ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf27i05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AP007285.1| Lotus japonicus genomic DNA, chromosome 2, clone... 46 0.090
2gb|AC171736.1| Solanum lycopersicum chromosome 11 clone C11HBa03... 46 0.090
3emb|AL109925.11|HSDJ534K7 Human DNA sequence from clone RP4-534K... 44 0.36
4emb|CR759896.12| Zebrafish DNA sequence from clone DKEY-192J17 i... 42 1.4
5gb|AC188104.1| Pongo pygmaeus abelii chromosome UNK clone CH276-... 42 1.4
6gb|CP000087.1| Rickettsia bellii RML369-C, complete genome 42 1.4
7ref|XM_642006.1| Dictyostelium discoideum AX4 hypothetical prote... 42 1.4
8ref|XM_637073.1| Dictyostelium discoideum AX4 hypothetical prote... 42 1.4
9ref|XM_635982.1| Dictyostelium discoideum AX4 hypothetical prote... 42 1.4
10ref|XM_630042.1| Dictyostelium discoideum AX4 hypothetical prote... 42 1.4
11ref|XM_631578.1| Dictyostelium discoideum AX4 hypothetical prote... 42 1.4
12gb|AY149028.1| Plasmodium chabaudi chabaudi strain AS clone YAC1... 42 1.4
13gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome 42 1.4
14emb|AL513013.12| Human DNA sequence from clone RP5-990P15 on chr... 42 1.4
15emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chrom... 42 1.4
16gb|AC083909.20|AC083909 Mus musculus 1 BAC RP23-424A2 (Roswell P... 42 1.4
17ref|XM_726258.1| Plasmodium yoelii yoelii str. 17XNL erythrocyte... 42 1.4
18ref|XM_720417.1| Plasmodium yoelii yoelii str. 17XNL mRNA cappin... 42 1.4
19ref|XM_737267.1| Plasmodium chabaudi chabaudi hypothetical prote... 42 1.4
20gb|AC188877.2| Phakopsora pachyrhizi clone JGIAFNA-349C8, comple... 40 5.5
21gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete s... 40 5.5
22gb|AC187730.2| Pan troglodytes BAC clone CH251-379I18 from chrom... 40 5.5
23dbj|AK225348.1| Homo sapiens mRNA for Serine/threonine-protein k... 40 5.5
24gb|AC186351.3| Gallus gallus BAC clone CH261-136O19 from chromos... 40 5.5
25emb|CT010579.12| Mouse DNA sequence from clone RP23-397K12 on ch... 40 5.5
26ref|XM_633088.1| Dictyostelium discoideum AX4 hypothetical prote... 40 5.5
27ref|XM_642728.1| Dictyostelium discoideum AX4 hypothetical prote... 40 5.5
28ref|XM_635423.1| Dictyostelium discoideum AX4 hypothetical prote... 40 5.5
29gb|AC159425.1| Trypanosoma brucei chromosome 3 clone RPCI93-27F1... 40 5.5
30gb|BC000953.2| Homo sapiens RIO kinase 2 (yeast), mRNA (cDNA clo... 40 5.5
31gb|AC147020.2| Mus musculus BAC clone RP23-267A11 from chromosom... 40 5.5
32gb|AC121328.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.5
33gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosom... 40 5.5
34gb|AC125398.4| Mus musculus BAC clone RP24-217G23 from chromosom... 40 5.5
35gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence 40 5.5
36gb|AC073042.7| Homo sapiens BAC clone CTD-2105K18 from 7, comple... 40 5.5
37ref|NM_018343.1| Homo sapiens RIO kinase 2 (yeast) (RIOK2), mRNA... 40 5.5
38dbj|AK001697.1| Homo sapiens cDNA FLJ10835 fis, clone NT2RP4001210 40 5.5
39dbj|AK142012.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN ... 40 5.5
