ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf16o05
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001067942.1| Oryza sativa (japonica cultivar-group) Os08g... 509 e-140
2dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 509 e-140
3dbj|AP006064.3| Oryza sativa (japonica cultivar-group) genomic D... 509 e-140
4dbj|AK105097.1| Oryza sativa (japonica cultivar-group) cDNA clon... 509 e-140
5ref|NM_001070037.1| Oryza sativa (japonica cultivar-group) Os09g... 88 1e-13
6ref|NM_001070036.1| Oryza sativa (japonica cultivar-group) Os09g... 88 1e-13
7gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome... 88 1e-13
8dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-13
9dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic D... 88 1e-13
10dbj|AK108029.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-13
11dbj|AK105666.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 1e-13
12ref|NM_001068546.1| Oryza sativa (japonica cultivar-group) Os08g... 66 5e-07
13dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic D... 66 5e-07
14dbj|AK108789.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 5e-07
15emb|CT834123.1| Oryza sativa (indica cultivar-group) cDNA clone:... 60 3e-05
16ref|NM_001053197.1| Oryza sativa (japonica cultivar-group) Os02g... 60 3e-05
17dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 60 3e-05
18dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 60 3e-05
19dbj|AP006164.2| Oryza sativa (japonica cultivar-group) genomic D... 60 3e-05
20dbj|AP004891.4| Oryza sativa (japonica cultivar-group) genomic D... 60 3e-05
21dbj|AK120604.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-05
22dbj|AK102614.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-05
23dbj|AK068924.1| Oryza sativa (japonica cultivar-group) cDNA clon... 60 3e-05
24ref|NM_001072833.1| Oryza sativa (japonica cultivar-group) Os12g... 58 1e-04
25ref|NM_001072448.1| Oryza sativa (japonica cultivar-group) Os11g... 58 1e-04
26gb|AC134047.3| Oryza sativa (japonica cultivar-group) chromosome... 58 1e-04
27dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-04
28dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 58 1e-04
29dbj|AK064771.1| Oryza sativa (japonica cultivar-group) cDNA clon... 58 1e-04
30emb|AL732376.2|CNS08C8Z Oryza sativa chromosome 12, . BAC OSJNBa... 58 1e-04
31ref|NM_001072445.1| Oryza sativa (japonica cultivar-group) Os11g... 56 5e-04
32dbj|AP003564.2| Oryza sativa (japonica cultivar-group) genomic D... 56 5e-04
33dbj|AK068348.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 5e-04
34ref|NM_001062821.1| Oryza sativa (japonica cultivar-group) Os05g... 52 0.008
35ref|NM_001060796.1| Oryza sativa (japonica cultivar-group) Os04g... 52 0.008
36ref|NM_001050401.1| Oryza sativa (japonica cultivar-group) Os01g... 52 0.008
37ref|NM_001048514.1| Oryza sativa (japonica cultivar-group) Os01g... 52 0.008
38emb|AL732349.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 52 0.008
39gb|AC104709.2| Oryza sativa (japonica cultivar-group) chromosome... 52 0.008
40dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
41dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
42dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
43dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
44emb|AL606668.2|OSJN00083 Oryza sativa genomic DNA, chromosome 4,... 52 0.008
45dbj|AP006753.2| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
46dbj|AP003335.4| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
47dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
48dbj|AP005052.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
49dbj|AP004040.3| Oryza sativa (japonica cultivar-group) genomic D... 52 0.008
50dbj|AK068990.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.008
51emb|CR855179.1| Oryza sativa genomic DNA, chromosome 4, BAC clon... 50 0.030
52emb|CR855170.1| Oryza sativa genomic DNA, chromosome 4, BAC clon... 50 0.030
53ref|NM_001059457.1| Oryza sativa (japonica cultivar-group) Os04g... 50 0.030
54ref|NM_001050071.1| Oryza sativa (japonica cultivar-group) Os01g... 50 0.030
55dbj|AP003216.3| Oryza sativa (japonica cultivar-group) genomic D... 50 0.030
56dbj|AK109494.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.030
57dbj|AK120786.1| Oryza sativa (japonica cultivar-group) cDNA clon... 50 0.030
58emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4,... 50 0.030
59emb|CT831779.1| Oryza sativa (indica cultivar-group) cDNA clone:... 48 0.12
60ref|NM_001068545.1| Oryza sativa (japonica cultivar-group) Os08g... 48 0.12
61ref|NM_001056477.1| Oryza sativa (japonica cultivar-group) Os03g... 48 0.12
62ref|NM_001054492.1| Oryza sativa (japonica cultivar-group) Os02g... 48 0.12
63ref|NM_001054491.1| Oryza sativa (japonica cultivar-group) Os02g... 48 0.12
64dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.12
65gb|AC134230.2| Oryza sativa (japonica cultivar-group) chromosome... 48 0.12
66dbj|AK119465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.12
67dbj|AK108039.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.12
68dbj|AK099781.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.12
69dbj|AK072228.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.12
70dbj|AK061628.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.12
71dbj|AK061307.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.12
72ref|NM_001069873.1| Oryza sativa (japonica cultivar-group) Os09g... 46 0.47
73ref|NM_001069747.1| Oryza sativa (japonica cultivar-group) Os09g... 46 0.47
74ref|NM_001063020.1| Oryza sativa (japonica cultivar-group) Os05g... 46 0.47
75ref|NM_001056478.1| Oryza sativa (japonica cultivar-group) Os03g... 46 0.47
76gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, compl... 46 0.47
77gb|AC136216.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.47
78gb|AC105260.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.47
79dbj|AP005393.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.47
80dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.47
81dbj|AP005420.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.47
82dbj|AK120024.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.47
83dbj|AK106440.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.47
84dbj|AK105952.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.47
85dbj|AK103957.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.47
86dbj|AK070159.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.47
87gb|CP000460.1| Burkholderia cenocepacia HI2424 chromosome 3, com... 44 1.8
88emb|CT829717.1| Oryza sativa (indica cultivar-group) cDNA clone:... 44 1.8
89emb|CR855235.1| Oryza sativa genomic DNA, chromosome 4, BAC clon... 44 1.8
90ref|NM_001064590.1| Oryza sativa (japonica cultivar-group) Os06g... 44 1.8
91ref|NM_001060265.1| Oryza sativa (japonica cultivar-group) Os04g... 44 1.8
92ref|NM_001059458.1| Oryza sativa (japonica cultivar-group) Os04g... 44 1.8
93ref|NM_001054488.1| Oryza sativa (japonica cultivar-group) Os02g... 44 1.8
94gb|CP000440.1| Burkholderia cepacia AMMD chromosome 1, complete ... 44 1.8
95emb|AM236085.1| Rhizobium leguminosarum bv. viciae plasmid pRL11... 44 1.8
96gb|CP000380.1| Burkholderia cenocepacia AU 1054 chromosome 3, co... 44 1.8
97gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 44 1.8
98gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome... 44 1.8
99gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 44 1.8
100gb|AC133003.3| Oryza sativa chromosome 3 BAC OSJNBa0010D22 genom... 44 1.8
101gb|AY261359.1| Bovine herpesvirus 5 strain SV507/99, complete ge... 44 1.8
102gb|CP000137.1| Rhizobium etli CFN 42 plasmid p42e, complete sequ... 44 1.8
103gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 44 1.8
104gb|AC136213.2| Leishmania major strain Friedlin chromosome 27 cl... 44 1.8
105emb|AL731579.4|OSJN00225 Oryza sativa genomic DNA, chromosome 4,... 44 1.8
106gb|AC154563.2| Mus musculus BAC clone RP23-401E22 from chromosom... 44 1.8
107dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome 44 1.8
108dbj|AP003616.4| Oryza sativa (japonica cultivar-group) genomic D... 44 1.8
109dbj|AK108932.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 1.8
110dbj|AK106907.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 1.8
111dbj|AK066754.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 1.8
112ref|XM_843045.1| Leishmania major strain Friedlin hypothetical p... 44 1.8
113emb|AL607004.4|OSJN00129 Oryza sativa genomic DNA, chromosome 4,... 44 1.8
114gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete ge... 42 7.3
115ref|XM_001233592.1| PREDICTED: Gallus gallus hypothetical protei... 42 7.3
116ref|XM_001225566.1| Chaetomium globosum CBS 148.51 conserved hyp... 42 7.3
117ref|NM_001072450.1| Oryza sativa (japonica cultivar-group) Os11g... 42 7.3
118ref|NM_001069871.1| Oryza sativa (japonica cultivar-group) Os09g... 42 7.3
119ref|NM_001063168.1| Oryza sativa (japonica cultivar-group) Os06g... 42 7.3
120gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 42 7.3
121gb|CP000081.1| Leishmania major chromosome 35, complete sequence 42 7.3
122gb|AC119252.10| Mus musculus chromosome 8, clone RP24-279M13, co... 42 7.3
123gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome 42 7.3
124gb|CP000133.1| Rhizobium etli CFN 42, complete genome 42 7.3
125gb|AC113016.7| Mus musculus chromosome 9, clone RP23-181L13, com... 42 7.3
126gb|AF308692.1| Oryza sativa nucellin-like protein (OSAP1) mRNA, ... 42 7.3
127gb|AF308691.1| Oryza sativa nucellin-like protein (OSAP1) gene, ... 42 7.3
128dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111 42 7.3
129gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome 42 7.3
130gb|AC182231.2| Mus musculus BAC clone RP23-356C18 from chromosom... 42 7.3
131dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, compl... 42 7.3
132emb|BX072341.1|CNS09RZD Single read from an extremity of a full-... 42 7.3
133emb|BX072340.1|CNS09RZC Single read from an extremity of a full-... 42 7.3
134emb|BX071844.1|CNS09RLK Single read from an extremity of a full-... 42 7.3
135emb|BX071843.1|CNS09RLJ Single read from an extremity of a full-... 42 7.3
136emb|BX071645.1|CNS09RG1 Single read from an extremity of a full-... 42 7.3
137emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-... 42 7.3
138emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-... 42 7.3
139emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-... 42 7.3
140emb|BX071464.1|CNS09RB0 Single read from an extremity of a full-... 42 7.3
141emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-... 42 7.3
142emb|BX071370.1|CNS09R8E Single read from an extremity of a full-... 42 7.3
143emb|BX071369.1|CNS09R8D Single read from an extremity of a full-... 42 7.3
144emb|BX071325.1|CNS09R75 Single read from an extremity of a full-... 42 7.3
145emb|BX071324.1|CNS09R74 Single read from an extremity of a full-... 42 7.3
146emb|BX071281.1|CNS09R5X Single read from an extremity of a full-... 42 7.3
147emb|BX071150.1|CNS09R2A Single read from an extremity of a full-... 42 7.3
148emb|BX071149.1|CNS09R29 Single read from an extremity of a full-... 42 7.3
149emb|BX070669.1|CNS09QOX Single read from an extremity of a full-... 42 7.3
150emb|BX071048.1|CNS09QZG Single read from an extremity of a full-... 42 7.3
151emb|BX071047.1|CNS09QZF Single read from an extremity of a full-... 42 7.3
152emb|BX070860.1|CNS09QU8 Single read from an extremity of a full-... 42 7.3
153emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-... 42 7.3
154emb|BX070688.1|CNS09QPG Single read from an extremity of a full-... 42 7.3
155emb|BX070687.1|CNS09QPF Single read from an extremity of a full-... 42 7.3
156emb|BX070681.1|CNS09QP9 Single read from an extremity of a full-... 42 7.3
157emb|BX061534.1|CNS09JN6 Single read from an extremity of a full-... 42 7.3
158emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-... 42 7.3
159emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-... 42 7.3
160emb|BX061372.1|CNS09JIO Single read from an extremity of a full-... 42 7.3
161emb|BX061371.1|CNS09JIN Single read from an extremity of a full-... 42 7.3
162emb|BX070196.1|CNS09QBS Single read from an extremity of a full-... 42 7.3
163emb|BX070195.1|CNS09QBR Single read from an extremity of a full-... 42 7.3
164emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-... 42 7.3
165emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-... 42 7.3
166emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-... 42 7.3
167emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-... 42 7.3
168emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-... 42 7.3
169emb|BX069764.1|CNS09PZS Single read from an extremity of a full-... 42 7.3
170emb|BX069763.1|CNS09PZR Single read from an extremity of a full-... 42 7.3
171emb|BX069694.1|CNS09PXU Single read from an extremity of a full-... 42 7.3
172emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-... 42 7.3
173emb|BX069225.1|CNS09PKT Single read from an extremity of a full-... 42 7.3
174emb|BX069224.1|CNS09PKS Single read from an extremity of a full-... 42 7.3
175emb|BX069119.1|CNS09PHV Single read from an extremity of a full-... 42 7.3
176emb|BX069118.1|CNS09PHU Single read from an extremity of a full-... 42 7.3
177emb|BX069067.1|CNS09PGF Single read from an extremity of a full-... 42 7.3
178emb|BX069066.1|CNS09PGE Single read from an extremity of a full-... 42 7.3
179emb|BX068401.1|CNS09OXX Single read from an extremity of a full-... 42 7.3
180emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-... 42 7.3
181emb|BX068340.1|CNS09OW8 Single read from an extremity of a full-... 42 7.3
182emb|BX068787.1|CNS09P8N Single read from an extremity of a full-... 42 7.3
183emb|BX068786.1|CNS09P8M Single read from an extremity of a full-... 42 7.3
184emb|BX068730.1|CNS09P72 Single read from an extremity of a full-... 42 7.3
185emb|BX068729.1|CNS09P71 Single read from an extremity of a full-... 42 7.3
186emb|BX068402.1|CNS09OXY Single read from an extremity of a full-... 42 7.3
187emb|BX067375.1|CNS09O5F Single read from an extremity of a full-... 42 7.3
188emb|BX067374.1|CNS09O5E Single read from an extremity of a full-... 42 7.3
189emb|BX068159.1|CNS09OR7 Single read from an extremity of a full-... 42 7.3
190emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-... 42 7.3
191emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-... 42 7.3
192emb|BX067751.1|CNS09OFV Single read from an extremity of a full-... 42 7.3
193emb|BX067750.1|CNS09OFU Single read from an extremity of a full-... 42 7.3
194emb|BX067204.1|CNS09O0O Single read from an extremity of a full-... 42 7.3
195emb|BX067203.1|CNS09O0N Single read from an extremity of a full-... 42 7.3
196emb|BX066718.1|CNS09NN6 Single read from an extremity of a full-... 42 7.3
197emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-... 42 7.3
198emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-... 42 7.3
199emb|BX066485.1|CNS09NGP Single read from an extremity of a full-... 42 7.3
200emb|BX066475.1|CNS09NGF Single read from an extremity of a full-... 42 7.3
201emb|BX066474.1|CNS09NGE Single read from an extremity of a full-... 42 7.3
202emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-... 42 7.3
203emb|BX066389.1|CNS09NE1 Single read from an extremity of a full-... 42 7.3
204emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-... 42 7.3
205emb|BX066287.1|CNS09NB7 Single read from an extremity of a full-... 42 7.3
206emb|BX066286.1|CNS09NB6 Single read from an extremity of a full-... 42 7.3
207emb|BX065868.1|CNS09MZK Single read from an extremity of a full-... 42 7.3
208emb|BX065859.1|CNS09MZB Single read from an extremity of a full-... 42 7.3
209emb|BX065782.1|CNS09MX6 Single read from an extremity of a full-... 42 7.3
210emb|BX065781.1|CNS09MX5 Single read from an extremity of a full-... 42 7.3
211emb|BX065577.1|CNS09MRH Single read from an extremity of a full-... 42 7.3
212emb|BX065576.1|CNS09MRG Single read from an extremity of a full-... 42 7.3
213emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-... 42 7.3
214emb|BX065054.1|CNS09MCY Single read from an extremity of a full-... 42 7.3
215emb|BX064997.1|CNS09MBD Single read from an extremity of a full-... 42 7.3
216emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-... 42 7.3
217emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-... 42 7.3
218emb|BX064806.1|CNS09M62 Single read from an extremity of a full-... 42 7.3
219emb|BX064779.1|CNS09M5B Single read from an extremity of a full-... 42 7.3
220emb|BX064778.1|CNS09M5A Single read from an extremity of a full-... 42 7.3
221emb|BX064711.1|CNS09M3F Single read from an extremity of a full-... 42 7.3
222emb|BX064710.1|CNS09M3E Single read from an extremity of a full-... 42 7.3
223emb|BX064612.1|CNS09M0O Single read from an extremity of a full-... 42 7.3
224emb|BX064611.1|CNS09M0N Single read from an extremity of a full-... 42 7.3
225emb|BX064509.1|CNS09LXT Single read from an extremity of a full-... 42 7.3
226emb|BX064050.1|CNS09LL2 Single read from an extremity of a full-... 42 7.3
227emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-... 42 7.3
228emb|BX064012.1|CNS09LK0 Single read from an extremity of a full-... 42 7.3
229emb|BX064011.1|CNS09LJZ Single read from an extremity of a full-... 42 7.3
230emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-... 42 7.3
231emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-... 42 7.3
232emb|BX063825.1|CNS09LET Single read from an extremity of a full-... 42 7.3
233emb|BX063745.1|CNS09LCL Single read from an extremity of a full-... 42 7.3
234emb|BX063744.1|CNS09LCK Single read from an extremity of a full-... 42 7.3
235emb|BX063730.1|CNS09LC6 Single read from an extremity of a full-... 42 7.3
236emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-... 42 7.3
237emb|BX063708.1|CNS09LBK Single read from an extremity of a full-... 42 7.3
238emb|BX063707.1|CNS09LBJ Single read from an extremity of a full-... 42 7.3
239emb|BX063617.1|CNS09L91 Single read from an extremity of a full-... 42 7.3
240emb|BX063616.1|CNS09L90 Single read from an extremity of a full-... 42 7.3
241emb|BX063582.1|CNS09L82 Single read from an extremity of a full-... 42 7.3
242emb|BX063581.1|CNS09L81 Single read from an extremity of a full-... 42 7.3
243emb|BX063323.1|CNS09L0V Single read from an extremity of a full-... 42 7.3
244emb|BX062417.1|CNS09KBP Single read from an extremity of a full-... 42 7.3
245emb|BX062744.1|CNS09KKS Single read from an extremity of a full-... 42 7.3
246emb|BX062743.1|CNS09KKR Single read from an extremity of a full-... 42 7.3
247emb|BX062646.1|CNS09KI2 Single read from an extremity of a full-... 42 7.3
248emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-... 42 7.3
249emb|BX062386.1|CNS09KAU Single read from an extremity of a full-... 42 7.3
250emb|BX062032.1|CNS09K10 Single read from an extremity of a full-... 42 7.3
251emb|BX061846.1|CNS09JVU Single read from an extremity of a full-... 42 7.3
252emb|BX061653.1|CNS09JQH Single read from an extremity of a full-... 42 7.3
253emb|BX061652.1|CNS09JQG Single read from an extremity of a full-... 42 7.3
254emb|BX060850.1|CNS09J46 Single read from an extremity of a full-... 42 7.3
255emb|BX060763.1|CNS09J1R Single read from an extremity of a full-... 42 7.3
256emb|BX060762.1|CNS09J1Q Single read from an extremity of a full-... 42 7.3
257emb|BX060639.1|CNS09IYB Single read from an extremity of a full-... 42 7.3
258emb|BX060638.1|CNS09IYA Single read from an extremity of a full-... 42 7.3
259emb|BX060485.1|CNS09IU1 Single read from an extremity of a full-... 42 7.3
260emb|BX060484.1|CNS09IU0 Single read from an extremity of a full-... 42 7.3
261emb|BX060483.1|CNS09ITZ Single read from an extremity of a full-... 42 7.3
262emb|BX060482.1|CNS09ITY Single read from an extremity of a full-... 42 7.3
263emb|BX060104.1|CNS09IJG Single read from an extremity of a full-... 42 7.3
264emb|BX060103.1|CNS09IJF Single read from an extremity of a full-... 42 7.3
265emb|BX060039.1|CNS09IHN Single read from an extremity of a full-... 42 7.3
266emb|BX060038.1|CNS09IHM Single read from an extremity of a full-... 42 7.3
267emb|BX059596.1|CNS09I5C Single read from an extremity of a full-... 42 7.3
268emb|BX059595.1|CNS09I5B Single read from an extremity of a full-... 42 7.3
269emb|BX059581.1|CNS09I4X Single read from an extremity of a full-... 42 7.3
270emb|BX059580.1|CNS09I4W Single read from an extremity of a full-... 42 7.3
271emb|BX059340.1|CNS09HY8 Single read from an extremity of a full-... 42 7.3
272emb|BX059233.1|CNS09HV9 Single read from an extremity of a full-... 42 7.3
273emb|BX059232.1|CNS09HV8 Single read from an extremity of a full-... 42 7.3
274emb|BX059085.1|CNS09HR5 Single read from an extremity of a full-... 42 7.3
275emb|BX058666.1|CNS09HFI Single read from an extremity of a full-... 42 7.3
276emb|BX058616.1|CNS09HE4 Single read from an extremity of a full-... 42 7.3
277emb|BX058615.1|CNS09HE3 Single read from an extremity of a full-... 42 7.3
278emb|BX058583.1|CNS09HD7 Single read from an extremity of a full-... 42 7.3
279emb|BX058582.1|CNS09HD6 Single read from an extremity of a full-... 42 7.3
280emb|BX058544.1|CNS09HC4 Single read from an extremity of a full-... 42 7.3
281emb|BX058454.1|CNS09H9M Single read from an extremity of a full-... 42 7.3
282emb|BX058452.1|CNS09H9K Single read from an extremity of a full-... 42 7.3
283emb|BX058451.1|CNS09H9J Single read from an extremity of a full-... 42 7.3
284emb|BX058330.1|CNS09H66 Single read from an extremity of a full-... 42 7.3
285emb|BX058329.1|CNS09H65 Single read from an extremity of a full-... 42 7.3
286emb|BX058255.1|CNS09H43 Single read from an extremity of a full-... 42 7.3
287emb|BX058230.1|CNS09H3E Single read from an extremity of a full-... 42 7.3
288emb|BX058229.1|CNS09H3D Single read from an extremity of a full-... 42 7.3
289emb|BX057878.1|CNS09GTM Single read from an extremity of a full-... 42 7.3
290emb|BX057785.1|CNS09GR1 Single read from an extremity of a full-... 42 7.3
291emb|BX057784.1|CNS09GR0 Single read from an extremity of a full-... 42 7.3
292emb|BX057634.1|CNS09GMU Single read from an extremity of a full-... 42 7.3
293emb|BX057633.1|CNS09GMT Single read from an extremity of a full-... 42 7.3
294emb|BX057495.1|CNS09GIZ Single read from an extremity of a full-... 42 7.3
295emb|BX057272.1|CNS09GCS Single read from an extremity of a full-... 42 7.3
296emb|BX057100.1|CNS09G80 Single read from an extremity of a full-... 42 7.3
297emb|BX056621.1|CNS09FUP Single read from an extremity of a full-... 42 7.3
298emb|BX056620.1|CNS09FUO Single read from an extremity of a full-... 42 7.3
299emb|BX056605.1|CNS09FU9 Single read from an extremity of a full-... 42 7.3
300emb|BX056604.1|CNS09FU8 Single read from an extremity of a full-... 42 7.3
301emb|BX056459.1|CNS09FQ7 Single read from an extremity of a full-... 42 7.3
302emb|BX056291.1|CNS09FLJ Single read from an extremity of a full-... 42 7.3
303emb|BX056290.1|CNS09FLI Single read from an extremity of a full-... 42 7.3
304emb|BX056141.1|CNS09FHD Single read from an extremity of a full-... 42 7.3
305emb|BX055855.1|CNS09F9F Single read from an extremity of a full-... 42 7.3
306emb|BX055854.1|CNS09F9E Single read from an extremity of a full-... 42 7.3
307emb|BX055853.1|CNS09F9D Single read from an extremity of a full-... 42 7.3
308emb|BX055833.1|CNS09F8T Single read from an extremity of a full-... 42 7.3
309emb|BX055484.1|CNS09EZ4 Single read from an extremity of a full-... 42 7.3
310emb|BX055142.1|CNS09EPM Single read from an extremity of a full-... 42 7.3
311emb|BX055141.1|CNS09EPL Single read from an extremity of a full-... 42 7.3
312emb|BX054882.1|CNS09EIE Single read from an extremity of a full-... 42 7.3
313emb|BX054081.1|CNS09DW5 Single read from an extremity of a full-... 42 7.3
314emb|BX053882.1|CNS09DQM Single read from an extremity of a full-... 42 7.3
315emb|BX053881.1|CNS09DQL Single read from an extremity of a full-... 42 7.3
316emb|BX053707.1|CNS09DLR Single read from an extremity of a full-... 42 7.3
317emb|BX053706.1|CNS09DLQ Single read from an extremity of a full-... 42 7.3
318emb|BX053418.1|CNS09DDQ Single read from an extremity of a full-... 42 7.3
319emb|BX053417.1|CNS09DDP Single read from an extremity of a full-... 42 7.3
320emb|BX053228.1|CNS09D8G Single read from an extremity of a full-... 42 7.3
321emb|BX053216.1|CNS09D84 Single read from an extremity of a full-... 42 7.3
322emb|BX053163.1|CNS09D6N Single read from an extremity of a full-... 42 7.3
323emb|BX053162.1|CNS09D6M Single read from an extremity of a full-... 42 7.3
324emb|BX053145.1|CNS09D65 Single read from an extremity of a full-... 42 7.3
325emb|BX053144.1|CNS09D64 Single read from an extremity of a full-... 42 7.3
326emb|BX053079.1|CNS09D4B Single read from an extremity of a full-... 42 7.3
327emb|BX053069.1|CNS09D41 Single read from an extremity of a full-... 42 7.3
328emb|BX053068.1|CNS09D40 Single read from an extremity of a full-... 42 7.3
329emb|BX052675.1|CNS09CT3 Single read from an extremity of a full-... 42 7.3
330emb|BX052674.1|CNS09CT2 Single read from an extremity of a full-... 42 7.3
331emb|BX052302.1|CNS09CIQ Single read from an extremity of a full-... 42 7.3
332emb|BX052301.1|CNS09CIP Single read from an extremity of a full-... 42 7.3
333emb|BX052215.1|CNS09CGB Single read from an extremity of a full-... 42 7.3
334emb|BX051963.1|CNS09C9B Single read from an extremity of a full-... 42 7.3
335emb|BX051962.1|CNS09C9A Single read from an extremity of a full-... 42 7.3
336emb|BX051916.1|CNS09C80 Single read from an extremity of a full-... 42 7.3
