematopoietic cell-specific Lyn substrate 1 (HCLS1),
            mRNA
 gb|BC016758.2| Homo sapiens hematopoietic cell-specific Lyn substrate 1, mRNA (cDNA
            clone MGC:1442 IMAGE:2966303), complete cds
          Length = 2029

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1325 ccccagccccagccccagccg 1305



to top

>gb|AC091395.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-288L22, complete
             sequence
          Length = 163323

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 25954 ccccagccccagccccagcccagcc 25978



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 26208 ccccagccccagccccagcccagcc 26232



to top

>gb|AC112143.5| Mus musculus BAC clone RP23-29E2 from chromosome 2, complete sequence
          Length = 205920

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 158034 ccccagccccagccccagcctagcc 158058



to top

>gb|AC102312.11| Mus musculus chromosome 10, clone RP24-428L4, complete sequence
          Length = 182940

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 69 ccatccccagccccagcccca 89
          |||||||||||||||||||||
Sbjct: 52 ccatccccagccccagcccca 72



to top

>gb|AC120411.9| Mus musculus chromosome 6, clone RP24-447O2, complete sequence
          Length = 202938

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 115388 tccccagccccagccccagcc 115408



to top

>gb|AY190956.1| Drosophila virilis clone DVIF01_06_H02 (D1438) genomic sequence
          Length = 46427

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 31547 ccccagccccagccccagccg 31527



to top

>ref|XM_846038.1| PREDICTED: Canis familiaris hypothetical protein LOC608892
           (LOC608892), mRNA
          Length = 1017

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 72  tccccagccccagccccagcc 92
           |||||||||||||||||||||
Sbjct: 878 tccccagccccagccccagcc 898



to top

>ref|XM_534562.2| PREDICTED: Canis familiaris similar to kinesin family member 13B,
            transcript variant 1 (LOC477369), mRNA
          Length = 5571

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 5036 ccccagccccagccccagccg 5056



to top

>ref|XM_851754.1| PREDICTED: Canis familiaris similar to kinesin family member 13B,
            transcript variant 2 (LOC477369), mRNA
          Length = 5625

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 5090 ccccagccccagccccagccg 5110



to top

>gb|BC003973.1| Mus musculus lysyl oxidase-like 1, mRNA (cDNA clone IMAGE:3488791),
           partial cds
          Length = 1557

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 73  ccccagccccagccccagccg 93
           |||||||||||||||||||||
Sbjct: 183 ccccagccccagccccagccg 203



to top

>gb|AC099341.4| Homo sapiens BAC clone RP11-317C13 from 7, complete sequence
          Length = 51939

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 43510 tccccagccccagccccagcc 43530



to top

>ref|XM_848807.1| PREDICTED: Canis familiaris similar to Dedicator of cytokinesis
            protein 6 (LOC611163), mRNA
          Length = 8988

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 64   gaccaccatccccagccccagccccagcc 92
            |||| ||| ||||||||||||||||||||
Sbjct: 7123 gacccccagccccagccccagccccagcc 7151



to top

>gb|AY504961.1| Homo sapiens tumor necrosis factor receptor superfamily, member 7
            (TNFRSF7) gene, complete cds
          Length = 10529

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 68   accatccccagccccagccccagcc 92
            |||| ||||||||||||||||||||
Sbjct: 5827 accaaccccagccccagccccagcc 5851



to top

>ref|XM_538612.2| PREDICTED: Canis familiaris similar to fibrillin 2 precursor
           (LOC481491), mRNA
          Length = 10291

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 73  ccccagccccagccccagccg 93
           |||||||||||||||||||||
Sbjct: 139 ccccagccccagccccagccg 159



to top

>gb|AC133207.3| Mus musculus BAC clone RP23-116L23 from chromosome 10, complete
             sequence
          Length = 222101