40gb|AC095033.2| Homo sapiens chromosome 1 clone RP11-313A24, comp... 40 5.5
41gb|AC103784.2| Homo sapiens chromosome 8, clone RP11-715C17, com... 40 5.5
42dbj|AK085918.1| Mus musculus 16 days neonate heart cDNA, RIKEN f... 40 5.5
43dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.5
44gb|AC090771.4| Homo sapiens chromosome 18, clone RP11-795H16, co... 40 5.5
45gb|AC022679.9| Homo sapiens chromosome 8, clone RP11-386G21, com... 40 5.5
46gb|AC084834.4| Homo sapiens chromosome 8, clone RP11-107M13, com... 40 5.5
47gb|AC008883.6| Homo sapiens chromosome 5 clone CTD-2215E18, comp... 40 5.5
48emb|Z82182.2|HSE90C2 Human DNA sequence from clone LL22NC01-90C2... 40 5.5
49emb|AL356413.11| Human DNA sequence from clone RP11-498F10 on ch... 40 5.5
50gb|AC090621.10| Homo sapiens chromosome 18, clone RP11-396N11, c... 40 5.5
51ref|XM_650783.1| Entamoeba histolytica HM-1:IMSS bromodomain pro... 40 5.5
52emb|X05035.1|PPEGLOG Orangutan epsilon-globin gene with Alu repe... 40 5.5
53gb|AY335641.1| Synthetic construct Homo sapiens hypothetical pro... 40 5.5
54gb|AC010842.5|AC010842 Drosophila melanogaster, chromosome 2R, r... 40 5.5
55gb|AC064829.6|AC064829 Homo sapiens BAC clone RP11-375P13 from Y... 40 5.5
56emb|AL591410.8| Mouse DNA sequence from clone RP23-96I2 on chrom... 40 5.5
57gb|AC009182.4|AC009182 Drosophila melanogaster, chromosome 2R, r... 40 5.5
58gb|AC023842.5|AC023842 Homo sapiens chromosome 8, clone RP11-374... 40 5.5
59gb|AC154289.1| Mus musculus BAC clone RP23-449E11 from chromosom... 40 5.5
60gb|AF283103.1|AF283103 Pineapple mealybug wilt associated virus-... 40 5.5
61gb|AC012494.8| Homo sapiens BAC clone RP11-312P13 from 2, comple... 40 5.5
62emb|CR622281.1| full-length cDNA clone CS0DH006YG19 of T cells (... 40 5.5
63emb|CR610601.1| full-length cDNA clone CS0DC026YF19 of Neuroblas... 40 5.5
64gb|AC084424.1|CBRG01B1 Caenorhabditis briggsae cosmid G01B1, com... 40 5.5
65gb|AC005484.2|AC005484 Homo sapiens PAC clone RP5-847O8 from 14q... 40 5.5
66gb|AC008905.6|AC008905 Homo sapiens chromosome 5 clone CTD-2259I... 40 5.5
67gb|AC008865.3|AC008865 Homo sapiens chromosome 5 clone CTD-2193I... 40 5.5
68emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chr... 40 5.5
69emb|AL132860.1| Caenorhabditis elegans YAC Y56A3A, complete sequ... 40 5.5
70emb|AL033514.1|CEY75B8A Caenorhabditis elegans YAC Y75B8A, compl... 40 5.5
71gb|AC000112.1|HSAC000112 Human PAC clone DJ149P21, complete sequ... 40 5.5
72emb|AL805923.6| Mouse DNA sequence from clone RP23-65B16 on chro... 40 5.5
73emb|AL671871.4| Mouse DNA sequence from clone RP23-157M14 on chr... 40 5.5 
>dbj|AP007285.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT01H08, TM0053,
             complete sequence
          Length = 109326
 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 79    tttgtacaaatatactcatttaa 101
             |||||||||||||||||||||||
Sbjct: 13137 tttgtacaaatatactcatttaa 13115
to top
>gb|AC171736.1| Solanum lycopersicum chromosome 11 clone C11HBa0323E19, complete sequence
          Length = 141216

