| Clone Name | FLbaf22o04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC128583.4| Rattus norvegicus BAC CH230-333G5 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 164725 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Plus Query: 274 atgaaggtggaggcagaagcag 295 |||||||||||||||||||||| Sbjct: 64846 atgaaggtggaggcagaagcag 64867
>gb|BC056057.1| Xenopus laevis hypothetical protein LOC398692, mRNA (cDNA clone MGC:69021 IMAGE:4964128), complete cds Length = 2009 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Minus Query: 127 tcctcggttctatctttctcgg 148 |||||||||||||||||||||| Sbjct: 37 tcctcggttctatctttctcgg 16
>emb|AL589699.4| Mouse DNA sequence from clone RP23-92G13 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to KIAA0386, five novel genes, the Gmnn gene for geminin, gene PNAS-27, the Ttrap gene for Traf and Tnf receptor associated protein, the gene for a novel protein similar to KIAA0319, the gene for the ortholog of human and rat aldehyde dehydrogenase 5A1 (succinate-semialdehyde dehydrogenase) (ALDH5A1) (SSADH), the 5' end of the Gpld1 gene for glycosylphosphatidylinositol specific phospholipase D1 and four CpG islands, complete sequence Length = 256608 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Minus Query: 276 gaaggtggaggcagaagcagga 297 |||||||||||||||||||||| Sbjct: 249157 gaaggtggaggcagaagcagga 249136
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence Length = 2090491 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 613 tcggtgaaggcaggctcgtcc 633 ||||||||||||||||||||| Sbjct: 1041130 tcggtgaaggcaggctcgtcc 1041150
>gb|AC132314.3| Mus musculus BAC clone RP24-233C4 from chromosome 18, complete sequence Length = 156356 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 277 aaggtggaggcagaagcagga 297 ||||||||||||||||||||| Sbjct: 95750 aaggtggaggcagaagcagga 95770
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 590 ggacactcgcaccggcaacct 610 ||||||||||||||||||||| Sbjct: 3991446 ggacactcgcaccggcaacct 3991426
>gb|AC129331.4| Mus musculus BAC clone RP23-75C8 from chromosome 8, complete sequence Length = 257765 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 41 ttcttccccaaagatggaggg 61 ||||||||||||||||||||| Sbjct: 102004 ttcttccccaaagatggaggg 101984
>gb|AC140930.3| Mus musculus BAC clone RP23-116P20 from chromosome 12, complete sequence Length = 201455 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 277 aaggtggaggcagaagcagga 297 ||||||||||||||||||||| Sbjct: 107662 aaggtggaggcagaagcagga 107642
>gb|AC164651.3| Ornithorhynchus anatinus BAC clone OABb-375A1 from chromosome unknown, complete sequence Length = 183178 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 281 tggaggcagaagcaggatggt 301 ||||||||||||||||||||| Sbjct: 67042 tggaggcagaagcaggatggt 67022
>ref|XM_838261.1| Leishmania major strain Friedlin hypothetical protein (LMJ_1178) partial mRNA Length = 4971 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 613 tcggtgaaggcaggctcgtcc 633 ||||||||||||||||||||| Sbjct: 3448 tcggtgaaggcaggctcgtcc 3468
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome Length = 5224283 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 902 tgcacttcctccttccaataa 922 ||||||||||||||||||||| Sbjct: 4241534 tgcacttcctccttccaataa 4241554 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 131,774,221 Number of extensions: 6515023 Number of successful extensions: 128134 Number of sequences better than 10.0: 11 Number of HSP's gapped: 128134 Number of HSP's successfully gapped: 11 Length of query: 987 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 964 Effective length of database: 18,503,978,556 Effective search space: 17837835327984 Effective search space used: 17837835327984 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)