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 87429 tccccagccccagccccagcc 87409



to top

>gb|AC009119.10| Homo sapiens chromosome 16 clone RP11-483P21, complete sequence
          Length = 181020

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 68     accatccccagccccagccccagcc 92
              |||| ||||||||||||||||||||
Sbjct: 180487 accagccccagccccagccccagcc 180511



to top

>gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosome 8, complete sequence
          Length = 183936

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 99188 ccccagccccagccccagccg 99168



to top

>gb|AC133750.2| Homo sapiens 3 BAC RP11-619K22 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 87386

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 3557 ccccagccccagccccagccg 3577



to top

>gb|AC023141.6| Homo sapiens BAC clone RP11-548K12 from 7, complete sequence
          Length = 197637

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 68    accatccccagccccagccccagcc 92
             |||| ||||||||||||||||||||
Sbjct: 67119 accagccccagccccagccccagcc 67095



to top

>gb|BC038490.1| Mus musculus BRCA1 associated protein, mRNA (cDNA clone MGC:47099
            IMAGE:3599718), complete cds
          Length = 3135

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 2722 ccccagccccagccccagccg 2702



to top

>gb|BC017145.1| Mus musculus arrestin 3, retinal, mRNA (cDNA clone MGC:28831
           IMAGE:4506006), complete cds
          Length = 1706

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 72  tccccagccccagccccagcc 92
           |||||||||||||||||||||
Sbjct: 839 tccccagccccagccccagcc 819



to top

>gb|AC160976.2| Mus musculus BAC clone RP24-67M24 from chromosome 9, complete sequence
          Length = 184288

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 21435 ccccagccccagccccagccg 21455



to top

>gb|AC103627.6| Mus musculus chromosome 1, clone RP24-241N3, complete sequence
          Length = 201487

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 130405 tccccagccccagccccagcc 130425



to top

>gb|AC091624.3| Canis familiaris clone RP81-117B1, complete sequence
          Length = 174712

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 73     ccccagccccagccccagccg 93
              |||||||||||||||||||||
Sbjct: 128578 ccccagccccagccccagccg 128598



to top

>dbj|AK124015.1| Homo sapiens cDNA FLJ42021 fis, clone SPLEN2034448, highly  similar
            to HEMATOPOIETIC LINEAGE CELL SPECIFIC PROTEIN
          Length = 2724

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 2091 ccccagccccagccccagccg 2071



to top

>gb|AC093572.18| Pan troglodytes clone rp43-25g23, complete sequence
          Length = 195652

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 170288 ccccagccccagccccagcccagcc 170312



to top

>gb|BT008130.1| Synthetic construct Homo sapiens hematopoietic cell-specific Lyn
            substrate 1 mRNA, partial cds
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|BT006824.1| Homo sapiens hematopoietic cell-specific Lyn substrate 1 mRNA,
            complete cds
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|AY573556.1| Sus scrofa delta-5 fatty acid desaturase gene, partial cds
          Length = 1114

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 74  cccagccccagccccagccga 94
           |||||||||||||||||||||
Sbjct: 948 cccagccccagccccagccga 928



to top

>gb|AC136191.5| Rattus norvegicus  BAC CH230-52I17 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 221923

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 23955 ccccagccccagccccagccg 23975



to top

>ref|NR_001464.1| Bos taurus X (inactive)-specific transcript (XIST) on chromosome X
          Length = 34635

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||| ||||
Sbjct: 2623 ccccagccccagccccagcccagcc 2647



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||| ||||
Sbjct: 2723 ccccagccccagccccagcccagcc 2747



to top

>dbj|AK143718.1| Mus musculus 6 days neonate spleen cDNA, RIKEN full-length enriched
            library, clone:F430012E22 product:BRCA1 associated
            protein, full insert sequence
          Length = 3529

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 3149 ccccagccccagccccagccg 3129



to top

>dbj|AK138861.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A430092M18 product:BRCA1 associated
            protein, full insert sequence
          Length = 4317