 Score = 46.1 bits (23), Expect = 0.090
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 116    ggagagattagccttgaacaaaa 138
              |||||||||||||||||||||||
Sbjct: 128202 ggagagattagccttgaacaaaa 128224
to top
>emb|AL109925.11|HSDJ534K7 Human DNA sequence from clone RP4-534K7 on chromosome 1p31.2-32.3
             Contains the 3' end of gene KIAA1799, the gene for a novel
             protein similar to deleted in lymphocytic leukemia 2
             (DLEU2), the 5' end of a variant of the ITGB3BP gene for
             integrin beta 3 binding protein (beta3-endonexin) and the
             PGM1 gene for phosphoglucomutase 1, complete sequence
          Length = 152583

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 86    aaatatactcatttaattctca 107
             ||||||||||||||||||||||
Sbjct: 22766 aaatatactcatttaattctca 22745
to top
>emb|CR759896.12| Zebrafish DNA sequence from clone DKEY-192J17 in linkage group 24,
              complete sequence
          Length = 140575

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 340    atttatataaaatcgttgaaaatta 364
              |||||||||||||||||||| ||||
Sbjct: 133007 atttatataaaatcgttgaagatta 133031
to top
>gb|AC188104.1| Pongo pygmaeus abelii chromosome UNK clone CH276-50H12, complete
             sequence
          Length = 200191

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 88    atatactcatttaattctcac 108
             |||||||||||||||||||||
Sbjct: 28339 atatactcatttaattctcac 28359
to top
>gb|CP000087.1| Rickettsia bellii RML369-C, complete genome
          Length = 1522076

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 346     ataaaatcgttgaaaattatc 366
               |||||||||||||||||||||
Sbjct: 1277995 ataaaatcgttgaaaattatc 1278015
to top
>ref|XM_642006.1| Dictyostelium discoideum AX4 hypothetical protein
           (DDBDRAFT_0189343) mRNA, complete cds
          Length = 1128

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 268 gaaaatgaaaatgaaagtgaa 288
           |||||||||||||||||||||
Sbjct: 802 gaaaatgaaaatgaaagtgaa 822
to top
>ref|XM_637073.1| Dictyostelium discoideum AX4 hypothetical protein
           (DDBDRAFT_0218063) mRNA, complete cds
          Length = 1941

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 268 gaaaatgaaaatgaaagtgaa 288
           |||||||||||||||||||||
Sbjct: 208 gaaaatgaaaatgaaagtgaa 228
to top
>ref|XM_635982.1| Dictyostelium discoideum AX4 hypothetical protein
           (DDBDRAFT_0206068) mRNA, complete cds
          Length = 3048

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 268 gaaaatgaaaatgaaagtgaa 288
           |||||||||||||||||||||
Sbjct: 682 gaaaatgaaaatgaaagtgaa 702



 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 aaaatgaaaatgaaagtgaa 288
           ||||||||||||||||||||
Sbjct: 719 aaaatgaaaatgaaagtgaa 738
to top
>ref|XM_630042.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0183813)
            mRNA, complete cds
          Length = 4926

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 268  gaaaatgaaaatgaaagtgaa 288
            |||||||||||||||||||||
Sbjct: 1669 gaaaatgaaaatgaaagtgaa 1689
to top
>ref|XM_631578.1| Dictyostelium discoideum AX4 hypothetical protein
           (DDBDRAFT_0187987) mRNA, complete cds
          Length = 1038

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 268 gaaaatgaaaatgaaagtgaa 288
           |||||||||||||||||||||
Sbjct: 241 gaaaatgaaaatgaaagtgaa 261
to top
>gb|AY149028.1| Plasmodium chabaudi chabaudi strain AS clone YAC101, complete
            sequence
          Length = 80019

