ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf19k02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 42 3.2
2ref|XM_869149.1| PREDICTED: Bos taurus similar to Choline transp... 42 3.2
3ref|XM_598872.2| PREDICTED: Bos taurus similar to Choline transp... 42 3.2
4gb|AC125025.7| Mus musculus chromosome 5, clone RP24-340K5, comp... 42 3.2
5gb|AC165316.4| Mus musculus chromosome 5, clone RP23-168G13, com... 42 3.2
6ref|XM_538839.2| PREDICTED: Canis familiaris similar to NG22 pro... 42 3.2
7gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome... 42 3.2
8gb|AC127371.3| Mus musculus BAC clone RP23-35D4 from 15, complet... 42 3.2
9emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on ch... 42 3.2
10emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on c... 42 3.2
11emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chr... 42 3.2
12emb|AL139398.20| Human DNA sequence from clone RP11-528B10 on ch... 42 3.2
13gb|AC016776.6| Homo sapiens BAC clone RP11-574K22 from 2, comple... 42 3.2
14emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chr... 42 3.2
15emb|AL833009.1|HSM804320 Homo sapiens mRNA; cDNA DKFZp666M124 (f... 42 3.2
16gb|AC134793.10| Mus musculus chromosome 15, clone RP23-159M8, co... 42 3.2
17emb|AL158059.3|CNS01RGK Human chromosome 14 DNA sequence BAC C-2... 42 3.2

>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome
          Length = 3928089
 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 335    gccgcggccagatccatcctg 355
              |||||||||||||||||||||
Sbjct: 850972 gccgcggccagatccatcctg 850992



to top

>ref|XM_869149.1| PREDICTED: Bos taurus similar to Choline transporter-like protein 4,
            transcript variant 2 (LOC520625), mRNA
          Length = 2287

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 451  ggaagatgagcatcagcagca 471
            |||||||||||||||||||||
Sbjct: 1038 ggaagatgagcatcagcagca 1018



to top

>ref|XM_598872.2| PREDICTED: Bos taurus similar to Choline transporter-like protein 4,
            transcript variant 1 (LOC520625), mRNA
          Length = 2287

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 451  ggaagatgagcatcagcagca 471
            |||||||||||||||||||||
Sbjct: 1038 ggaagatgagcatcagcagca 1018



to top

>gb|AC125025.7| Mus musculus chromosome 5, clone RP24-340K5, complete sequence
          Length = 175313

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 559    aattttgagttggccccttta 579
              |||||||||||||||||||||
Sbjct: 110153 aattttgagttggccccttta 110133



to top

>gb|AC165316.4| Mus musculus chromosome 5, clone RP23-168G13, complete sequence
          Length = 205237

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 559    aattttgagttggccccttta 579
              |||||||||||||||||||||
Sbjct: 191945 aattttgagttggccccttta 191925



to top

>ref|XM_538839.2| PREDICTED: Canis familiaris similar to NG22 protein isoform 2
           (LOC481718), mRNA
          Length = 2136

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 451 ggaagatgagcatcagcagca 471
           |||||||||||||||||||||
Sbjct: 982 ggaagatgagcatcagcagca 962



to top

>gb|AC122405.4| Mus musculus BAC clone RP24-119O6 from chromosome 12, complete sequence
          Length = 196285

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 527    ttatatctgaaaaatgagtta 547
              |||||||||||||||||||||
Sbjct: 114526 ttatatctgaaaaatgagtta 114546



to top

>gb|AC127371.3| Mus musculus BAC clone RP23-35D4 from 15, complete sequence
          Length = 210688

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 506    tacaatggaaaacaagcaagc 526
              |||||||||||||||||||||
Sbjct: 175399 tacaatggaaaacaagcaagc 175379



to top

>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the
             NEU1 gene for sialidase 1 (lysosomal sialidase), the
             C6orf29 gene for chromosome 6 open reading frame 29, the
             BAT8 gene for HLA-B associated transcript 8, a novel
             transcript DAQB-331I12.5, the ZBTB12 gene (previously
             C6orf46) for zinc finger and BTB domain containing 12, the
             C2 gene for complement component 2, the Bf gene for
             B-factor, properdin, the RDBP gene for RD RNA binding
             protein, the SKIV2L gene for superkiller viralicidic
             activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3
             homolog Z (C. elegans), the STK19 gene for
             serine/threonine kinase 19, the 5' end of the C4A gene for
             complement component 4A and 8 CpG isalnds, complete
             sequence
          Length = 153464