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 3937 ccccagccccagccccagccg 3917



to top

>gb|AC129805.7| Homo sapiens 12 BAC RP11-125N22 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 165378

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 68    accatccccagccccagccccagcc 92
             |||| ||||||||||||||||||||
Sbjct: 77877 accagccccagccccagccccagcc 77853



to top

>gb|AC091495.4| Homo sapiens chromosome 18, clone RP11-894D23, complete sequence
          Length = 158458

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 81216 tccccagccccagccccagcc 81196



to top

>gb|AC009899.12| Homo sapiens chromosome 18, clone RP11-19F9, complete sequence
          Length = 164359

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 163349 tccccagccccagccccagcc 163369



to top

>gb|AC034259.7| Homo sapiens chromosome 11, clone RP11-138N3, complete sequence
          Length = 206192

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 58085 tccccagccccagccccagcc 58065



to top

>gb|AC009879.8| Homo sapiens, clone RP11-346I3, complete sequence
          Length = 191352

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 146570 tccccagccccagccccagcc 146590



to top

>gb|AC087889.15| Mus Musculus Strain C57BL6/J Chromosome 10 BAC, RP23-337L15, Complete
              Sequence, complete sequence
          Length = 215756

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 148537 tccccagccccagccccagcc 148517



to top

>emb|CT010480.10| Mouse DNA sequence from clone RP23-313E11 on chromosome 13, complete
             sequence
          Length = 203636

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 77706 ccccagccccagccccagccg 77726



to top

>gb|AC108487.2| Homo sapiens chromosome 3 clone RP11-733E24, complete sequence
          Length = 180925

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 532    ggtgcttggtggagtgaaaaa 552
              |||||||||||||||||||||
Sbjct: 172223 ggtgcttggtggagtgaaaaa 172203



to top

>dbj|AK034212.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length enriched
            library, clone:9330164E08 product:BRCA1 associated
            protein, full insert sequence
          Length = 2618

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 2287 ccccagccccagccccagccg 2267



to top

>gb|AC091784.8| Genomic sequence for Mus musculus, clone RP23-213D23, complete sequence
          Length = 215410

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 146085 tccccagccccagccccagcc 146105



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8
          Length = 28434780

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 68       accatccccagccccagccccagcc 92
                |||| ||||||||||||||||||||
Sbjct: 13388976 accaaccccagccccagccccagcc 13389000



to top

>gb|AC087413.5| Homo sapiens BAC clone RP11-680J17 from 4, complete sequence
          Length = 80701

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 62    gagaccaccatccccagccccagcc 86
             |||||||||||| ||||||||||||
Sbjct: 12664 gagaccaccatcgccagccccagcc 12688



to top

>gb|AC011711.8| Homo sapiens chromosome 11, clone RP11-309J20, complete sequence
          Length = 149542

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 679   tgaggacatgacttttgaaga 699
             |||||||||||||||||||||
Sbjct: 24349 tgaggacatgacttttgaaga 24369



to top

>emb|AL935212.11| Human DNA sequence from clone RP11-160N1 on chromosome 9 Contains eight
              novel pseudogenes, two novel genes and three CpG islands,
              complete sequence
          Length = 181647

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 68     accatccccagccccagccccagcc 92
              |||| ||||||||||||||||||||
Sbjct: 156141 accagccccagccccagccccagcc 156165



to top

>gb|AF357006.1|AF357006 Mus musculus lysyl oxidase-like 1 (Loxl1) mRNA, complete cds
          Length = 2013

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 73  ccccagccccagccccagccg 93
           |||||||||||||||||||||
Sbjct: 889 ccccagccccagccccagccg 909



to top

>emb|AL590989.15| Human DNA sequence from clone RP11-149P14 on chromosome 1 Contains a
             pseudogene similar to part of cytochrome b, the 5' end of
             a novel gene and a CpG island, complete sequence
          Length = 110121