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 268  gaaaatgaaaatgaaagtgaa 288
            |||||||||||||||||||||
Sbjct: 2297 gaaaatgaaaatgaaagtgaa 2317
to top
>gb|CP000095.1| Prochlorococcus marinus str. NATL2A, complete genome
          Length = 1842899

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 173     gtttctcaatggaatgaagat 193
               |||||||||||||||||||||
Sbjct: 1577585 gtttctcaatggaatgaagat 1577605
to top
>emb|AL513013.12| Human DNA sequence from clone RP5-990P15 on chromosome 1 Contains the
             5' end of a novel gene, a novel gene (DKFZp564J047), two
             novel genes and a CpG island, complete sequence
          Length = 77001

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 88    atatactcatttaattctcac 108
             |||||||||||||||||||||
Sbjct: 34341 atatactcatttaattctcac 34321
to top
>emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chromosome 9; segment 4/5
          Length = 254050

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 268   gaaaatgaaaatgaaagtgaa 288
             |||||||||||||||||||||
Sbjct: 80923 gaaaatgaaaatgaaagtgaa 80943
to top
>gb|AC083909.20|AC083909 Mus musculus 1 BAC RP23-424A2 (Roswell Park Cancer Institute Mouse BAC
              Library) complete sequence
          Length = 204857

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 255    ggaaagacgagacgaaaatgaaaatgaaa 283
              ||||||| |||| ||||||||||||||||
Sbjct: 153659 ggaaagaagagaagaaaatgaaaatgaaa 153631
to top
>ref|XM_726258.1| Plasmodium yoelii yoelii str. 17XNL erythrocyte membrane-associated
            giant protein antigen 332 (PY03350) partial mRNA
          Length = 10215

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 268  gaaaatgaaaatgaaagtgaa 288
            |||||||||||||||||||||
Sbjct: 6631 gaaaatgaaaatgaaagtgaa 6651
to top
>ref|XM_720417.1| Plasmodium yoelii yoelii str. 17XNL mRNA capping enzyme (PY05095)
           partial mRNA
          Length = 1338

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 268 gaaaatgaaaatgaaagtgaa 288
           |||||||||||||||||||||
Sbjct: 703 gaaaatgaaaatgaaagtgaa 723
to top
>ref|XM_737267.1| Plasmodium chabaudi chabaudi hypothetical protein (PC402403.00.0)
           partial mRNA
          Length = 654

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 268 gaaaatgaaaatgaaagtgaa 288
           |||||||||||||||||||||
Sbjct: 469 gaaaatgaaaatgaaagtgaa 489
to top
>gb|AC188877.2| Phakopsora pachyrhizi clone JGIAFNA-349C8, complete sequence
          Length = 36106

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   aaaatgaaaatgaaagtgaa 288
             ||||||||||||||||||||
Sbjct: 24840 aaaatgaaaatgaaagtgaa 24859
to top
>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence
          Length = 21146708

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 269      aaaatgaaaatgaaagtgaa 288
                ||||||||||||||||||||
Sbjct: 19683124 aaaatgaaaatgaaagtgaa 19683143
to top
>gb|AC187730.2| Pan troglodytes BAC clone CH251-379I18 from chromosome 7, complete
              sequence
          Length = 146113

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 297    taatggtgagagactaaaaa 316
              ||||||||||||||||||||
Sbjct: 138293 taatggtgagagactaaaaa 138312
to top
>dbj|AK225348.1| Homo sapiens mRNA for Serine/threonine-protein kinase RIO2 variant,
            clone: HEP13058
          Length = 2161

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  gaaaatgaaagtgaacggaa 293
            ||||||||||||||||||||
Sbjct: 1082 gaaaatgaaagtgaacggaa 1101
to top
>gb|AC186351.3| Gallus gallus BAC clone CH261-136O19 from chromosome z, complete
             sequence
          Length = 163961

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   gaaaatgaaaatgaaagtga 287
             ||||||||||||||||||||
Sbjct: 71237 gaaaatgaaaatgaaagtga 71218
to top
>emb|CT010579.12| Mouse DNA sequence from clone RP23-397K12 on chromosome 14, complete
             sequence
          Length = 115130