337emb|BX051915.1|CNS09C7Z Single read from an extremity of a full-... 42 7.3
338emb|BX051465.1|CNS09BVH Single read from an extremity of a full-... 42 7.3
339emb|BX051464.1|CNS09BVG Single read from an extremity of a full-... 42 7.3
340emb|BX050918.1|CNS09BGA Single read from an extremity of a full-... 42 7.3
341emb|BX050847.1|CNS09BEB Single read from an extremity of a full-... 42 7.3
342emb|BX050846.1|CNS09BEA Single read from an extremity of a full-... 42 7.3
343emb|BX050778.1|CNS09BCE Single read from an extremity of a full-... 42 7.3
344emb|BX050777.1|CNS09BCD Single read from an extremity of a full-... 42 7.3
345emb|BX050735.1|CNS09BB7 Single read from an extremity of a full-... 42 7.3
346emb|BX051098.1|CNS09BLA Single read from an extremity of a full-... 42 7.3
347emb|BX051097.1|CNS09BL9 Single read from an extremity of a full-... 42 7.3
348emb|BX051054.1|CNS09BK2 Single read from an extremity of a full-... 42 7.3
349emb|BX051169.1|CNS09BN9 Single read from an extremity of a full-... 42 7.3
350emb|BX050638.1|CNS09B8I Single read from an extremity of a full-... 42 7.3
351emb|BX050637.1|CNS09B8H Single read from an extremity of a full-... 42 7.3
352emb|BX050473.1|CNS09B3X Single read from an extremity of a full-... 42 7.3
353emb|BX050286.1|CNS09AYQ Single read from an extremity of a full-... 42 7.3
354emb|BX050285.1|CNS09AYP Single read from an extremity of a full-... 42 7.3
355emb|BX049853.1|CNS09AMP Single read from an extremity of a full-... 42 7.3
356emb|BX049852.1|CNS09AMO Single read from an extremity of a full-... 42 7.3
357emb|BX049279.1|CNS09A6R Single read from an extremity of a full-... 42 7.3
358emb|BX049278.1|CNS09A6Q Single read from an extremity of a full-... 42 7.3
359emb|BX049134.1|CNS09A2Q Single read from an extremity of a full-... 42 7.3
360emb|BX049056.1|CNS09A0K Single read from an extremity of a full-... 42 7.3
361emb|BX048984.1|CNS099YK Single read from an extremity of a full-... 42 7.3
362emb|BX048838.1|CNS099UI Single read from an extremity of a full-... 42 7.3
363emb|BX048147.1|CNS099BB Single read from an extremity of a full-... 42 7.3
364emb|BX048146.1|CNS099BA Single read from an extremity of a full-... 42 7.3
365emb|BX048661.1|CNS099PL Single read from an extremity of a full-... 42 7.3
366emb|BX048660.1|CNS099PK Single read from an extremity of a full-... 42 7.3
367emb|BX048627.1|CNS099ON Single read from an extremity of a full-... 42 7.3
368emb|BX048303.1|CNS099FN Single read from an extremity of a full-... 42 7.3
369emb|BX048302.1|CNS099FM Single read from an extremity of a full-... 42 7.3
370emb|BX047689.1|CNS098YL Single read from an extremity of a full-... 42 7.3
371emb|BX047677.1|CNS098Y9 Single read from an extremity of a full-... 42 7.3
372emb|BX047676.1|CNS098Y8 Single read from an extremity of a full-... 42 7.3
373emb|BX048050.1|CNS0998M Single read from an extremity of a full-... 42 7.3
374emb|BX047927.1|CNS09957 Single read from an extremity of a full-... 42 7.3
375emb|BX047926.1|CNS09956 Single read from an extremity of a full-... 42 7.3
376emb|BX047906.1|CNS0994M Single read from an extremity of a full-... 42 7.3
377emb|BX047547.1|CNS098UN Single read from an extremity of a full-... 42 7.3
378emb|BX047520.1|CNS098TW Single read from an extremity of a full-... 42 7.3
379emb|BX047255.1|CNS098MJ Single read from an extremity of a full-... 42 7.3
380emb|BX047103.1|CNS098IB Single read from an extremity of a full-... 42 7.3
381emb|BX047102.1|CNS098IA Single read from an extremity of a full-... 42 7.3
382emb|BX046951.1|CNS098E3 Single read from an extremity of a full-... 42 7.3
383emb|BX046950.1|CNS098E2 Single read from an extremity of a full-... 42 7.3
384emb|BX046775.1|CNS09897 Single read from an extremity of a full-... 42 7.3
385emb|BX046739.1|CNS09887 Single read from an extremity of a full-... 42 7.3
386emb|BX046676.1|CNS0986G Single read from an extremity of a full-... 42 7.3
387emb|BX046675.1|CNS0986F Single read from an extremity of a full-... 42 7.3
388emb|BX046022.1|CNS097OA Single read from an extremity of a full-... 42 7.3
389emb|BX046021.1|CNS097O9 Single read from an extremity of a full-... 42 7.3
390emb|BX046532.1|CNS0982G Single read from an extremity of a full-... 42 7.3
391emb|BX046531.1|CNS0982F Single read from an extremity of a full-... 42 7.3
392emb|BX046528.1|CNS0982C Single read from an extremity of a full-... 42 7.3
393emb|BX046527.1|CNS0982B Single read from an extremity of a full-... 42 7.3
394emb|BX046456.1|CNS0980C Single read from an extremity of a full-... 42 7.3
395emb|BX046455.1|CNS0980B Single read from an extremity of a full-... 42 7.3
396emb|BX045808.1|CNS097IC Single read from an extremity of a full-... 42 7.3
397emb|BX045791.1|CNS097HV Single read from an extremity of a full-... 42 7.3
398emb|BX045765.1|CNS097H5 Single read from an extremity of a full-... 42 7.3
399emb|BX045764.1|CNS097H4 Single read from an extremity of a full-... 42 7.3
400emb|BX045566.1|CNS097BM Single read from an extremity of a full-... 42 7.3
401emb|BX045565.1|CNS097BL Single read from an extremity of a full-... 42 7.3
402emb|BX045090.1|CNS096YE Single read from an extremity of a full-... 42 7.3
403emb|BX045089.1|CNS096YD Single read from an extremity of a full-... 42 7.3
404emb|BX044717.1|CNS096O1 Single read from an extremity of a full-... 42 7.3
405emb|BX044716.1|CNS096O0 Single read from an extremity of a full-... 42 7.3
406emb|BX044420.1|CNS096FS Single read from an extremity of a full-... 42 7.3
407emb|BX044419.1|CNS096FR Single read from an extremity of a full-... 42 7.3
408emb|BX044388.1|CNS096EW Single read from an extremity of a full-... 42 7.3
409emb|BX044387.1|CNS096EV Single read from an extremity of a full-... 42 7.3
410emb|BX043307.1|CNS095KV Single read from an extremity of a full-... 42 7.3
411emb|BX043306.1|CNS095KU Single read from an extremity of a full-... 42 7.3
412emb|BX044308.1|CNS096CO Single read from an extremity of a full-... 42 7.3
413emb|BX044226.1|CNS096AE Single read from an extremity of a full-... 42 7.3
414emb|BX044225.1|CNS096AD Single read from an extremity of a full-... 42 7.3
415emb|BX044213.1|CNS096A1 Single read from an extremity of a full-... 42 7.3
416emb|BX044163.1|CNS0968N Single read from an extremity of a full-... 42 7.3
417emb|BX044006.1|CNS0964A Single read from an extremity of a full-... 42 7.3
418emb|BX044005.1|CNS09649 Single read from an extremity of a full-... 42 7.3
419emb|BX043903.1|CNS0961F Single read from an extremity of a full-... 42 7.3
420emb|BX043902.1|CNS0961E Single read from an extremity of a full-... 42 7.3
421emb|BX043494.1|CNS095Q2 Single read from an extremity of a full-... 42 7.3
422emb|BX043388.1|CNS095N4 Single read from an extremity of a full-... 42 7.3
423emb|BX043030.1|CNS095D6 Single read from an extremity of a full-... 42 7.3
424emb|BX043029.1|CNS095D5 Single read from an extremity of a full-... 42 7.3
425emb|BX042574.1|CNS0950I Single read from an extremity of a full-... 42 7.3
426emb|BX042573.1|CNS0950H Single read from an extremity of a full-... 42 7.3
427emb|BX042534.1|CNS094ZE Single read from an extremity of a full-... 42 7.3
428emb|BX042036.1|CNS094LK Single read from an extremity of a full-... 42 7.3
429emb|BX042035.1|CNS094LJ Single read from an extremity of a full-... 42 7.3
430emb|BX041884.1|CNS094HC Single read from an extremity of a full-... 42 7.3
431emb|BX041883.1|CNS094HB Single read from an extremity of a full-... 42 7.3
432emb|BX041767.1|CNS094E3 Single read from an extremity of a full-... 42 7.3
433emb|BX041453.1|CNS0945D Single read from an extremity of a full-... 42 7.3
434emb|BX041364.1|CNS0942W Single read from an extremity of a full-... 42 7.3
435emb|BX041363.1|CNS0942V Single read from an extremity of a full-... 42 7.3
436emb|BX041666.1|CNS094BA Single read from an extremity of a full-... 42 7.3
437emb|BX041665.1|CNS094B9 Single read from an extremity of a full-... 42 7.3
438emb|BX041016.1|CNS093T8 Single read from an extremity of a full-... 42 7.3
439emb|BX040956.1|CNS093RK Single read from an extremity of a full-... 42 7.3
440emb|BX040955.1|CNS093RJ Single read from an extremity of a full-... 42 7.3
441emb|BX040769.1|CNS093MD Single read from an extremity of a full-... 42 7.3
442emb|BX040768.1|CNS093MC Single read from an extremity of a full-... 42 7.3
443emb|BX040585.1|CNS093H9 Single read from an extremity of a full-... 42 7.3
444emb|BX040584.1|CNS093H8 Single read from an extremity of a full-... 42 7.3
445emb|BX040258.1|CNS09386 Single read from an extremity of a full-... 42 7.3
446emb|BX040257.1|CNS09385 Single read from an extremity of a full-... 42 7.3
447emb|BX040215.1|CNS0936Z Single read from an extremity of a full-... 42 7.3
448emb|BX040214.1|CNS0936Y Single read from an extremity of a full-... 42 7.3
449emb|BX040211.1|CNS0936V Single read from an extremity of a full-... 42 7.3
450emb|BX040210.1|CNS0936U Single read from an extremity of a full-... 42 7.3
451emb|BX039593.1|CNS092PP Single read from an extremity of a full-... 42 7.3
452emb|BX039720.1|CNS092T8 Single read from an extremity of a full-... 42 7.3
453emb|BX038556.1|CNS091WW Single read from an extremity of a full-... 42 7.3
454emb|BX038555.1|CNS091WV Single read from an extremity of a full-... 42 7.3
455emb|BX038383.1|CNS091S3 Single read from an extremity of a full-... 42 7.3
456emb|BX038382.1|CNS091S2 Single read from an extremity of a full-... 42 7.3
457emb|BX038371.1|CNS091RR Single read from an extremity of a full-... 42 7.3
458emb|BX038370.1|CNS091RQ Single read from an extremity of a full-... 42 7.3
459emb|BX038029.1|CNS091I9 Single read from an extremity of a full-... 42 7.3
460emb|BX038028.1|CNS091I8 Single read from an extremity of a full-... 42 7.3
461emb|BX038003.1|CNS091HJ Single read from an extremity of a full-... 42 7.3
462emb|BX038002.1|CNS091HI Single read from an extremity of a full-... 42 7.3
463emb|BX037726.1|CNS0919U Single read from an extremity of a full-... 42 7.3
464emb|BX037704.1|CNS09198 Single read from an extremity of a full-... 42 7.3
465emb|BX037689.1|CNS0918T Single read from an extremity of a full-... 42 7.3
466emb|BX037688.1|CNS0918S Single read from an extremity of a full-... 42 7.3
467emb|BX037669.1|CNS09189 Single read from an extremity of a full-... 42 7.3
468emb|BX037668.1|CNS09188 Single read from an extremity of a full-... 42 7.3
469emb|BX037021.1|CNS090Q9 Single read from an extremity of a full-... 42 7.3
470emb|BX032666.1|CNS08XDA Single read from an extremity of a full-... 42 7.3
471emb|BX032665.1|CNS08XD9 Single read from an extremity of a full-... 42 7.3
472emb|BX032437.1|CNS08X6X Single read from an extremity of a full-... 42 7.3
473emb|BX032436.1|CNS08X6W Single read from an extremity of a full-... 42 7.3
474emb|BX031689.1|CNS08WM5 Single read from an extremity of a full-... 42 7.3
475emb|BX031688.1|CNS08WM4 Single read from an extremity of a full-... 42 7.3
476emb|BX029444.1|CNS08UVS Single read from an extremity of a full-... 42 7.3
477emb|BX029896.1|CNS08V8C Single read from an extremity of a full-... 42 7.3
478emb|BX029613.1|CNS08V0H Single read from an extremity of a full-... 42 7.3
479emb|BX029612.1|CNS08V0G Single read from an extremity of a full-... 42 7.3
480emb|BX028447.1|CNS08U43 Single read from an extremity of a full-... 42 7.3
481emb|BX028274.1|CNS08TZA Single read from an extremity of a full-... 42 7.3
482emb|BX022761.1|CNS08PQ5 Single read from an extremity of a full-... 42 7.3
483emb|BX022760.1|CNS08PQ4 Single read from an extremity of a full-... 42 7.3
484emb|BX021277.1|CNS08OKX Single read from an extremity of a full-... 42 7.3
485emb|BX021276.1|CNS08OKW Single read from an extremity of a full-... 42 7.3
486emb|BX020664.1|CNS08O3W Single read from an extremity of a full-... 42 7.3
487emb|BX020663.1|CNS08O3V Single read from an extremity of a full-... 42 7.3
488emb|BX020342.1|CNS08NUY Single read from an extremity of a full-... 42 7.3
489emb|BX020341.1|CNS08NUX Single read from an extremity of a full-... 42 7.3
490emb|BX020026.1|CNS08NM6 Single read from an extremity of a full-... 42 7.3
491emb|BX017081.1|CNS08LCD Single read from an extremity of a full-... 42 7.3
492emb|BX017080.1|CNS08LCC Single read from an extremity of a full-... 42 7.3
493emb|BX016439.1|CNS08KUJ Single read from an extremity of a full-... 42 7.3
494emb|BX016092.1|CNS08KKW Single read from an extremity of a full-... 42 7.3
495emb|BX016091.1|CNS08KKV Single read from an extremity of a full-... 42 7.3
496emb|BX015695.1|CNS08K9V Single read from an extremity of a full-... 42 7.3
497emb|BX015595.1|CNS08K73 Single read from an extremity of a full-... 42 7.3
498emb|BX015295.1|CNS08JYR Single read from an extremity of a full-... 42 7.3
499emb|BX014967.1|CNS08JPN Single read from an extremity of a full-... 42 7.3
500emb|AL591222.2|HS378I6 Homo sapiens chromosome 9 BAC RP11-378I6,... 42 7.3