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 58885 tccccagccccagccccagcc 58865



to top

>emb|AL512324.14| Human DNA sequence from clone RP11-432I13 on chromosome 10 Contains
            the 3' end of a breast cancer antigen (NY-BR-1)
            pseudogene, the 3' end of a novel gene, a pseudogene
            similar to part of cubilin (intrinsic factor-cobalamin
            receptor, CUBN), a seven transmembrane helix receptor
            (FLJ31393) pseudogene, the OR13A1 gene for olfactory
            receptor family 13 subfamily A member 1 and two CpG
            islands, complete sequence
          Length = 168473

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 72   tccccagccccagccccagcc 92
            |||||||||||||||||||||
Sbjct: 7120 tccccagccccagccccagcc 7100



to top

>emb|AL365274.17| Human DNA sequence from clone RP11-298A17 on chromosome 9 Contains the
              DAB2IP gene for DAB2 interacting protein (AF9Q34, DIP1/2,
              KIAA1743) and four CpG islands, complete sequence
          Length = 171941

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 68     accatccccagccccagccccagcc 92
              |||| ||||||||||||||||||||
Sbjct: 103826 accagccccagccccagccccagcc 103802



to top

>gb|AF424820.1|AF424820 Macaca mulatta neurexophilin 4 mRNA, partial cds
          Length = 332

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 72  tccccagccccagccccagcc 92
           |||||||||||||||||||||
Sbjct: 243 tccccagccccagccccagcc 263



to top

>gb|AC018375.8| Homo sapiens, clone RP11-3P24, complete sequence
          Length = 149951

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 679    tgaggacatgacttttgaaga 699
              |||||||||||||||||||||
Sbjct: 143091 tgaggacatgacttttgaaga 143111



to top

>emb|AL121895.26|HSA234K24 Human DNA sequence from clone RP11-234K24 on chromosome 20 Contains a
              novel gene, the 3' end of the EPB41L1 gene for the
              erythrocyte membrane protein band 4.1-like protein, the
              C20orf4 gene for chromosome 20 open reading frame 4 and a
              CpG island, complete sequence
          Length = 153192

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 132208 tccccagccccagccccagcc 132228



to top

>emb|AL132655.13|HSJ806M20 Human DNA sequence from clone RP4-806M20 on chromosome 20 Contains a
             novel pseudogene, the 5' end of the GNAS complex locus and
             a CpG island, complete sequence
          Length = 126586

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    ccatccccagccccagcccca 89
             |||||||||||||||||||||
Sbjct: 70607 ccatccccagccccagcccca 70587



to top

>gb|AC157950.2| Mus musculus BAC clone RP23-128A23 from chromosome 9, complete sequence
          Length = 202301

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 182969 ccccagccccagccccagcccagcc 182993



to top

>gb|AC157996.2| Mus musculus BAC clone RP24-194J17 from chromosome 9, complete sequence
          Length = 158268

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 22448 ccccagccccagccccagcccagcc 22472



to top

>emb|Z92546.2|HS65A6 Human DNA sequence from clone CTA-65A6 on chromosome 22q11-12 Contains
             the 3' part of the gene for the ortholog of rat CAIN
             (KIAA0330), the gene for a novel Sushi domain (SCR repeat)
             containing protein similar to Mucins, ESTs, an STS, GSSs
             and two putative CpG islands, complete sequence
          Length = 73511

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 61611 ccccagccccagccccagcccagcc 61635



to top

>emb|X16663.1|HSHEAM Human HS1 gene for heamatopoietic lineage cell specific protein
          Length = 1968

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1318 ccccagccccagccccagccg 1298



to top

>emb|CR456794.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0918D for
            gene HCLS1, hematopoietic cell-specific Lyn substrate 1;
            complete cds, incl. stopcodon
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>emb|AL513025.13| Mouse DNA sequence from clone RP23-235O1 on chromosome 13 Contains the 5'
              end of a novel gene, the E2f3 gene for E2F transcription
              factor 3, a novel gene and two CpG islands, complete
              sequence
          Length = 197940