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    tacaaatatactcatttaat 102
             ||||||||||||||||||||
Sbjct: 17185 tacaaatatactcatttaat 17166
to top
>ref|XM_633088.1| Dictyostelium discoideum AX4 hypothetical protein
           (DDBDRAFT_0186624) mRNA, complete cds
          Length = 3117

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 269 aaaatgaaaatgaaagtgaa 288
           ||||||||||||||||||||
Sbjct: 338 aaaatgaaaatgaaagtgaa 357
to top
>ref|XM_642728.1| Dictyostelium discoideum AX4 hypothetical protein
           (DDBDRAFT_0206282) mRNA, complete cds
          Length = 1965

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 265 gacgaaaatgaaaatgaaagtgaa 288
           ||||||||||||||||||| ||||
Sbjct: 304 gacgaaaatgaaaatgaaaatgaa 327
to top
>ref|XM_635423.1| Dictyostelium discoideum AX4 hypothetical protein
           (DDBDRAFT_0204541) mRNA, complete cds
          Length = 4887

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 265 gacgaaaatgaaaatgaaagtgaa 288
           ||||||||||||||||||| ||||
Sbjct: 637 gacgaaaatgaaaatgaaaatgaa 660
to top
>gb|AC159425.1| Trypanosoma brucei chromosome 3 clone RPCI93-27F10, complete sequence
          Length = 135196

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 269   aaaatgaaaatgaaagtgaa 288
             ||||||||||||||||||||
Sbjct: 35486 aaaatgaaaatgaaagtgaa 35467
to top
>gb|BC000953.2| Homo sapiens RIO kinase 2 (yeast), mRNA (cDNA clone MGC:4923
            IMAGE:3449997), complete cds
          Length = 1844

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  gaaaatgaaagtgaacggaa 293
            ||||||||||||||||||||
Sbjct: 1089 gaaaatgaaagtgaacggaa 1108
to top
>gb|AC147020.2| Mus musculus BAC clone RP23-267A11 from chromosome 18, complete
             sequence
          Length = 204727

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   ttttctggctacgtttctca 180
             ||||||||||||||||||||
Sbjct: 45696 ttttctggctacgtttctca 45715
to top
>gb|AC121328.3| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBb0030E22, complete sequence
          Length = 135468

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 307   agactaaaaaattgtattatatca 330
             ||||||||||||| ||||||||||
Sbjct: 24693 agactaaaaaattctattatatca 24670
to top
>gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosome 10, complete sequence
          Length = 181828

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 306    gagactaaaaaattgtatta 325
              ||||||||||||||||||||
Sbjct: 132389 gagactaaaaaattgtatta 132408
to top
>gb|AC125398.4| Mus musculus BAC clone RP24-217G23 from chromosome 18, complete
             sequence
          Length = 166948

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   ttttctggctacgtttctca 180
             ||||||||||||||||||||
Sbjct: 17384 ttttctggctacgtttctca 17365
to top
>gb|AC145338.7| Pan troglodytes clone rp43-47g15, complete sequence
          Length = 202653

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    tatactcatttaattctcac 108
             ||||||||||||||||||||
Sbjct: 29927 tatactcatttaattctcac 29908
to top
>gb|AC073042.7| Homo sapiens BAC clone CTD-2105K18 from 7, complete sequence
          Length = 182038

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 297   taatggtgagagactaaaaa 316
             ||||||||||||||||||||
Sbjct: 65009 taatggtgagagactaaaaa 65028
to top
>ref|NM_018343.1| Homo sapiens RIO kinase 2 (yeast) (RIOK2), mRNA
 dbj|AK002021.1| Homo sapiens cDNA FLJ11159 fis, clone PLACE1006966
          Length = 1832