>ref|NM_001067942.1| Oryza sativa (japonica cultivar-group) Os08g0267300 (Os08g0267300)
            mRNA, complete cds
          Length = 1575
 Score =  509 bits (257), Expect = e-140
 Identities = 425/481 (88%)
 Strand = Plus / Plus

                                                                        
Query: 963  gcgagagatgctactacgggctaggctatggcgacgggtcgttcagccgcggcgtgctgg 1022
            ||||||| |||||||||  ||| | ||| ||||||||||||||||||||||||||||| |
Sbjct: 746  gcgagaggtgctactactcgctggcctacggcgacgggtcgttcagccgcggcgtgctcg 805

                                                                        
Query: 1023 ccacggacacggtcggcctcggcggcgccaagctcgacgccttcgtgtttggctgcgggc 1082
            |||||||||||||||  |||||||||||||   |||||| ||||||||| ||||||||||
Sbjct: 806  ccacggacacggtcgcgctcggcggcgccagcgtcgacggcttcgtgttcggctgcgggc 865

                                                                        
Query: 1083 tcagcaaccacggcctgttcggtggcacagcggggctcatgggcctcggccggacggaac 1142
            ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |
Sbjct: 866  tcagcaaccgcggcctgttcggcggcacggcggggctcatgggcctcggccggacggagc 925

                                                                        
Query: 1143 tgtcgctggtctcccagacggcatcccgcttcggcggcgtgttctcctactgcttgccgg 1202
            | ||||||||||||||||||||  |||| ||||||||||| |||||||||||| | || |
Sbjct: 926  tctcgctggtctcccagacggcgccccggttcggcggcgtcttctcctactgcctccccg 985

                                                                        
Query: 1203 cgaccacctccggcgactccacgggttccctctccctgggcagcgacccatcctcctacc 1262
            |  |||||||||||||| || |||| ||||||||||| ||| ||||| | ||||||||||
Sbjct: 986  ccgccacctccggcgacgccgcgggctccctctccctcggcggcgacacctcctcctacc 1045

                                                                        
Query: 1263 gcaacacgacgcccgtggcatacacccgcatgatcgcggacccggcgcagccccctttct 1322
            ||||| | ||||| ||| | ||||||||||||||||| |||||||||||||| || ||||
Sbjct: 1046 gcaacgccacgccggtgtcctacacccgcatgatcgccgacccggcgcagccgccgttct 1105

                                                                        
Query: 1323 acttcatgaacgtcaccggcgcgtccgtcggcggagccgcggtgaccgcgtcggggctcg 1382
            ||||||||||||| |||||||||||||||||||| ||||||||| ||||| |||||||||
Sbjct: 1106 acttcatgaacgtgaccggcgcgtccgtcggcggcgccgcggtggccgcggcggggctcg 1165

                                                                        
Query: 1383 gcgcccgcaacgtgctcatcgactcgggcacggtgatcacgcggctggcgccgtccgtgt 1442
            | |||  |||||| ||| ||||||| ||||||||||||||||| || |||||||| ||||
Sbjct: 1166 gtgccgccaacgtcctcctcgactccggcacggtgatcacgcgcctcgcgccgtcggtgt 1225

             
Query: 1443 a 1443
            |
Sbjct: 1226 a 1226



 Score =  278 bits (140), Expect = 7e-71
 Identities = 239/272 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1508 ttctcgctcctcgacacgtgctacaacctgacgggccacgacgaggtgaacgtgccactg 1567
            |||||||| |||||| |||||||||||||||| || |||||||||||||| |||||| ||
Sbjct: 1291 ttctcgctgctcgacgcgtgctacaacctgaccgggcacgacgaggtgaaggtgccattg 1350

                                                                        
Query: 1568 ctgacgctacggctcgagggcggcgccgacatgaccgtggaggccgccgggatgctgttc 1627
            |||||||| || |||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 1351 ctgacgctgcgcctcgagggcggcgccgacatgaccgtcgacgctgccgggatgctgttc 1410

                                                                        
Query: 1628 atggccaagaaggacgggtctcaggtgtgcctggcgatggcgagcctcccgtacgaggac 1687
            ||||| | |||||| ||||| ||||||||| |||| |||||||||||| | | ||| |||
Sbjct: 1411 atggcgaggaaggatgggtcgcaggtgtgcttggccatggcgagcctctcattcgaagac 1470

                                                                        
Query: 1688 cagacgcctatcatagggaactaccagcagaagaacaagagggtcgtgtatgacacggtg 1747
            |||||||| || || || |||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 1471 cagacgcccattattggcaactaccagcagaagaacaagagggtagtgtatgacactgtg 1530

                                            
Query: 1748 cgctctgggctaggttttgctgacgaagattg 1779
             ||||  ||||||| |||||||| || |||||
Sbjct: 1531 ggctcaaggctaggctttgctgatgaggattg 1562



 Score =  182 bits (92), Expect = 3e-42
 Identities = 173/200 (86%)
 Strand = Plus / Plus

                                                                       
Query: 751 cgccgccaagctcaacgtcatcgtggacaccggcagcgacctcacctgggtgcagtgcaa 810
           ||||| ||| |||| ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 516 cgccggcaacctcaccgtcatcgtcgacaccggcagcgacctcacctgggtgcagtgcaa 575

                                                                       
Query: 811 gccctgccgtgcctgctacgagcagcgggacccgctcttcgaccccgctagctccgccac 870
           ||| |||   | |||||||| |||||| |||||||| ||||||||  |  |||||||| |
Sbjct: 576 gccgtgctccgtctgctacgcgcagcgcgacccgctgttcgacccgtccggctccgcctc 635

                                                                       
Query: 871 ctacgccgccgtcccgtgcaacgcctccgcctgcgcggcctcgctgaaggaggccaccgg 930
           ||||||||||||||| ||||| |||||||||||||  ||||| || |||| |||||||||
Sbjct: 636 ctacgccgccgtcccctgcaatgcctccgcctgcgaagcctccctcaaggcggccaccgg 695

                               
Query: 931 cgcgcccggattctgcgcca 950
           || ||| |||| ||||||||
Sbjct: 696 cgtgccgggatcctgcgcca 715



 Score = 89.7 bits (45), Expect = 3e-14
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                       
Query: 669 aggtccctctgacctctggcattcgcttccagacactcaactacgtcaccaccatcgcgc 728
           ||||||| |||||||| ||||| ||||||||||| ||||||||||||||||||||||| |
Sbjct: 428 aggtccccctgacctccggcatccgcttccagacgctcaactacgtcaccaccatcgctc 487

                
Query: 729 tcggc 733
           |||||
Sbjct: 488 tcggc 492



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8
          Length = 28434780

 Score =  509 bits (257), Expect = e-140
 Identities = 425/481 (88%)
 Strand = Plus / Minus

                                                                            
Query: 963      gcgagagatgctactacgggctaggctatggcgacgggtcgttcagccgcggcgtgctgg 1022
                ||||||| |||||||||  ||| | ||| ||||||||||||||||||||||||||||| |
Sbjct: 10184625 gcgagaggtgctactactcgctggcctacggcgacgggtcgttcagccgcggcgtgctcg 10184566

                                                                            
Query: 1023     ccacggacacggtcggcctcggcggcgccaagctcgacgccttcgtgtttggctgcgggc 1082
                |||||||||||||||  |||||||||||||   |||||| ||||||||| ||||||||||
Sbjct: 10184565 ccacggacacggtcgcgctcggcggcgccagcgtcgacggcttcgtgttcggctgcgggc 10184506

                                                                            
Query: 1083     tcagcaaccacggcctgttcggtggcacagcggggctcatgggcctcggccggacggaac 1142
                ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |
Sbjct: 10184505 tcagcaaccgcggcctgttcggcggcacggcggggctcatgggcctcggccggacggagc 10184446

                                                                            
Query: 1143     tgtcgctggtctcccagacggcatcccgcttcggcggcgtgttctcctactgcttgccgg 1202
                | ||||||||||||||||||||  |||| ||||||||||| |||||||||||| | || |
Sbjct: 10184445 tctcgctggtctcccagacggcgccccggttcggcggcgtcttctcctactgcctccccg 10184386

                                                                            
Query: 1203     cgaccacctccggcgactccacgggttccctctccctgggcagcgacccatcctcctacc 1262
                |  |||||||||||||| || |||| ||||||||||| ||| ||||| | ||||||||||
Sbjct: 10184385 ccgccacctccggcgacgccgcgggctccctctccctcggcggcgacacctcctcctacc 10184326

                                                                            
Query: 1263     gcaacacgacgcccgtggcatacacccgcatgatcgcggacccggcgcagccccctttct 1322
                ||||| | ||||| ||| | ||||||||||||||||| |||||||||||||| || ||||
Sbjct: 10184325 gcaacgccacgccggtgtcctacacccgcatgatcgccgacccggcgcagccgccgttct 10184266

                                                                            
Query: 1323     acttcatgaacgtcaccggcgcgtccgtcggcggagccgcggtgaccgcgtcggggctcg 1382
                ||||||||||||| |||||||||||||||||||| ||||||||| ||||| |||||||||
Sbjct: 10184265 acttcatgaacgtgaccggcgcgtccgtcggcggcgccgcggtggccgcggcggggctcg 10184206

                                                                            
Query: 1383     gcgcccgcaacgtgctcatcgactcgggcacggtgatcacgcggctggcgccgtccgtgt 1442
                | |||  |||||| ||| ||||||| ||||||||||||||||| || |||||||| ||||
Sbjct: 10184205 gtgccgccaacgtcctcctcgactccggcacggtgatcacgcgcctcgcgccgtcggtgt 10184146

                 
Query: 1443     a 1443
                |
Sbjct: 10184145 a 10184145



 Score =  278 bits (140), Expect = 7e-71
 Identities = 239/272 (87%)
 Strand = Plus / Minus

                                                                            
Query: 1508     ttctcgctcctcgacacgtgctacaacctgacgggccacgacgaggtgaacgtgccactg 1567
                |||||||| |||||| |||||||||||||||| || |||||||||||||| |||||| ||
Sbjct: 10184080 ttctcgctgctcgacgcgtgctacaacctgaccgggcacgacgaggtgaaggtgccattg 10184021

                                                                            
Query: 1568     ctgacgctacggctcgagggcggcgccgacatgaccgtggaggccgccgggatgctgttc 1627
                |||||||| || |||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 10184020 ctgacgctgcgcctcgagggcggcgccgacatgaccgtcgacgctgccgggatgctgttc 10183961