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 177097 tccccagccccagccccagcc 177117



to top

>gb|BC030384.1| Mus musculus BRCA1 associated protein, mRNA (cDNA clone
            IMAGE:5376472), with apparent retained intron
          Length = 2222

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1807 ccccagccccagccccagccg 1787



to top

>emb|BX000359.7| Mouse DNA sequence from clone RP23-343C18 on chromosome 11 Contains the
             gene for a novel helix-loop-helix DNA-binding domain
             containing protein, a novel gene, the Gosr1 gene for golgi
             SNAP receptor complex member 1 and a CpG island, complete
             sequence
          Length = 118586

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 24393 ccccagccccagccccagcccagcc 24369



to top

>emb|AL773510.5| Mouse DNA sequence from clone RP24-200F10 on chromosome 4 Contains a
             novel gene and a casein kinase II alpha 1 polypeptide
             (Csnk2a1) pseudogene, complete sequence
          Length = 134053

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 17478 tccccagccccagccccagcc 17458



to top

>gb|AC116104.7| Mus musculus chromosome 5, clone RP23-18K20, complete sequence
          Length = 210459

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 73     ccccagccccagccccagccg 93
              |||||||||||||||||||||
Sbjct: 104847 ccccagccccagccccagccg 104867



to top

>gb|AC004923.2| Homo sapiens PAC clone RP5-901A4 from 11, complete sequence
          Length = 94851

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 72   tccccagccccagccccagcc 92
            |||||||||||||||||||||
Sbjct: 3280 tccccagccccagccccagcc 3260



to top

>gb|AF321921.1|AF321921 Mus musculus BRAP2 variant 2 mRNA, complete cds
          Length = 3862

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 3482 ccccagccccagccccagccg 3462



to top

>gb|AC154576.2| Mus musculus BAC clone RP23-372B6 from chromosome 14, complete sequence
          Length = 152380

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 347   agccttattggagggagtggg 367
             |||||||||||||||||||||
Sbjct: 37449 agccttattggagggagtggg 37429



to top

>gb|AC093798.3| Homo sapiens BAC clone RP11-306N14 from 2, complete sequence
          Length = 233877

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 200796 tccccagccccagccccagcc 200776



to top

>gb|AC079776.5| Homo sapiens BAC clone RP11-315H12 from 2, complete sequence
          Length = 198961

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    ccatccccagccccagcccca 89
             |||||||||||||||||||||
Sbjct: 74486 ccatccccagccccagcccca 74466



to top

>gb|AC093802.3| Homo sapiens BAC clone RP11-315F22 from 2, complete sequence
          Length = 165535

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 40493 ccccagccccagccccagcccagcc 40517



to top

>gb|AC005840.2|AC005840 Homo sapiens complete sequence of a PAC clone RP1-102E24 containing
             SYB1, CD27, and SCNN1A genes
          Length = 140026

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 68    accatccccagccccagccccagcc 92
             |||| ||||||||||||||||||||
Sbjct: 35803 accaaccccagccccagccccagcc 35779



to top

>gb|AC025812.11|AC025812 Homo sapiens chromosome 3 clone RP11-182G24, complete sequence
          Length = 149006

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 532    ggtgcttggtggagtgaaaaa 552
              |||||||||||||||||||||
Sbjct: 111668 ggtgcttggtggagtgaaaaa 111648



to top

>gb|AC006064.10| Homo sapiens 12 PAC RP5-940J5 (Roswell Park Cancer Institute Human
            PAC Library) complete sequence
          Length = 172571

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 68   accatccccagccccagccccagcc 92
            |||| ||||||||||||||||||||
Sbjct: 6057 accaaccccagccccagccccagcc 6081



to top

>dbj|AP005832.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:B1136D08
          Length = 176635