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  gaaaatgaaagtgaacggaa 293
            ||||||||||||||||||||
Sbjct: 1100 gaaaatgaaagtgaacggaa 1119
to top
>dbj|AK001697.1| Homo sapiens cDNA FLJ10835 fis, clone NT2RP4001210
          Length = 2940

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 274 gaaaatgaaagtgaacggaa 293
           ||||||||||||||||||||
Sbjct: 138 gaaaatgaaagtgaacggaa 157
to top
>dbj|AK142012.1| Mus musculus 12 days embryo eyeball cDNA, RIKEN full-length enriched
            library, clone:D230002O22 product:unclassifiable, full
            insert sequence
          Length = 2247

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 160  gttttctggctacgtttctc 179
            ||||||||||||||||||||
Sbjct: 1713 gttttctggctacgtttctc 1732
to top
>gb|AC095033.2| Homo sapiens chromosome 1 clone RP11-313A24, complete sequence
          Length = 157332

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   agaacgtcactgtgaacaaa 157
             ||||||||||||||||||||
Sbjct: 46399 agaacgtcactgtgaacaaa 46380
to top
>gb|AC103784.2| Homo sapiens chromosome 8, clone RP11-715C17, complete sequence
          Length = 175745

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     cctgaaaaatggcagagtgt 48
              ||||||||||||||||||||
Sbjct: 141887 cctgaaaaatggcagagtgt 141906
to top
>dbj|AK085918.1| Mus musculus 16 days neonate heart cDNA, RIKEN full-length enriched
           library, clone:D830028N22 product:unclassifiable, full
           insert sequence
          Length = 3246

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 83  tacaaatatactcatttaat 102
           ||||||||||||||||||||
Sbjct: 195 tacaaatatactcatttaat 176
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 307      agactaaaaaattgtattatatca 330
                ||||||||||||| ||||||||||
Sbjct: 22467548 agactaaaaaattctattatatca 22467525
to top
>gb|AC090771.4| Homo sapiens chromosome 18, clone RP11-795H16, complete sequence
          Length = 186031

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    acaaatatactcatttaattctca 107
             ||||||||||||||| ||||||||
Sbjct: 98700 acaaatatactcattgaattctca 98677
to top
>gb|AC022679.9| Homo sapiens chromosome 8, clone RP11-386G21, complete sequence
          Length = 160766

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 178    tcaatggaatgaagattcttttga 201
              ||||| ||||||||||||||||||
Sbjct: 124260 tcaattgaatgaagattcttttga 124237
to top
>gb|AC084834.4| Homo sapiens chromosome 8, clone RP11-107M13, complete sequence
          Length = 153304

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 178    tcaatggaatgaagattcttttga 201
              ||||| ||||||||||||||||||
Sbjct: 134181 tcaattgaatgaagattcttttga 134204
to top
>gb|AC008883.6| Homo sapiens chromosome 5 clone CTD-2215E18, complete sequence
          Length = 127144

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 274  gaaaatgaaagtgaacggaa 293
            ||||||||||||||||||||
Sbjct: 8087 gaaaatgaaagtgaacggaa 8068
to top
>emb|Z82182.2|HSE90C2 Human DNA sequence from clone LL22NC01-90C2 on chromosome 22 Contains
             an STSs and GSSs, complete sequence
          Length = 39004

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 89    tatactcatttaattctcac 108
             ||||||||||||||||||||
Sbjct: 26583 tatactcatttaattctcac 26564
to top
>emb|AL356413.11| Human DNA sequence from clone RP11-498F10 on chromosome 13, complete
              sequence
          Length = 146278

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 268    gaaaatgaaaatgaaagtgaacgg 291
              |||||||||||||||| |||||||
Sbjct: 105417 gaaaatgaaaatgaaattgaacgg 105440
to top
>gb|AC090621.10| Homo sapiens chromosome 18, clone RP11-396N11, complete sequence
          Length = 188858