                                                                            
Query: 1628     atggccaagaaggacgggtctcaggtgtgcctggcgatggcgagcctcccgtacgaggac 1687
                ||||| | |||||| ||||| ||||||||| |||| |||||||||||| | | ||| |||
Sbjct: 10183960 atggcgaggaaggatgggtcgcaggtgtgcttggccatggcgagcctctcattcgaagac 10183901

                                                                            
Query: 1688     cagacgcctatcatagggaactaccagcagaagaacaagagggtcgtgtatgacacggtg 1747
                |||||||| || || || |||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 10183900 cagacgcccattattggcaactaccagcagaagaacaagagggtagtgtatgacactgtg 10183841

                                                
Query: 1748     cgctctgggctaggttttgctgacgaagattg 1779
                 ||||  ||||||| |||||||| || |||||
Sbjct: 10183840 ggctcaaggctaggctttgctgatgaggattg 10183809



 Score =  182 bits (92), Expect = 3e-42
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                            
Query: 751      cgccgccaagctcaacgtcatcgtggacaccggcagcgacctcacctgggtgcagtgcaa 810
                ||||| ||| |||| ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 10184855 cgccggcaacctcaccgtcatcgtcgacaccggcagcgacctcacctgggtgcagtgcaa 10184796

                                                                            
Query: 811      gccctgccgtgcctgctacgagcagcgggacccgctcttcgaccccgctagctccgccac 870
                ||| |||   | |||||||| |||||| |||||||| ||||||||  |  |||||||| |
Sbjct: 10184795 gccgtgctccgtctgctacgcgcagcgcgacccgctgttcgacccgtccggctccgcctc 10184736

                                                                            
Query: 871      ctacgccgccgtcccgtgcaacgcctccgcctgcgcggcctcgctgaaggaggccaccgg 930
                ||||||||||||||| ||||| |||||||||||||  ||||| || |||| |||||||||
Sbjct: 10184735 ctacgccgccgtcccctgcaatgcctccgcctgcgaagcctccctcaaggcggccaccgg 10184676

                                    
Query: 931      cgcgcccggattctgcgcca 950
                || ||| |||| ||||||||
Sbjct: 10184675 cgtgccgggatcctgcgcca 10184656



 Score = 89.7 bits (45), Expect = 3e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                            
Query: 669      aggtccctctgacctctggcattcgcttccagacactcaactacgtcaccaccatcgcgc 728
                ||||||| |||||||| ||||| ||||||||||| ||||||||||||||||||||||| |
Sbjct: 10184943 aggtccccctgacctccggcatccgcttccagacgctcaactacgtcaccaccatcgctc 10184884

                     
Query: 729      tcggc 733
                |||||
Sbjct: 10184883 tcggc 10184879



 Score = 65.9 bits (33), Expect = 5e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                             
Query: 768      tcatcgtggacaccggcagcgacctcacctgggtgcagtgcaagc 812
                ||||||||||||||||||||||||||| ||||  |||||||||||
Sbjct: 23062146 tcatcgtggacaccggcagcgacctcatctggacgcagtgcaagc 23062190



 Score = 48.1 bits (24), Expect = 0.12
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                    
Query: 773      gtggacaccggcagcgacctcacctgggtgcagtgc 808
                |||||||||||||||||||||| ||||  |||||||
Sbjct: 23058717 gtggacaccggcagcgacctcatctggacgcagtgc 23058752



to top

>dbj|AP006064.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0023I13
          Length = 165911

 Score =  509 bits (257), Expect = e-140
 Identities = 425/481 (88%)
 Strand = Plus / Minus

                                                                          
Query: 963    gcgagagatgctactacgggctaggctatggcgacgggtcgttcagccgcggcgtgctgg 1022
              ||||||| |||||||||  ||| | ||| ||||||||||||||||||||||||||||| |
Sbjct: 143971 gcgagaggtgctactactcgctggcctacggcgacgggtcgttcagccgcggcgtgctcg 143912

                                                                          
Query: 1023   ccacggacacggtcggcctcggcggcgccaagctcgacgccttcgtgtttggctgcgggc 1082
              |||||||||||||||  |||||||||||||   |||||| ||||||||| ||||||||||
Sbjct: 143911 ccacggacacggtcgcgctcggcggcgccagcgtcgacggcttcgtgttcggctgcgggc 143852

                                                                          
Query: 1083   tcagcaaccacggcctgttcggtggcacagcggggctcatgggcctcggccggacggaac 1142
              ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |
Sbjct: 143851 tcagcaaccgcggcctgttcggcggcacggcggggctcatgggcctcggccggacggagc 143792

                                                                          
Query: 1143   tgtcgctggtctcccagacggcatcccgcttcggcggcgtgttctcctactgcttgccgg 1202
              | ||||||||||||||||||||  |||| ||||||||||| |||||||||||| | || |
Sbjct: 143791 tctcgctggtctcccagacggcgccccggttcggcggcgtcttctcctactgcctccccg 143732

                                                                          
Query: 1203   cgaccacctccggcgactccacgggttccctctccctgggcagcgacccatcctcctacc 1262
              |  |||||||||||||| || |||| ||||||||||| ||| ||||| | ||||||||||
Sbjct: 143731 ccgccacctccggcgacgccgcgggctccctctccctcggcggcgacacctcctcctacc 143672

                                                                          
Query: 1263   gcaacacgacgcccgtggcatacacccgcatgatcgcggacccggcgcagccccctttct 1322
              ||||| | ||||| ||| | ||||||||||||||||| |||||||||||||| || ||||
Sbjct: 143671 gcaacgccacgccggtgtcctacacccgcatgatcgccgacccggcgcagccgccgttct 143612

                                                                          
Query: 1323   acttcatgaacgtcaccggcgcgtccgtcggcggagccgcggtgaccgcgtcggggctcg 1382
              ||||||||||||| |||||||||||||||||||| ||||||||| ||||| |||||||||
Sbjct: 143611 acttcatgaacgtgaccggcgcgtccgtcggcggcgccgcggtggccgcggcggggctcg 143552

                                                                          
Query: 1383   gcgcccgcaacgtgctcatcgactcgggcacggtgatcacgcggctggcgccgtccgtgt 1442
              | |||  |||||| ||| ||||||| ||||||||||||||||| || |||||||| ||||
Sbjct: 143551 gtgccgccaacgtcctcctcgactccggcacggtgatcacgcgcctcgcgccgtcggtgt 143492

               
Query: 1443   a 1443
              |
Sbjct: 143491 a 143491



 Score =  278 bits (140), Expect = 7e-71
 Identities = 239/272 (87%)
 Strand = Plus / Minus

                                                                          
Query: 1508   ttctcgctcctcgacacgtgctacaacctgacgggccacgacgaggtgaacgtgccactg 1567
              |||||||| |||||| |||||||||||||||| || |||||||||||||| |||||| ||
Sbjct: 143426 ttctcgctgctcgacgcgtgctacaacctgaccgggcacgacgaggtgaaggtgccattg 143367

                                                                          
Query: 1568   ctgacgctacggctcgagggcggcgccgacatgaccgtggaggccgccgggatgctgttc 1627
              |||||||| || |||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 143366 ctgacgctgcgcctcgagggcggcgccgacatgaccgtcgacgctgccgggatgctgttc 143307

                                                                          
Query: 1628   atggccaagaaggacgggtctcaggtgtgcctggcgatggcgagcctcccgtacgaggac 1687
              ||||| | |||||| ||||| ||||||||| |||| |||||||||||| | | ||| |||
Sbjct: 143306 atggcgaggaaggatgggtcgcaggtgtgcttggccatggcgagcctctcattcgaagac 143247

                                                                          
Query: 1688   cagacgcctatcatagggaactaccagcagaagaacaagagggtcgtgtatgacacggtg 1747
              |||||||| || || || |||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 143246 cagacgcccattattggcaactaccagcagaagaacaagagggtagtgtatgacactgtg 143187

                                              
Query: 1748   cgctctgggctaggttttgctgacgaagattg 1779
               ||||  ||||||| |||||||| || |||||
Sbjct: 143186 ggctcaaggctaggctttgctgatgaggattg 143155



 Score =  182 bits (92), Expect = 3e-42
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                          
Query: 751    cgccgccaagctcaacgtcatcgtggacaccggcagcgacctcacctgggtgcagtgcaa 810
              ||||| ||| |||| ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 144201 cgccggcaacctcaccgtcatcgtcgacaccggcagcgacctcacctgggtgcagtgcaa 144142

                                                                          
Query: 811    gccctgccgtgcctgctacgagcagcgggacccgctcttcgaccccgctagctccgccac 870
              ||| |||   | |||||||| |||||| |||||||| ||||||||  |  |||||||| |
Sbjct: 144141 gccgtgctccgtctgctacgcgcagcgcgacccgctgttcgacccgtccggctccgcctc 144082

                                                                          
Query: 871    ctacgccgccgtcccgtgcaacgcctccgcctgcgcggcctcgctgaaggaggccaccgg 930
              ||||||||||||||| ||||| |||||||||||||  ||||| || |||| |||||||||
Sbjct: 144081 ctacgccgccgtcccctgcaatgcctccgcctgcgaagcctccctcaaggcggccaccgg 144022

                                  
Query: 931    cgcgcccggattctgcgcca 950
              || ||| |||| ||||||||
Sbjct: 144021 cgtgccgggatcctgcgcca 144002



 Score = 89.7 bits (45), Expect = 3e-14
 Identities = 60/65 (92%)
 Strand = Plus / Minus

                                                                          
Query: 669    aggtccctctgacctctggcattcgcttccagacactcaactacgtcaccaccatcgcgc 728
              ||||||| |||||||| ||||| ||||||||||| ||||||||||||||||||||||| |
Sbjct: 144289 aggtccccctgacctccggcatccgcttccagacgctcaactacgtcaccaccatcgctc 144230

                   
Query: 729    tcggc 733
              |||||
Sbjct: 144229 tcggc 144225



to top

>dbj|AK105097.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-100-B11, full
            insert sequence
          Length = 2569

 Score =  509 bits (257), Expect = e-140
 Identities = 425/481 (88%)
 Strand = Plus / Plus

                                                                        
Query: 963  gcgagagatgctactacgggctaggctatggcgacgggtcgttcagccgcggcgtgctgg 1022
            ||||||| |||||||||  ||| | ||| ||||||||||||||||||||||||||||| |
Sbjct: 1636 gcgagaggtgctactactcgctggcctacggcgacgggtcgttcagccgcggcgtgctcg 1695

                                                                        
Query: 1023 ccacggacacggtcggcctcggcggcgccaagctcgacgccttcgtgtttggctgcgggc 1082
            |||||||||||||||  |||||||||||||   |||||| ||||||||| ||||||||||
Sbjct: 1696 ccacggacacggtcgcgctcggcggcgccagcgtcgacggcttcgtgttcggctgcgggc 1755

                                                                        
Query: 1083 tcagcaaccacggcctgttcggtggcacagcggggctcatgggcctcggccggacggaac 1142
            ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||| |
Sbjct: 1756 tcagcaaccgcggcctgttcggcggcacggcggggctcatgggcctcggccggacggagc 1815

                                                                        
Query: 1143 tgtcgctggtctcccagacggcatcccgcttcggcggcgtgttctcctactgcttgccgg 1202
            | ||||||||||||||||||||  |||| ||||||||||| |||||||||||| | || |
Sbjct: 1816 tctcgctggtctcccagacggcgccccggttcggcggcgtcttctcctactgcctccccg 1875

                                                                        
Query: 1203 cgaccacctccggcgactccacgggttccctctccctgggcagcgacccatcctcctacc 1262
            |  |||||||||||||| || |||| ||||||||||| ||| ||||| | ||||||||||
Sbjct: 1876 ccgccacctccggcgacgccgcgggctccctctccctcggcggcgacacctcctcctacc 1935

                                                                        
Query: 1263 gcaacacgacgcccgtggcatacacccgcatgatcgcggacccggcgcagccccctttct 1322
            ||||| | ||||| ||| | ||||||||||||||||| |||||||||||||| || ||||
Sbjct: 1936 gcaacgccacgccggtgtcctacacccgcatgatcgccgacccggcgcagccgccgttct 1995

                                                                        
Query: 1323 acttcatgaacgtcaccggcgcgtccgtcggcggagccgcggtgaccgcgtcggggctcg 1382
            ||||||||||||| |||||||||||||||||||| ||||||||| ||||| |||||||||
Sbjct: 1996 acttcatgaacgtgaccggcgcgtccgtcggcggcgccgcggtggccgcggcggggctcg 2055

                                                                        
Query: 1383 gcgcccgcaacgtgctcatcgactcgggcacggtgatcacgcggctggcgccgtccgtgt 1442
            | |||  |||||| ||| ||||||| ||||||||||||||||| || |||||||| ||||
Sbjct: 2056 gtgccgccaacgtcctcctcgactccggcacggtgatcacgcgcctcgcgccgtcggtgt 2115

             
Query: 1443 a 1443
            |
Sbjct: 2116 a 2116



 Score =  278 bits (140), Expect = 7e-71
 Identities = 239/272 (87%)
 Strand = Plus / Plus