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 68     accatccccagccccagccccagcc 92
              |||| ||||||||||||||||||||
Sbjct: 140445 accaaccccagccccagccccagcc 140469



to top

>dbj|AP004228.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1120_B07
          Length = 118763

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 68    accatccccagccccagccccagcc 92
             |||| ||||||||||||||||||||
Sbjct: 25703 accaaccccagccccagccccagcc 25727



to top

>dbj|AP006623.1| Homo sapiens genomic DNA, chromosome 11, clone:RP11-1391J07, complete
            sequence
          Length = 121103

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 72   tccccagccccagccccagcc 92
            |||||||||||||||||||||
Sbjct: 7518 tccccagccccagccccagcc 7498



to top

>dbj|AP006621.1| Homo sapiens genomic DNA, chromosome 11, clone:CMB9-55F22, complete
              sequence
          Length = 129989

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 121198 tccccagccccagccccagcc 121178



to top

>gb|AC040169.7| Homo sapiens chromosome 16 clone RP11-505K9, complete sequence
          Length = 212596

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 68   accatccccagccccagccccagcc 92
            |||| ||||||||||||||||||||
Sbjct: 7697 accagccccagccccagccccagcc 7721



to top

>gb|AC132936.9| Homo sapiens chromosome 11, clone RP13-569C6, complete sequence
          Length = 178778

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 112495 tccccagccccagccccagcc 112515



to top

>gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, complete sequence
          Length = 163503

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 90305 tccccagccccagccccagcc 90325



to top

>gb|AC004148.1|AC004148 Homo sapiens chromosome 17, clone HCIT524C5, complete sequence
          Length = 118276

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 22215 tccccagccccagccccagcc 22195



to top

>gb|AY892681.1| Synthetic construct Homo sapiens clone FLH026836.01L hematopoietic
            cell-specific Lyn substrate 1 (HCLS1) mRNA, partial cds
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|AY892680.1| Synthetic construct Homo sapiens clone FLH026835.01L hematopoietic
            cell-specific Lyn substrate 1 (HCLS1) mRNA, partial cds
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|AY890192.1| Synthetic construct Homo sapiens clone FLH026840.01X hematopoietic
            cell-specific Lyn substrate 1 (HCLS1) mRNA, complete cds
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|AY890191.1| Synthetic construct Homo sapiens clone FLH026839.01X hematopoietic
            cell-specific Lyn substrate 1 (HCLS1) mRNA, complete cds
          Length = 1461

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1276 ccccagccccagccccagccg 1256



to top

>gb|AC118614.12| Mus musculus chromosome 18, clone RP23-477B20, complete sequence
          Length = 159912

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 336    ttggaaagcatagccttattggagggagt 364
              |||| ||| ||||||||||||||||||||
Sbjct: 128809 ttgggaagtatagccttattggagggagt 128837



to top

>gb|AC165322.12| Mus musculus chromosome 1, clone RP23-127J15, complete sequence
          Length = 185278

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 143320 ccccagccccagccccagcccagcc 143296



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 143434 ccccagccccagccccagcccagcc 143410



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 143543 ccccagccccagccccagcccagcc 143519



to top

>emb|AL928537.12| Mouse DNA sequence from clone RP23-236E7 on chromosome 2, complete
            sequence
          Length = 190808

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||| ||||
Sbjct: 8827 ccccagccccagccccagcctagcc 8851



to top

>gb|AC155931.2| Mus musculus BAC clone RP23-289D4 from 9, complete sequence
          Length = 189845

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 73   ccccagccccagccccagccgagcc 97
            |||||||||||||||||||| ||||
Sbjct: 4601 ccccagccccagccccagcccagcc 4625



to top

>gb|BC069604.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA (cDNA clone
          MGC:97163 IMAGE:7262406), complete cds
          Length = 1065