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 84     acaaatatactcatttaattctca 107
              ||||||||||||||| ||||||||
Sbjct: 175347 acaaatatactcattgaattctca 175370
to top
>ref|XM_650783.1| Entamoeba histolytica HM-1:IMSS bromodomain protein (21.t00055)
           partial mRNA
          Length = 798

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 342 ttatataaaatcgttgaaaattat 365
           |||||||||||| |||||||||||
Sbjct: 463 ttatataaaatctttgaaaattat 486
to top
>emb|X05035.1|PPEGLOG Orangutan epsilon-globin gene with Alu repeats in flanking regions
          Length = 4995

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 312 aaaaaattgtattatatcaaggaatgtt 339
           ||||||||||||||| ||||||| ||||
Sbjct: 277 aaaaaattgtattatctcaaggactgtt 304
to top
>gb|AY335641.1| Synthetic construct Homo sapiens hypothetical protein FLJ11159
            (FLJ11159) mRNA, partial cds
          Length = 1659

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  gaaaatgaaagtgaacggaa 293
            ||||||||||||||||||||
Sbjct: 1051 gaaaatgaaagtgaacggaa 1070
to top
>gb|AC010842.5|AC010842 Drosophila melanogaster, chromosome 2R, region 59F5-59F8, BAC clone
              BACR02E09, complete sequence
          Length = 175118

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 269    aaaatgaaaatgaaagtgaa 288
              ||||||||||||||||||||
Sbjct: 139192 aaaatgaaaatgaaagtgaa 139211
to top
>gb|AC064829.6|AC064829 Homo sapiens BAC clone RP11-375P13 from Y, complete sequence
          Length = 89684

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 298   aatggtgagagactaaaaaa 317
             ||||||||||||||||||||
Sbjct: 26658 aatggtgagagactaaaaaa 26639
to top
>emb|AL591410.8| Mouse DNA sequence from clone RP23-96I2 on chromosome 11 Contains part of
              the Myo1d gene for myosin ID, complete sequence
          Length = 231675

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 210    ttttgtggtgctttaggaaa 229
              ||||||||||||||||||||
Sbjct: 175425 ttttgtggtgctttaggaaa 175406
to top
>gb|AC009182.4|AC009182 Drosophila melanogaster, chromosome 2R, region 60A2-60A3, BAC clone
             BACR05F24, complete sequence
          Length = 147086

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 269   aaaatgaaaatgaaagtgaa 288
             ||||||||||||||||||||
Sbjct: 20305 aaaatgaaaatgaaagtgaa 20324
to top
>gb|AC023842.5|AC023842 Homo sapiens chromosome 8, clone RP11-374M4, complete sequence
          Length = 187351

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 29     cctgaaaaatggcagagtgt 48
              ||||||||||||||||||||
Sbjct: 177044 cctgaaaaatggcagagtgt 177025
to top
>gb|AC154289.1| Mus musculus BAC clone RP23-449E11 from chromosome 16, complete sequence
          Length = 191617

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 303    tgagagactaaaaaattgta 322
              ||||||||||||||||||||
Sbjct: 127921 tgagagactaaaaaattgta 127902
to top
>gb|AF283103.1|AF283103 Pineapple mealybug wilt associated virus-2 polyprotein (ORF1a) and
            RNA-dependent RNA polymerase genes, partial cds; and
            hydrophobic protein p5, heat shock protein 70, p46, coat
            protein, diverged coat protein, p20, p22, and p6 genes,
            complete cds
          Length = 14861

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 346  ataaaatcgttgaaaattat 365
            ||||||||||||||||||||
Sbjct: 9517 ataaaatcgttgaaaattat 9536
to top
>gb|AC012494.8| Homo sapiens BAC clone RP11-312P13 from 2, complete sequence
          Length = 191122

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    tattatatcaaggaatgtta 340
              ||||||||||||||||||||
Sbjct: 138598 tattatatcaaggaatgtta 138579
to top
>emb|CR622281.1| full-length cDNA clone CS0DH006YG19 of T cells (Jurkat cell line) of
            Homo sapiens (human)
          Length = 1781