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 451   ggaagatgagcatcagcagca 471
             |||||||||||||||||||||
Sbjct: 24775 ggaagatgagcatcagcagca 24795



to top

>emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on chromosome 6 contains the
             5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
             gene for  chromosome 6 open reading frame 28, the HSPA1L
             gene for heat shock 70kDa protein 1-like, the HSPA1A gene
             for heat shock 70kDa protein 1A, the HSPA1B gene for heat
             shock 70kDa protein 1B, the gene for chromosome 6 open
             reading frame 48, the NEU1 gene for sialidase 1 (lysosomal
             sialidase), the gene forchromosome 6 open reading frame
             29, the gene for  HLA-B associated transcript 8, the gene
             for chromosome 6 open reading frame 46 and eight CpG
             islands, complete sequence
          Length = 113582

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 451   ggaagatgagcatcagcagca 471
             |||||||||||||||||||||
Sbjct: 78500 ggaagatgagcatcagcagca 78520



to top

>emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chromosome 6 contains the
              MSH5 gene for mutS homolog 5 (e. coli), the gene for NG23
              protein, the gene for chromosome 6 open reading frame 27,
              the VARS2 gene for valyl-tRNA synthetase 2, the gene for
              chromosome 6 open reading frame 28, the HSPA1L gene for
              heat shock 70kDa protein 1-like, the HSPA1A gene for heat
              shock 70kDa protein 1A, the HSPA1B gene for heat shock
              70kDa protein 1B, the gene for chromosome 6 open reading
              frame 48, the NEU1 gene for sialidase 1 (lysosomal
              sialidase), the gene for chromosome 6 open reading frame
              29, the BAT8 gene for HLA-B associated transcript 8, the
              gene for chromosome 6 open reading frame 46 and nine CpG
              islands, complete sequence
          Length = 179894

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 451    ggaagatgagcatcagcagca 471
              |||||||||||||||||||||
Sbjct: 134711 ggaagatgagcatcagcagca 134731



to top

>emb|AL139398.20| Human DNA sequence from clone RP11-528B10 on chromosome Xp11.21-11.23,
              complete sequence
          Length = 125999

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 285    ccagagctcccacctcccttc 305
              |||||||||||||||||||||
Sbjct: 115348 ccagagctcccacctcccttc 115368



to top

>gb|AC016776.6| Homo sapiens BAC clone RP11-574K22 from 2, complete sequence
          Length = 197425

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 289   agctcccacctcccttctcctcgcc 313
             |||||||||||||| ||||||||||
Sbjct: 23307 agctcccacctcccgtctcctcgcc 23283



to top

>emb|CR388202.9| Human DNA sequence from clone DADB-333F21 on chromosome 6, complete
             sequence
          Length = 80364

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 451   ggaagatgagcatcagcagca 471
             |||||||||||||||||||||
Sbjct: 63732 ggaagatgagcatcagcagca 63752



to top

>emb|AL833009.1|HSM804320 Homo sapiens mRNA; cDNA DKFZp666M124 (from clone DKFZp666M124)
          Length = 2333

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 451 ggaagatgagcatcagcagca 471
           |||||||||||||||||||||
Sbjct: 747 ggaagatgagcatcagcagca 727



to top

>gb|AC134793.10| Mus musculus chromosome 15, clone RP23-159M8, complete sequence
          Length = 216860

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 506    tacaatggaaaacaagcaagc 526
              |||||||||||||||||||||
Sbjct: 188781 tacaatggaaaacaagcaagc 188801



to top

>emb|AL158059.3|CNS01RGK Human chromosome 14 DNA sequence BAC C-2007A10 of library CalTech-D from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 148515

 Score = 42.1 bits (21), Expect = 3.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 527    ttatatctgaaaaatgagtta 547
              |||||||||||||||||||||
Sbjct: 100524 ttatatctgaaaaatgagtta 100544


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 152,372,335
Number of extensions: 8269896
Number of successful extensions: 163531
Number of sequences better than 10.0: 17
Number of HSP's gapped: 163531
Number of HSP's successfully gapped: 17
Length of query: 853
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 831
Effective length of database: 18,508,616,841
Effective search space: 15380660594871
Effective search space used: 15380660594871
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top