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 62 gagaccaccatccccagccccagcc 86
          |||||||||||| ||||||||||||
Sbjct: 50 gagaccaccatcgccagccccagcc 74



to top

>gb|BC069594.1| Homo sapiens atonal homolog 1 (Drosophila), mRNA (cDNA clone
          MGC:97152 IMAGE:7262394), complete cds
          Length = 1065

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                   
Query: 62 gagaccaccatccccagccccagcc 86
          |||||||||||| ||||||||||||
Sbjct: 50 gagaccaccatcgccagccccagcc 74



to top

>gb|AY107914.1| Zea mays PCO063920 mRNA sequence
          Length = 427

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 73  ccccagccccagccccagccg 93
           |||||||||||||||||||||
Sbjct: 273 ccccagccccagccccagccg 293



to top

>ref|NM_001012066.1| Rattus norvegicus sphingosine kinase 2 (Sphk2), mRNA
 gb|BC079120.1| Rattus norvegicus sphingosine kinase 2, mRNA (cDNA clone MGC:94123
            IMAGE:7126682), complete cds
          Length = 2408

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 1202 ccccagccccagccccagccg 1222



to top

>gb|AF152365.1|AF152365 Homo sapiens constitutive fragile region FRA3B sequence
          Length = 246546

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 532    ggtgcttggtggagtgaaaaa 552
              |||||||||||||||||||||
Sbjct: 145755 ggtgcttggtggagtgaaaaa 145735



to top

>emb|CT033785.8| Mouse DNA sequence from clone RP23-445G17 on chromosome 13, complete
              sequence
          Length = 181922

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 105219 tccccagccccagccccagcc 105199



to top

>gb|BC062932.1| Mus musculus cDNA clone IMAGE:30355188, containing frame-shift errors
          Length = 3725

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 73   ccccagccccagccccagccg 93
            |||||||||||||||||||||
Sbjct: 3328 ccccagccccagccccagccg 3308



to top

>emb|BX276129.7| Mouse DNA sequence from clone RP23-213F21 on chromosome X, complete
            sequence
          Length = 77618

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 72   tccccagccccagccccagcc 92
            |||||||||||||||||||||
Sbjct: 6652 tccccagccccagccccagcc 6632



to top

>gb|AC139320.4| Mus musculus BAC clone RP24-410G8 from 9, complete sequence
          Length = 176888

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 73     ccccagccccagccccagccg 93
              |||||||||||||||||||||
Sbjct: 168388 ccccagccccagccccagccg 168408



to top

>emb|CT030730.7| Mouse DNA sequence from clone RP24-252L17 on chromosome 9, complete
             sequence
          Length = 151456

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 97907 ccccagccccagccccagcccagcc 97931



to top

>gb|AC004546.1|AC004546 Drosophila melanogaster DNA sequence (P1s DS02684 (D134) and DS00269
             (D131)), complete sequence
          Length = 102389

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 74    cccagccccagccccagccga 94
             |||||||||||||||||||||
Sbjct: 59654 cccagccccagccccagccga 59674



to top

>gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, complete sequence
          Length = 210710

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 157178 tccccagccccagccccagcc 157158



to top

>gb|AC140324.3| Mus musculus BAC clone RP23-402K14 from 6, complete sequence
          Length = 200190

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 75465 ccccagccccagccccagcccagcc 75441



to top

>emb|CT030196.9| Mouse DNA sequence from clone RP23-282B14 on chromosome 12, complete
              sequence
          Length = 215752

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 205582 ccccagccccagccccagcccagcc 205558



to top

>gb|U61148.1|HSU61148 Human atonal homolog 1 (Hath1) gene, complete cds
          Length = 1572

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 62  gagaccaccatccccagccccagcc 86
           |||||||||||| ||||||||||||
Sbjct: 412 gagaccaccatcgccagccccagcc 436



to top

>emb|AL833776.9| Mouse DNA sequence from clone RP23-478M17 on chromosome X, complete
             sequence
          Length = 136414