                                                                        
Query: 1508 ttctcgctcctcgacacgtgctacaacctgacgggccacgacgaggtgaacgtgccactg 1567
            |||||||| |||||| |||||||||||||||| || |||||||||||||| |||||| ||
Sbjct: 2181 ttctcgctgctcgacgcgtgctacaacctgaccgggcacgacgaggtgaaggtgccattg 2240

                                                                        
Query: 1568 ctgacgctacggctcgagggcggcgccgacatgaccgtggaggccgccgggatgctgttc 1627
            |||||||| || |||||||||||||||||||||||||| || || |||||||||||||||
Sbjct: 2241 ctgacgctgcgcctcgagggcggcgccgacatgaccgtcgacgctgccgggatgctgttc 2300

                                                                        
Query: 1628 atggccaagaaggacgggtctcaggtgtgcctggcgatggcgagcctcccgtacgaggac 1687
            ||||| | |||||| ||||| ||||||||| |||| |||||||||||| | | ||| |||
Sbjct: 2301 atggcgaggaaggatgggtcgcaggtgtgcttggccatggcgagcctctcattcgaagac 2360

                                                                        
Query: 1688 cagacgcctatcatagggaactaccagcagaagaacaagagggtcgtgtatgacacggtg 1747
            |||||||| || || || |||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 2361 cagacgcccattattggcaactaccagcagaagaacaagagggtagtgtatgacactgtg 2420

                                            
Query: 1748 cgctctgggctaggttttgctgacgaagattg 1779
             ||||  ||||||| |||||||| || |||||
Sbjct: 2421 ggctcaaggctaggctttgctgatgaggattg 2452



 Score =  182 bits (92), Expect = 3e-42
 Identities = 173/200 (86%)
 Strand = Plus / Plus

                                                                        
Query: 751  cgccgccaagctcaacgtcatcgtggacaccggcagcgacctcacctgggtgcagtgcaa 810
            ||||| ||| |||| ||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 1406 cgccggcaacctcaccgtcatcgtcgacaccggcagcgacctcacctgggtgcagtgcaa 1465

                                                                        
Query: 811  gccctgccgtgcctgctacgagcagcgggacccgctcttcgaccccgctagctccgccac 870
            ||| |||   | |||||||| |||||| |||||||| ||||||||  |  |||||||| |
Sbjct: 1466 gccgtgctccgtctgctacgcgcagcgcgacccgctgttcgacccgtccggctccgcctc 1525

                                                                        
Query: 871  ctacgccgccgtcccgtgcaacgcctccgcctgcgcggcctcgctgaaggaggccaccgg 930
            ||||||||||||||| ||||| |||||||||||||  ||||| || |||| |||||||||
Sbjct: 1526 ctacgccgccgtcccctgcaatgcctccgcctgcgaagcctccctcaaggcggccaccgg 1585

                                
Query: 931  cgcgcccggattctgcgcca 950
            || ||| |||| ||||||||
Sbjct: 1586 cgtgccgggatcctgcgcca 1605



 Score = 89.7 bits (45), Expect = 3e-14
 Identities = 60/65 (92%)
 Strand = Plus / Plus

                                                                        
Query: 669  aggtccctctgacctctggcattcgcttccagacactcaactacgtcaccaccatcgcgc 728
            ||||||| |||||||| ||||| ||||||||||| ||||||||||||||||||||||| |
Sbjct: 1318 aggtccccctgacctccggcatccgcttccagacgctcaactacgtcaccaccatcgctc 1377

                 
Query: 729  tcggc 733
            |||||
Sbjct: 1378 tcggc 1382



to top

>ref|NM_001070037.1| Oryza sativa (japonica cultivar-group) Os09g0482300 (Os09g0482300)
            mRNA, complete cds
          Length = 1723

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 776  gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
            |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 1355 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 1296

                                
Query: 836  cgggacccgctcttcgaccc 855
            | ||||||||| ||||||||
Sbjct: 1295 caggacccgctgttcgaccc 1276



to top

>ref|NM_001070036.1| Oryza sativa (japonica cultivar-group) Os09g0482200 (Os09g0482200)
           mRNA, complete cds
          Length = 1608

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                       
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
           |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 586 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 645

                               
Query: 836 cgggacccgctcttcgaccc 855
           | ||||||||| ||||||||
Sbjct: 646 caggacccgctgttcgaccc 665



to top

>gb|AC108761.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
            OSJNBa0087J09, complete sequence
          Length = 153351

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                        
Query: 776  gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
            |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 7695 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 7754

                                
Query: 836  cgggacccgctcttcgaccc 855
            | ||||||||| ||||||||
Sbjct: 7755 caggacccgctgttcgaccc 7774



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9
          Length = 22696651

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                            
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
                |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 18468230 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 18468289

                                    
Query: 836      cgggacccgctcttcgaccc 855
                | ||||||||| ||||||||
Sbjct: 18468290 caggacccgctgttcgaccc 18468309



 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                            
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
                |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 18479689 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 18479748

                                    
Query: 836      cgggacccgctcttcgaccc 855
                | ||||||||| ||||||||
Sbjct: 18479749 caggacccgctgttcgaccc 18479768



 Score = 46.1 bits (23), Expect = 0.47
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 770      atcgtggacaccggcagcgacctcacctgggtgcagtgc 808
                ||||||||||| |  ||||| ||||||||||||||||||
Sbjct: 15291069 atcgtggacacggcgagcgagctcacctgggtgcagtgc 15291107



 Score = 46.1 bits (23), Expect = 0.47
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 774      tggacaccggcagcgacctcacctgggtgcagtgc 808
                ||||||||||||||||||||| ||||  |||||||
Sbjct: 16923206 tggacaccggcagcgacctcatctggacgcagtgc 16923240



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                 
Query: 776      gacaccggcagcgacctcacctgggtgcagtgc 808
                ||||||||||||||||||| ||||  |||||||
Sbjct: 16915924 gacaccggcagcgacctcatctggacgcagtgc 16915956



to top

>dbj|AP005392.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
              clone:P0463D04
          Length = 145828

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                          
Query: 776    gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
              |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 130104 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 130163

                                  
Query: 836    cgggacccgctcttcgaccc 855
              | ||||||||| ||||||||
Sbjct: 130164 caggacccgctgttcgaccc 130183



 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                          
Query: 776    gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
              |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 141563 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 141622

                                  
Query: 836    cgggacccgctcttcgaccc 855
              | ||||||||| ||||||||
Sbjct: 141623 caggacccgctgttcgaccc 141642



to top

>dbj|AK108029.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-137-B01, full
            insert sequence
          Length = 1723

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 776  gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
            |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 1355 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 1296

                                
Query: 836  cgggacccgctcttcgaccc 855
            | ||||||||| ||||||||
Sbjct: 1295 caggacccgctgttcgaccc 1276



to top

>dbj|AK105666.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-200-H10, full
           insert sequence
          Length = 1608

 Score = 87.7 bits (44), Expect = 1e-13
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                       
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagcag 835
           |||||||||||||||||  | |||||||||||||||||||||   | |||||||||||||
Sbjct: 586 gacaccggcagcgacctgtcgtgggtgcagtgcaagccctgcgccgactgctacgagcag 645

                               
Query: 836 cgggacccgctcttcgaccc 855
           | ||||||||| ||||||||
Sbjct: 646 caggacccgctgttcgaccc 665



to top

>ref|NM_001068546.1| Oryza sativa (japonica cultivar-group) Os08g0469100 (Os08g0469100)
           mRNA, complete cds
          Length = 1298

 Score = 65.9 bits (33), Expect = 5e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 768 tcatcgtggacaccggcagcgacctcacctgggtgcagtgcaagc 812
           ||||||||||||||||||||||||||| ||||  |||||||||||
Sbjct: 85  tcatcgtggacaccggcagcgacctcatctggacgcagtgcaagc 129



to top

>dbj|AP004585.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0470B03
          Length = 163371

 Score = 65.9 bits (33), Expect = 5e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                           
Query: 768    tcatcgtggacaccggcagcgacctcacctgggtgcagtgcaagc 812
              ||||||||||||||||||||||||||| ||||  |||||||||||
Sbjct: 121874 tcatcgtggacaccggcagcgacctcatctggacgcagtgcaagc 121918



 Score = 48.1 bits (24), Expect = 0.12
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                  
Query: 773    gtggacaccggcagcgacctcacctgggtgcagtgc 808
              |||||||||||||||||||||| ||||  |||||||
Sbjct: 118445 gtggacaccggcagcgacctcatctggacgcagtgc 118480



to top

>dbj|AK108789.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-151-B04, full
           insert sequence
          Length = 1298

 Score = 65.9 bits (33), Expect = 5e-07
 Identities = 42/45 (93%)
 Strand = Plus / Plus

                                                        
Query: 768 tcatcgtggacaccggcagcgacctcacctgggtgcagtgcaagc 812
           ||||||||||||||||||||||||||| ||||  |||||||||||
Sbjct: 85  tcatcgtggacaccggcagcgacctcatctggacgcagtgcaagc 129



to top

>emb|CT834123.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA039O02, full
            insert sequence
          Length = 771

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                  
Query: 1398 tcatcgactcgggcacggtgatcacgcggctggcgccg 1435
            |||||||||| ||||||||||||||||||||| |||||
Sbjct: 156  tcatcgactccggcacggtgatcacgcggctgccgccg 193



to top

>ref|NM_001053197.1| Oryza sativa (japonica cultivar-group) Os02g0314600 (Os02g0314600)
           mRNA, complete cds
          Length = 1967

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 774 tggacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagc 833
           ||||||||||||||||||||| |||| ||||||||  ||||||||  |  |||| |||||
Sbjct: 639 tggacaccggcagcgacctcaactggctgcagtgcgcgccctgcctcgattgcttcgagc 698

                                 
Query: 834 agcgggacccgctcttcgaccc 855
           |||| | |||| | ||||||||
Sbjct: 699 agcgcggcccggtgttcgaccc 720



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6
          Length = 30731886

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                      
Query: 1398     tcatcgactcgggcacggtgatcacgcggctggcgccg 1435
                |||||||||| ||||||||||||||||||||| |||||
Sbjct: 11330533 tcatcgactccggcacggtgatcacgcggctgccgccg 11330496



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                          
Query: 832    gcagcgggacccgctcttcgaccccgctagctccgccacctacgccgccgtcccgtgcaa 891
              |||||||||||| || |||||||| || | |||  |||| |||||||||||||| |||| 
Sbjct: 978579 gcagcgggaccccctgttcgacccggccacctcgaccacgtacgccgccgtcccttgcag 978520

                              
Query: 892    cgcctccgcctgcgcg 907
              | || |||||||||||
Sbjct: 978519 ctccgccgcctgcgcg 978504



 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                      
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
                |||||||||||||||||  | |||||||||||||||||
Sbjct: 11426188 gacaccggcagcgacctgtcgtgggtgcagtgcaagcc 11426225



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                      
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
                |||||||||||||||||  | |||||||||||| ||||
Sbjct: 11398682 gacaccggcagcgacctgtcgtgggtgcagtgccagcc 11398719



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                      
Query: 824      tgctacgagcagcgggacccgctcttcgaccccgctagctccgccacctacgcc 877
                |||||||||||||||||   ||| |||||||| || |||||  |||||||||||
Sbjct: 23969227 tgctacgagcagcgggagaagctgttcgacccggcgagctcgtccacctacgcc 23969280



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                        
Query: 867     ccacctacgccgccgtcccgtgcaacgcctccgcctgcgcg 907
               |||| |||||||||||||| |||| | || |||||||||||
Sbjct: 1063765 ccacgtacgccgccgtcccctgcacctccgccgcctgcgcg 1063725



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 1401     tcgactcgggcacggtgatcacgcg 1425
                ||||||| |||||||||||||||||
Sbjct: 23969759 tcgactccggcacggtgatcacgcg 23969783



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                            
Query: 774      tggacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagc 833
                ||||||||||||||||||||| |||| ||||||||  ||||||||  |  |||| |||||
Sbjct: 12464165 tggacaccggcagcgacctcaactggctgcagtgcgcgccctgcctcgattgcttcgagc 12464224

                                      
Query: 834      agcgggacccgctcttcgaccc 855
                |||| | |||| | ||||||||
Sbjct: 12464225 agcgcggcccggtgttcgaccc 12464246



 Score = 52.0 bits (26), Expect = 0.008
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                              
Query: 773      gtggacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
                |||||||||||||||||| |  | ||||||||||||||||| ||||
Sbjct: 29908327 gtggacaccggcagcgacgtgtcgtgggtgcagtgcaagccgtgcc 29908372



 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                            
Query: 1398     tcatcgactcgggcacggtgatcacgcg 1425
                |||||||||| |||||||||||||||||
Sbjct: 29933856 tcatcgactccggcacggtgatcacgcg 29933883



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                  
Query: 1401     tcgactcgggcacggtgatcacgcggctggcgcc 1434
                ||||| ||||||||||| ||||||||||| ||||
Sbjct: 29908925 tcgacacgggcacggtggtcacgcggctgccgcc 29908958



to top

>dbj|AP006164.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1386G10
          Length = 121827