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  gaaaatgaaagtgaacggaa 293
            ||||||||||||||||||||
Sbjct: 1086 gaaaatgaaagtgaacggaa 1105
to top
>emb|CR610601.1| full-length cDNA clone CS0DC026YF19 of Neuroblastoma Cot
            25-normalized of Homo sapiens (human)
          Length = 1826

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 274  gaaaatgaaagtgaacggaa 293
            ||||||||||||||||||||
Sbjct: 1120 gaaaatgaaagtgaacggaa 1139
to top
>gb|AC084424.1|CBRG01B1 Caenorhabditis briggsae cosmid G01B1, complete sequence
          Length = 42042

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 260   gacgagacgaaaatgaaaat 279
             ||||||||||||||||||||
Sbjct: 32956 gacgagacgaaaatgaaaat 32975
to top
>gb|AC005484.2|AC005484 Homo sapiens PAC clone RP5-847O8 from 14q24.3, complete sequence
          Length = 131943

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 89   tatactcatttaattctcac 108
            ||||||||||||||||||||
Sbjct: 8998 tatactcatttaattctcac 8979
to top
>gb|AC008905.6|AC008905 Homo sapiens chromosome 5 clone CTD-2259I14, complete sequence
          Length = 129430

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 274    gaaaatgaaagtgaacggaa 293
              ||||||||||||||||||||
Sbjct: 127054 gaaaatgaaagtgaacggaa 127035
to top
>gb|AC008865.3|AC008865 Homo sapiens chromosome 5 clone CTD-2193I10, complete sequence
          Length = 191162

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 274    gaaaatgaaagtgaacggaa 293
              ||||||||||||||||||||
Sbjct: 181728 gaaaatgaaagtgaacggaa 181709
to top
>emb|AL731729.10| Mouse DNA sequence from clone RP23-92L12 on chromosome X, complete
             sequence
          Length = 216656

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   gagattagccttgaacaaaa 138
             ||||||||||||||||||||
Sbjct: 47242 gagattagccttgaacaaaa 47223
to top
>emb|AL132860.1| Caenorhabditis elegans YAC Y56A3A, complete sequence
          Length = 169364

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 347    taaaatcgttgaaaattatc 366
              ||||||||||||||||||||
Sbjct: 132582 taaaatcgttgaaaattatc 132601
to top
>emb|AL033514.1|CEY75B8A Caenorhabditis elegans YAC Y75B8A, complete sequence
          Length = 298406

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 347    taaaatcgttgaaaattatc 366
              ||||||||||||||||||||
Sbjct: 142382 taaaatcgttgaaaattatc 142401
to top
>gb|AC000112.1|HSAC000112 Human PAC clone DJ149P21, complete sequence
          Length = 111118

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 29     cctgaaaaatggcagagtgt 48
              ||||||||||||||||||||
Sbjct: 108657 cctgaaaaatggcagagtgt 108638
to top
>emb|AL805923.6| Mouse DNA sequence from clone RP23-65B16 on chromosome 4, complete
              sequence
          Length = 182774

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 269    aaaatgaaaatgaaagtgaa 288
              ||||||||||||||||||||
Sbjct: 166865 aaaatgaaaatgaaagtgaa 166884
to top
>emb|AL671871.4| Mouse DNA sequence from clone RP23-157M14 on chromosome 4, complete
              sequence
          Length = 199593

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 160    gttttctggctacgtttctc 179
              ||||||||||||||||||||
Sbjct: 115444 gttttctggctacgtttctc 115425


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 88,543,703
Number of extensions: 4953705
Number of successful extensions: 392440
Number of sequences better than 10.0: 73
Number of HSP's gapped: 392440
Number of HSP's successfully gapped: 74
Length of query: 385
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 363
Effective length of database: 18,508,616,841
Effective search space: 6718627913283
Effective search space used: 6718627913283
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
to top