ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf22o04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC128583.4| Rattus norvegicus BAC CH230-333G5 (Children's Ho... 44 0.94
2gb|BC056057.1| Xenopus laevis hypothetical protein LOC398692, mR... 44 0.94
3emb|AL589699.4| Mouse DNA sequence from clone RP23-92G13 on chro... 44 0.94
4gb|CP000081.1| Leishmania major chromosome 35, complete sequence 42 3.7
5gb|AC132314.3| Mus musculus BAC clone RP24-233C4 from chromosome... 42 3.7
6gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, comp... 42 3.7
7gb|AC129331.4| Mus musculus BAC clone RP23-75C8 from chromosome ... 42 3.7
8gb|AC140930.3| Mus musculus BAC clone RP23-116P20 from chromosom... 42 3.7
9gb|AC164651.3| Ornithorhynchus anatinus BAC clone OABb-375A1 fro... 42 3.7
10ref|XM_838261.1| Leishmania major strain Friedlin hypothetical p... 42 3.7
11gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 42 3.7

>gb|AC128583.4| Rattus norvegicus  BAC CH230-333G5 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 164725
 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 274   atgaaggtggaggcagaagcag 295
             ||||||||||||||||||||||
Sbjct: 64846 atgaaggtggaggcagaagcag 64867



to top

>gb|BC056057.1| Xenopus laevis hypothetical protein LOC398692, mRNA (cDNA clone
           MGC:69021 IMAGE:4964128), complete cds
          Length = 2009

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 127 tcctcggttctatctttctcgg 148
           ||||||||||||||||||||||
Sbjct: 37  tcctcggttctatctttctcgg 16



to top

>emb|AL589699.4| Mouse DNA sequence from clone RP23-92G13 on chromosome 13 Contains the 3'
              end of the gene for a novel protein similar to KIAA0386,
              five novel genes, the Gmnn gene for geminin, gene PNAS-27,
              the Ttrap gene for Traf and Tnf receptor associated
              protein, the gene for a novel protein similar to KIAA0319,
              the gene for the ortholog of human and rat aldehyde
              dehydrogenase 5A1 (succinate-semialdehyde dehydrogenase)
              (ALDH5A1) (SSADH), the 5' end of the Gpld1 gene for
              glycosylphosphatidylinositol specific phospholipase D1 and
              four CpG islands, complete sequence
          Length = 256608

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 276    gaaggtggaggcagaagcagga 297
              ||||||||||||||||||||||
Sbjct: 249157 gaaggtggaggcagaagcagga 249136



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 613     tcggtgaaggcaggctcgtcc 633
               |||||||||||||||||||||
Sbjct: 1041130 tcggtgaaggcaggctcgtcc 1041150



to top

>gb|AC132314.3| Mus musculus BAC clone RP24-233C4 from chromosome 18, complete sequence
          Length = 156356

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 277   aaggtggaggcagaagcagga 297
             |||||||||||||||||||||
Sbjct: 95750 aaggtggaggcagaagcagga 95770



to top

>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome
          Length = 5928787

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 590     ggacactcgcaccggcaacct 610
               |||||||||||||||||||||
Sbjct: 3991446 ggacactcgcaccggcaacct 3991426



to top

>gb|AC129331.4| Mus musculus BAC clone RP23-75C8 from chromosome 8, complete sequence
          Length = 257765

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 41     ttcttccccaaagatggaggg 61
              |||||||||||||||||||||
Sbjct: 102004 ttcttccccaaagatggaggg 101984



to top

>gb|AC140930.3| Mus musculus BAC clone RP23-116P20 from chromosome 12, complete sequence
          Length = 201455

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 277    aaggtggaggcagaagcagga 297
              |||||||||||||||||||||
Sbjct: 107662 aaggtggaggcagaagcagga 107642



to top

>gb|AC164651.3| Ornithorhynchus anatinus BAC clone OABb-375A1 from chromosome unknown,
             complete sequence
          Length = 183178

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 281   tggaggcagaagcaggatggt 301
             |||||||||||||||||||||
Sbjct: 67042 tggaggcagaagcaggatggt 67022



to top

>ref|XM_838261.1| Leishmania major strain Friedlin hypothetical protein (LMJ_1178)
            partial mRNA
          Length = 4971

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 613  tcggtgaaggcaggctcgtcc 633
            |||||||||||||||||||||
Sbjct: 3448 tcggtgaaggcaggctcgtcc 3468



to top

>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 902     tgcacttcctccttccaataa 922
               |||||||||||||||||||||
Sbjct: 4241534 tgcacttcctccttccaataa 4241554


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 131,774,221
Number of extensions: 6515023
Number of successful extensions: 128134
Number of sequences better than 10.0: 11
Number of HSP's gapped: 128134
Number of HSP's successfully gapped: 11
Length of query: 987
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 964
Effective length of database: 18,503,978,556
Effective search space: 17837835327984
Effective search space used: 17837835327984
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top