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                   
Query: 1398  tcatcgactcgggcacggtgatcacgcggctggcgccg 1435
             |||||||||| ||||||||||||||||||||| |||||
Sbjct: 18242 tcatcgactccggcacggtgatcacgcggctgccgccg 18205



 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                    
Query: 776    gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
              |||||||||||||||||  | |||||||||||||||||
Sbjct: 113897 gacaccggcagcgacctgtcgtgggtgcagtgcaagcc 113934



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 776   gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
             |||||||||||||||||  | |||||||||||| ||||
Sbjct: 86391 gacaccggcagcgacctgtcgtgggtgcagtgccagcc 86428



to top

>dbj|AP004891.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0705A04
          Length = 182468

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                          
Query: 774    tggacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagc 833
              ||||||||||||||||||||| |||| ||||||||  ||||||||  |  |||| |||||
Sbjct: 144302 tggacaccggcagcgacctcaactggctgcagtgcgcgccctgcctcgattgcttcgagc 144361

                                    
Query: 834    agcgggacccgctcttcgaccc 855
              |||| | |||| | ||||||||
Sbjct: 144362 agcgcggcccggtgttcgaccc 144383



to top

>dbj|AK120604.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013150B18, full
            insert sequence
          Length = 1871

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                  
Query: 1398 tcatcgactcgggcacggtgatcacgcggctggcgccg 1435
            |||||||||| ||||||||||||||||||||| |||||
Sbjct: 1096 tcatcgactccggcacggtgatcacgcggctgccgccg 1133



to top

>dbj|AK102614.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033099D18, full
            insert sequence
          Length = 1868

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                  
Query: 1398 tcatcgactcgggcacggtgatcacgcggctggcgccg 1435
            |||||||||| ||||||||||||||||||||| |||||
Sbjct: 1096 tcatcgactccggcacggtgatcacgcggctgccgccg 1133



to top

>dbj|AK068924.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170E21, full
           insert sequence
          Length = 1967

 Score = 60.0 bits (30), Expect = 3e-05
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                       
Query: 774 tggacaccggcagcgacctcacctgggtgcagtgcaagccctgccgtgcctgctacgagc 833
           ||||||||||||||||||||| |||| ||||||||  ||||||||  |  |||| |||||
Sbjct: 639 tggacaccggcagcgacctcaactggctgcagtgcgcgccctgcctcgattgcttcgagc 698

                                 
Query: 834 agcgggacccgctcttcgaccc 855
           |||| | |||| | ||||||||
Sbjct: 699 agcgcggcccggtgttcgaccc 720



to top

>ref|NM_001072833.1| Oryza sativa (japonica cultivar-group) Os12g0177500 (Os12g0177500)
           mRNA, complete cds
          Length = 1818

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 776 gacaccggcagcgacctcacctgggtgcagtgc 808
           |||||||||||||||||||||||| ||||||||
Sbjct: 289 gacaccggcagcgacctcacctggctgcagtgc 321



to top

>ref|NM_001072448.1| Oryza sativa (japonica cultivar-group) Os11g0184500 (Os11g0184500)
           mRNA, complete cds
          Length = 291

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 776 gacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||||||||||||||||||| |||||
Sbjct: 184 gacaccggcagcgacctcacctgggtggagtgc 216



to top

>gb|AC134047.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0052O08 map MAP_LOC, complete sequence
          Length = 154839

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                              
Query: 776   gacaccggcagcgacctcacctgggtgcagtgc 808
             ||||||||||||||||||||||||||| |||||
Sbjct: 50154 gacaccggcagcgacctcacctgggtggagtgc 50186



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                             
Query: 776   gacaccggcagcgacctcacctgggtgcagtg 807
             |||||||||||||||||||||||| |||||||
Sbjct: 10602 gacaccggcagcgacctcacctggctgcagtg 10633



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 776   gacaccggcagcgacctcacctgggtgcagtgc 808
             ||||||||||||  |||||||||| ||||||||
Sbjct: 57424 gacaccggcagcaccctcacctggctgcagtgc 57456



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                                
Query: 776     gacaccggcagcgacctcacctgggtgcagtgc 808
               |||||||||||||||||||||||| ||||||||
Sbjct: 3932092 gacaccggcagcgacctcacctggctgcagtgc 3932124



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                                
Query: 776     gacaccggcagcgacctcacctgggtgcagtgc 808
               ||||||||||||||||||||||||||| |||||
Sbjct: 4268644 gacaccggcagcgacctcacctgggtggagtgc 4268676



 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                               
Query: 776     gacaccggcagcgacctcacctgggtgcagtg 807
               |||||||||||||||||||||||| |||||||
Sbjct: 4229092 gacaccggcagcgacctcacctggctgcagtg 4229123



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 776     gacaccggcagcgacctcacctgggtgcagtgc 808
               ||||||||||||  |||||||||| ||||||||
Sbjct: 4275914 gacaccggcagcaccctcacctggctgcagtgc 4275946



to top

>dbj|AK064771.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000A17, full
           insert sequence
          Length = 1820

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 776 gacaccggcagcgacctcacctgggtgcagtgc 808
           |||||||||||||||||||||||| ||||||||
Sbjct: 290 gacaccggcagcgacctcacctggctgcagtgc 322



to top

>emb|AL732376.2|CNS08C8Z Oryza sativa chromosome 12, . BAC OSJNBa0086B10 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 152090

 Score = 58.0 bits (29), Expect = 1e-04
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                              
Query: 776   gacaccggcagcgacctcacctgggtgcagtgc 808
             |||||||||||||||||||||||| ||||||||
Sbjct: 94068 gacaccggcagcgacctcacctggctgcagtgc 94100



to top

>ref|NM_001072445.1| Oryza sativa (japonica cultivar-group) Os11g0183900 (Os11g0183900)
           mRNA, complete cds
          Length = 1693

 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 776 gacaccggcagcgacctcacctgggtgcagtg 807
           |||||||||||||||||||||||| |||||||
Sbjct: 353 gacaccggcagcgacctcacctggctgcagtg 384



to top

>dbj|AP003564.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:OSJNBa0062J13
          Length = 152837

 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                         
Query: 832   gcagcgggacccgctcttcgaccccgctagctccgccacctacgccgccgtcccgtgcaa 891
             |||||||||||| || |||||||| || | |||  |||| |||||||||||||| |||| 
Sbjct: 41452 gcagcgggaccccctgttcgacccggccacctcgaccacgtacgccgccgtcccttgcag 41393

                             
Query: 892   cgcctccgcctgcgcg 907
             | || |||||||||||
Sbjct: 41392 ctccgccgcctgcgcg 41377



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 867    ccacctacgccgccgtcccgtgcaacgcctccgcctgcgcg 907
              |||| |||||||||||||| |||| | || |||||||||||
Sbjct: 126638 ccacgtacgccgccgtcccctgcacctccgccgcctgcgcg 126598



to top

>dbj|AK068348.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013146J21, full
           insert sequence
          Length = 1694

 Score = 56.0 bits (28), Expect = 5e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 776 gacaccggcagcgacctcacctgggtgcagtg 807
           |||||||||||||||||||||||| |||||||
Sbjct: 354 gacaccggcagcgacctcacctggctgcagtg 385



to top

>ref|NM_001062821.1| Oryza sativa (japonica cultivar-group) Os05g0557100 (Os05g0557100)
           mRNA, complete cds
          Length = 1485

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 776 gacaccggcagcgacctcacctgggt 801
           ||||||||||||||||||||||||||
Sbjct: 382 gacaccggcagcgacctcacctgggt 407



to top

>ref|NM_001060796.1| Oryza sativa (japonica cultivar-group) Os04g0677100 (Os04g0677100)
           mRNA, complete cds
          Length = 1422

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 771 tcgtggacaccggcagcgacctcacctgggtgcagtgc 808
           |||||||| ||||||||||| ||| |||||||||||||
Sbjct: 437 tcgtggactccggcagcgacgtcatctgggtgcagtgc 474



to top

>ref|NM_001050401.1| Oryza sativa (japonica cultivar-group) Os01g0679500 (Os01g0679500)
           mRNA, complete cds
          Length = 1455

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                     
Query: 776 gacaccggcagcgacctcacctgggt 801
           ||||||||||||||||||||||||||
Sbjct: 313 gacaccggcagcgacctcacctgggt 338



to top

>ref|NM_001048514.1| Oryza sativa (japonica cultivar-group) Os01g0140100 (Os01g0140100)
           mRNA, complete cds
          Length = 1832

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
           ||||||||||||||| ||||||||||||| ||| ||||
Sbjct: 583 gacaccggcagcgacgtcacctgggtgcaatgccagcc 620



to top

>emb|AL732349.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0402C08, complete
             sequence
          Length = 100836

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 771   tcgtggacaccggcagcgacctcacctgggtgcagtgc 808
             |||||||| ||||||||||| ||| |||||||||||||
Sbjct: 28551 tcgtggactccggcagcgacgtcatctgggtgcagtgc 28514



to top

>gb|AC104709.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03,
             complete sequence
          Length = 144601

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                       
Query: 776   gacaccggcagcgacctcacctgggt 801
             ||||||||||||||||||||||||||
Sbjct: 80699 gacaccggcagcgacctcacctgggt 80674



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                          
Query: 767      gtcatcgtggacaccggcagcgacctcacctgggtgcagtgc 808
                |||||||| |||||||||||| |||||| ||||| |||||||
Sbjct: 20866838 gtcatcgtcgacaccggcagcaacctcatctgggcgcagtgc 20866797



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                          
Query: 776      gacaccggcagcgacctcacctgggt 801
                ||||||||||||||||||||||||||
Sbjct: 27484569 gacaccggcagcgacctcacctgggt 27484544



 Score = 46.1 bits (23), Expect = 0.47
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 1508     ttctcgctcctcgacacgtgctacaacctga 1538
                ||||||||  |||||||||||||||||||||
Sbjct: 29159904 ttctcgctgttcgacacgtgctacaacctga 29159874



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4
          Length = 35498469

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                      
Query: 771      tcgtggacaccggcagcgacctcacctgggtgcagtgc 808
                |||||||| ||||||||||| ||| |||||||||||||
Sbjct: 34622930 tcgtggactccggcagcgacgtcatctgggtgcagtgc 34622893



 Score = 50.1 bits (25), Expect = 0.030
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                         
Query: 769      catcgtggacaccggcagcgacctc 793
                |||||||||||||||||||||||||
Sbjct: 22323168 catcgtggacaccggcagcgacctc 22323192



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                          
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
                ||||||| ||||||||||| ||||  ||||||| ||||||||
Sbjct: 22328782 gacaccgccagcgacctcatctggacgcagtgccagccctgc 22328823



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                          
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
                |||||||||||||||||| | |||  ||||||| ||||||||
Sbjct: 30049044 gacaccggcagcgacctctcgtggacgcagtgcgagccctgc 30049085



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                          
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
                |||||||||||||||||| | |||  ||||||| ||||||||
Sbjct: 30109747 gacaccggcagcgacctctcgtggacgcagtgcgagccctgc 30109788



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                     
Query: 776     gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
               ||||||||||||||| ||||||||||||| ||| ||||
Sbjct: 2120071 gacaccggcagcgacgtcacctgggtgcaatgccagcc 2120108



 Score = 52.0 bits (26), Expect = 0.008
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                          
Query: 776      gacaccggcagcgacctcacctgggt 801
                ||||||||||||||||||||||||||
Sbjct: 27950508 gacaccggcagcgacctcacctgggt 27950533



 Score = 50.1 bits (25), Expect = 0.030
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                                 
Query: 1403     gactcgggcacggtgatcacgcggctggcgccg 1435
                ||||| ||||||||||||||||||||| |||||
Sbjct: 24015699 gactccggcacggtgatcacgcggctgccgccg 24015731



to top

>emb|AL606668.2|OSJN00083 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064G10,
             complete sequence
          Length = 150206

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 771   tcgtggacaccggcagcgacctcacctgggtgcagtgc 808
             |||||||| ||||||||||| ||| |||||||||||||
Sbjct: 77052 tcgtggactccggcagcgacgtcatctgggtgcagtgc 77015



to top

>dbj|AP006753.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0039D04
          Length = 184408

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                       
Query: 767   gtcatcgtggacaccggcagcgacctcacctgggtgcagtgc 808
             |||||||| |||||||||||| |||||| ||||| |||||||
Sbjct: 77628 gtcatcgtcgacaccggcagcaacctcatctgggcgcagtgc 77587



to top

>dbj|AP003335.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1144G04
          Length = 194459

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 26/26 (100%)
 Strand = Plus / Plus

                                        
Query: 776    gacaccggcagcgacctcacctgggt 801
              ||||||||||||||||||||||||||
Sbjct: 137189 gacaccggcagcgacctcacctgggt 137214



to top

>dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0480E02
          Length = 141862

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                   
Query: 776   gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
             ||||||||||||||| ||||||||||||| ||| ||||
Sbjct: 41183 gacaccggcagcgacgtcacctgggtgcaatgccagcc 41220



to top

>dbj|AP005052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
            clone:P0654B04
          Length = 156907