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 80604 ccccagccccagccccagcccagcc 80580



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 80698 ccccagccccagccccagcccagcc 80674



to top

>emb|AL731682.20| Mouse DNA sequence from clone RP23-123F7 on chromosome 2, complete
              sequence
          Length = 201290

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 73     ccccagccccagccccagccg 93
              |||||||||||||||||||||
Sbjct: 136335 ccccagccccagccccagccg 136315



to top

>emb|AL671492.12| Mouse DNA sequence from clone RP23-286H11 on chromosome X, complete
             sequence
          Length = 202638

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 52524 tccccagccccagccccagcc 52544



to top

>emb|AL627093.17| Mouse DNA sequence from clone RP23-450P8 on chromosome 4, complete
              sequence
          Length = 169621

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 131428 tccccagccccagccccagcc 131448



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 132701 tccccagccccagccccagcc 132721



to top

>emb|AL596258.15| Mouse DNA sequence from clone RP23-226P4 on chromosome 11, complete
             sequence
          Length = 219037

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 84842 ccccagccccagccccagccg 84862



to top

>emb|AL772213.7| Mouse DNA sequence from clone RP23-104G16 on chromosome 2, complete
             sequence
          Length = 218975

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 40377 tccccagccccagccccagcc 40357



to top

>emb|AL589652.13| Mouse DNA sequence from clone RP23-369L6 on chromosome X, complete
             sequence
          Length = 199294

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 87442 ccccagccccagccccagcccagcc 87466



to top

>emb|AJ421481.1| Bos taurus X-inactivation center region, Jpx and Xist genes
          Length = 233345

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 118919 ccccagccccagccccagcccagcc 118943



 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 73     ccccagccccagccccagccgagcc 97
              |||||||||||||||||||| ||||
Sbjct: 119019 ccccagccccagccccagcccagcc 119043



to top

>emb|AL359087.17| Human DNA sequence from clone RP5-900A3, complete sequence
          Length = 109860

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 68    accatccccagccccagccccagcc 92
             |||| ||||||||||||||||||||
Sbjct: 20560 accagccccagccccagccccagcc 20536



to top

>gb|AC158595.25| Mus musculus 10 BAC RP24-216B14 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 231740

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 69    ccatccccagccccagcccca 89
             |||||||||||||||||||||
Sbjct: 65150 ccatccccagccccagcccca 65130



to top

>gb|AC117665.6| Mus musculus chromosome 8, clone RP23-360I9, complete sequence
          Length = 217058

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 72    tccccagccccagccccagcc 92
             |||||||||||||||||||||
Sbjct: 85870 tccccagccccagccccagcc 85890



to top

>dbj|AP000353.2| Homo sapiens genomic DNA, chromosome 22q11.2, IGLL region,
             clone:KB318B8
          Length = 123828

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 73    ccccagccccagccccagccgagcc 97
             |||||||||||||||||||| ||||
Sbjct: 43586 ccccagccccagccccagcccagcc 43562



to top

>gb|AF489555.1| Mus musculus chromosome 11 genomic sequence
          Length = 20539

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 73    ccccagccccagccccagccg 93
             |||||||||||||||||||||
Sbjct: 10387 ccccagccccagccccagccg 10367



to top

>emb|AL645484.14| Mouse DNA sequence from clone RP23-38A10 on chromosome 11, complete
              sequence
          Length = 161787

 Score = 42.1 bits (21), Expect = 4.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 72     tccccagccccagccccagcc 92
              |||||||||||||||||||||
Sbjct: 155101 tccccagccccagccccagcc 155121


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 168,471,425
Number of extensions: 8896079
Number of successful extensions: 199215
Number of sequences better than 10.0: 236
Number of HSP's gapped: 199023
Number of HSP's successfully gapped: 274
Length of query: 1048
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1025
Effective length of database: 18,503,978,556
Effective search space: 18966578019900
Effective search space used: 18966578019900
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top