>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the
NEU1 gene for sialidase 1 (lysosomal sialidase), the
C6orf29 gene for chromosome 6 open reading frame 29, the
BAT8 gene for HLA-B associated transcript 8, a novel
transcript DAQB-331I12.5, the ZBTB12 gene (previously
C6orf46) for zinc finger and BTB domain containing 12, the
C2 gene for complement component 2, the Bf gene for
B-factor, properdin, the RDBP gene for RD RNA binding
protein, the SKIV2L gene for superkiller viralicidic
activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3
homolog Z (C. elegans), the STK19 gene for
serine/threonine kinase 19, the 5' end of the C4A gene for
complement component 4A and 8 CpG isalnds, complete
sequence
Length = 153464
Score = 42.1 bits (21), Expect = 3.2
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 451 ggaagatgagcatcagcagca 471
|||||||||||||||||||||
Sbjct: 24775 ggaagatgagcatcagcagca 24795
>emb|AL671762.10| Human DNA sequence from clone XXbac-254B15 on chromosome 6 contains the
5' end of the VARS2 gene for valyl-tRNA synthetase 2, the
gene for chromosome 6 open reading frame 28, the HSPA1L
gene for heat shock 70kDa protein 1-like, the HSPA1A gene
for heat shock 70kDa protein 1A, the HSPA1B gene for heat
shock 70kDa protein 1B, the gene for chromosome 6 open
reading frame 48, the NEU1 gene for sialidase 1 (lysosomal
sialidase), the gene forchromosome 6 open reading frame
29, the gene for HLA-B associated transcript 8, the gene
for chromosome 6 open reading frame 46 and eight CpG
islands, complete sequence
Length = 113582
Score = 42.1 bits (21), Expect = 3.2
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 451 ggaagatgagcatcagcagca 471
|||||||||||||||||||||
Sbjct: 78500 ggaagatgagcatcagcagca 78520
>emb|AL662834.8| Human DNA sequence from clone XXbac-40G17 on chromosome 6 contains the
MSH5 gene for mutS homolog 5 (e. coli), the gene for NG23
protein, the gene for chromosome 6 open reading frame 27,
the VARS2 gene for valyl-tRNA synthetase 2, the gene for
chromosome 6 open reading frame 28, the HSPA1L gene for
heat shock 70kDa protein 1-like, the HSPA1A gene for heat
shock 70kDa protein 1A, the HSPA1B gene for heat shock
70kDa protein 1B, the gene for chromosome 6 open reading
frame 48, the NEU1 gene for sialidase 1 (lysosomal
sialidase), the gene for chromosome 6 open reading frame
29, the BAT8 gene for HLA-B associated transcript 8, the
gene for chromosome 6 open reading frame 46 and nine CpG
islands, complete sequence
Length = 179894
Score = 42.1 bits (21), Expect = 3.2
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 451 ggaagatgagcatcagcagca 471
|||||||||||||||||||||
Sbjct: 134711 ggaagatgagcatcagcagca 134731
>emb|AL158059.3|CNS01RGK Human chromosome 14 DNA sequence BAC C-2007A10 of library CalTech-D from
chromosome 14 of Homo sapiens (Human), complete sequence
Length = 148515
Score = 42.1 bits (21), Expect = 3.2
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 527 ttatatctgaaaaatgagtta 547
|||||||||||||||||||||
Sbjct: 100524 ttatatctgaaaaatgagtta 100544
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
Posted date: Dec 3, 2006 5:45 PM
Number of letters in database: 18,610,659,111
Number of sequences in database: 4,638,285
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 152,372,335
Number of extensions: 8269896
Number of successful extensions: 163531
Number of sequences better than 10.0: 17
Number of HSP's gapped: 163531
Number of HSP's successfully gapped: 17
Length of query: 853
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 831
Effective length of database: 18,508,616,841
Effective search space: 15380660594871
Effective search space used: 15380660594871
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)