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                          
Query: 773  gtggacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
            |||||||||||||||||| |  | ||||||||||||||||| ||||
Sbjct: 8603 gtggacaccggcagcgacgtgtcgtgggtgcagtgcaagccgtgcc 8648



 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 1398  tcatcgactcgggcacggtgatcacgcg 1425
             |||||||||| |||||||||||||||||
Sbjct: 34132 tcatcgactccggcacggtgatcacgcg 34159



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1401 tcgactcgggcacggtgatcacgcggctggcgcc 1434
            ||||| ||||||||||| ||||||||||| ||||
Sbjct: 9201 tcgacacgggcacggtggtcacgcggctgccgcc 9234



to top

>dbj|AP004040.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1008_D06
          Length = 112768

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 41/46 (89%)
 Strand = Plus / Plus

                                                           
Query: 773   gtggacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
             |||||||||||||||||| |  | ||||||||||||||||| ||||
Sbjct: 65292 gtggacaccggcagcgacgtgtcgtgggtgcagtgcaagccgtgcc 65337



 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 1398  tcatcgactcgggcacggtgatcacgcg 1425
             |||||||||| |||||||||||||||||
Sbjct: 90821 tcatcgactccggcacggtgatcacgcg 90848



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 1401  tcgactcgggcacggtgatcacgcggctggcgcc 1434
             ||||| ||||||||||| ||||||||||| ||||
Sbjct: 65890 tcgacacgggcacggtggtcacgcggctgccgcc 65923



to top

>dbj|AK068990.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013170M01, full
           insert sequence
          Length = 1833

 Score = 52.0 bits (26), Expect = 0.008
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagcc 813
           ||||||||||||||| ||||||||||||| ||| ||||
Sbjct: 584 gacaccggcagcgacgtcacctgggtgcaatgccagcc 621



to top

>emb|CR855179.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSIGBa0152K17,
             complete sequence
          Length = 97679

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 769   catcgtggacaccggcagcgacctc 793
             |||||||||||||||||||||||||
Sbjct: 56821 catcgtggacaccggcagcgacctc 56845



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 776   gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
             ||||||| ||||||||||| ||||  ||||||| ||||||||
Sbjct: 62434 gacaccgccagcgacctcatctggacgcagtgccagccctgc 62475



to top

>emb|CR855170.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0818E04,
           complete sequence
          Length = 146307

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 769 catcgtggacaccggcagcgacctc 793
           |||||||||||||||||||||||||
Sbjct: 800 catcgtggacaccggcagcgacctc 824



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 776  gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
            ||||||| ||||||||||| ||||  ||||||| ||||||||
Sbjct: 6413 gacaccgccagcgacctcatctggacgcagtgccagccctgc 6454



to top

>ref|NM_001059457.1| Oryza sativa (japonica cultivar-group) Os04g0448300 (Os04g0448300)
           mRNA, complete cds
          Length = 1768

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 769 catcgtggacaccggcagcgacctc 793
           |||||||||||||||||||||||||
Sbjct: 561 catcgtggacaccggcagcgacctc 585



to top

>ref|NM_001050071.1| Oryza sativa (japonica cultivar-group) Os01g0608300 (Os01g0608300)
            mRNA, complete cds
          Length = 1479

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                             
Query: 1403 gactcgggcacggtgatcacgcggctggcgccg 1435
            ||||| ||||||||||||||||||||| |||||
Sbjct: 1126 gactccggcacggtgatcacgcggctgccgccg 1158



to top

>dbj|AP003216.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBa0090K04
          Length = 152556

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 1403   gactcgggcacggtgatcacgcggctggcgccg 1435
              ||||| ||||||||||||||||||||| |||||
Sbjct: 130221 gactccggcacggtgatcacgcggctgccgccg 130253



to top

>dbj|AK109494.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-A01, full
           insert sequence
          Length = 1610

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 769 catcgtggacaccggcagcgacctc 793
           |||||||||||||||||||||||||
Sbjct: 384 catcgtggacaccggcagcgacctc 408



to top

>dbj|AK120786.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023010M08, full
           insert sequence
          Length = 1770

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                    
Query: 769 catcgtggacaccggcagcgacctc 793
           |||||||||||||||||||||||||
Sbjct: 562 catcgtggacaccggcagcgacctc 586



to top

>emb|AL606448.3|OSJN00013 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064H22,
             complete sequence
          Length = 147214

 Score = 50.1 bits (25), Expect = 0.030
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 769   catcgtggacaccggcagcgacctc 793
             |||||||||||||||||||||||||
Sbjct: 74072 catcgtggacaccggcagcgacctc 74096



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 776   gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
             ||||||| ||||||||||| ||||  ||||||| ||||||||
Sbjct: 79686 gacaccgccagcgacctcatctggacgcagtgccagccctgc 79727



to top

>emb|CT831779.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA007C23, full
            insert sequence
          Length = 1970

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 1066 tcatcgactccggcacggtgatcacgcg 1093



to top

>ref|NM_001068545.1| Oryza sativa (japonica cultivar-group) Os08g0469000 (Os08g0469000)
           mRNA, complete cds
          Length = 1347

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 773 gtggacaccggcagcgacctcacctgggtgcagtgc 808
           |||||||||||||||||||||| ||||  |||||||
Sbjct: 325 gtggacaccggcagcgacctcatctggacgcagtgc 360



to top

>ref|NM_001056477.1| Oryza sativa (japonica cultivar-group) Os03g0317300 (Os03g0317300)
           mRNA, complete cds
          Length = 1498

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 776 gacaccggcagcgacctcacctgg 799
           ||||||||||||||||||||||||
Sbjct: 399 gacaccggcagcgacctcacctgg 422



to top

>ref|NM_001054492.1| Oryza sativa (japonica cultivar-group) Os02g0721000 (Os02g0721000)
            mRNA, complete cds
          Length = 1454

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 402  tcatcgactccggcacggtgatcacgcg 375



to top

>ref|NM_001054491.1| Oryza sativa (japonica cultivar-group) Os02g0720900 (Os02g0720900)
            mRNA, complete cds
          Length = 2020

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 1069 tcatcgactccggcacggtgatcacgcg 1096



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                        
Query: 776      gacaccggcagcgacctcacctgg 799
                ||||||||||||||||||||||||
Sbjct: 11392594 gacaccggcagcgacctcacctgg 11392617



 Score = 46.1 bits (23), Expect = 0.47
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                           
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
                ||||||||||||||||||| ||||  ||||||| |||| ||||
Sbjct: 11419474 gacaccggcagcgacctcatctggacgcagtgccagccgtgcc 11419516



 Score = 46.1 bits (23), Expect = 0.47
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                           
Query: 776      gacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
                ||||||||||||||||||| ||||  ||||||| |||| ||||
Sbjct: 11437951 gacaccggcagcgacctcatctggacgcagtgccagccgtgcc 11437993



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 769      catcgtggacaccggcagcgacctca 794
                |||||| |||||||||||||||||||
Sbjct: 21420359 catcgtcgacaccggcagcgacctca 21420384



to top

>gb|AC134230.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0005J15,
              complete sequence
          Length = 159270

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 776    gacaccggcagcgacctcacctgg 799
              ||||||||||||||||||||||||
Sbjct: 104128 gacaccggcagcgacctcacctgg 104151



 Score = 46.1 bits (23), Expect = 0.47
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 776    gacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
              ||||||||||||||||||| ||||  ||||||| |||| ||||
Sbjct: 131008 gacaccggcagcgacctcatctggacgcagtgccagccgtgcc 131050



 Score = 46.1 bits (23), Expect = 0.47
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 776    gacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
              ||||||||||||||||||| ||||  ||||||| |||| ||||
Sbjct: 149485 gacaccggcagcgacctcatctggacgcagtgccagccgtgcc 149527



to top

>dbj|AK119465.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-134-A02, full
           insert sequence
          Length = 1497

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 776 gacaccggcagcgacctcacctgg 799
           ||||||||||||||||||||||||
Sbjct: 399 gacaccggcagcgacctcacctgg 422



to top

>dbj|AK108039.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-137-C12, full
            insert sequence
          Length = 1454

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 402  tcatcgactccggcacggtgatcacgcg 375



to top

>dbj|AK099781.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095M09, full
            insert sequence
          Length = 2021

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 1070 tcatcgactccggcacggtgatcacgcg 1097



to top

>dbj|AK072228.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013169I21, full
            insert sequence
          Length = 2463

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 1613 tcatcgactccggcacggtgatcacgcg 1640



to top

>dbj|AK061628.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-D10, full
            insert sequence
          Length = 1973

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 1069 tcatcgactccggcacggtgatcacgcg 1096



to top

>dbj|AK061307.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-A02, full
            insert sequence
          Length = 1610

 Score = 48.1 bits (24), Expect = 0.12
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1398 tcatcgactcgggcacggtgatcacgcg 1425
            |||||||||| |||||||||||||||||
Sbjct: 1069 tcatcgactccggcacggtgatcacgcg 1096



to top

>ref|NM_001069873.1| Oryza sativa (japonica cultivar-group) Os09g0452800 (Os09g0452800)
           mRNA, complete cds
          Length = 1447

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 774 tggacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||||||||||||| ||||  |||||||
Sbjct: 376 tggacaccggcagcgacctcatctggacgcagtgc 410



to top

>ref|NM_001069747.1| Oryza sativa (japonica cultivar-group) Os09g0423500 (Os09g0423500)
           mRNA, complete cds
          Length = 1568

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 770 atcgtggacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||| |  ||||| ||||||||||||||||||
Sbjct: 447 atcgtggacacggcgagcgagctcacctgggtgcagtgc 485



to top

>ref|NM_001063020.1| Oryza sativa (japonica cultivar-group) Os05g0590000 (Os05g0590000)
            mRNA, complete cds
          Length = 1715

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1508 ttctcgctcctcgacacgtgctacaacctga 1538
            ||||||||  |||||||||||||||||||||
Sbjct: 1271 ttctcgctgttcgacacgtgctacaacctga 1301



to top

>ref|NM_001056478.1| Oryza sativa (japonica cultivar-group) Os03g0318400 (Os03g0318400)
           mRNA, complete cds
          Length = 1515

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
           ||||||||||||||||||| ||||  ||||||| |||| ||||
Sbjct: 428 gacaccggcagcgacctcatctggacgcagtgccagccgtgcc 470



to top

>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence
          Length = 3363523

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 1362    cggtgaccgcgtcggggctcggcgcccgcaacgtg 1396
               |||||| |||||||||||||| |||| ||||||||
Sbjct: 1161902 cggtgatcgcgtcggggctcgccgccggcaacgtg 1161868



to top

>gb|AC136216.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0022J22, complete sequence
          Length = 142854

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 1508  ttctcgctcctcgacacgtgctacaacctga 1538
             ||||||||  |||||||||||||||||||||
Sbjct: 43363 ttctcgctgttcgacacgtgctacaacctga 43333



to top

>gb|AC105260.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1115_D04,
             complete sequence
          Length = 100800

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 1508  ttctcgctcctcgacacgtgctacaacctga 1538
             ||||||||  |||||||||||||||||||||
Sbjct: 86128 ttctcgctgttcgacacgtgctacaacctga 86098



to top

>dbj|AP005393.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0488D02
          Length = 154537

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 774   tggacaccggcagcgacctcacctgggtgcagtgc 808
             ||||||||||||||||||||| ||||  |||||||
Sbjct: 53019 tggacaccggcagcgacctcatctggacgcagtgc 53053



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 776   gacaccggcagcgacctcacctgggtgcagtgc 808
             ||||||||||||||||||| ||||  |||||||
Sbjct: 45737 gacaccggcagcgacctcatctggacgcagtgc 45769



to top

>dbj|AP005579.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OJ1740_D06
          Length = 187410

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                     
Query: 770    atcgtggacaccggcagcgacctcacctgggtgcagtgc 808
              ||||||||||| |  ||||| ||||||||||||||||||
Sbjct: 185045 atcgtggacacggcgagcgagctcacctgggtgcagtgc 185083



to top

>dbj|AP005420.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0418B08
          Length = 165909

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                    
Query: 770   atcgtggacaccggcagcgacctcacctgggtgcagtgc 808
             ||||||||||| |  ||||| ||||||||||||||||||
Sbjct: 70258 atcgtggacacggcgagcgagctcacctgggtgcagtgc 70296



to top

>dbj|AK120024.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-186-C07, full
           insert sequence
          Length = 1568

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 770 atcgtggacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||| |  ||||| ||||||||||||||||||
Sbjct: 447 atcgtggacacggcgagcgagctcacctgggtgcagtgc 485



to top

>dbj|AK106440.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-103-D09, full
           insert sequence
          Length = 1515

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagccctgcc 818
           ||||||||||||||||||| ||||  ||||||| |||| ||||
Sbjct: 428 gacaccggcagcgacctcatctggacgcagtgccagccgtgcc 470



to top

>dbj|AK105952.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-205-D02, full
           insert sequence
          Length = 1449

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 774 tggacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||||||||||||| ||||  |||||||
Sbjct: 376 tggacaccggcagcgacctcatctggacgcagtgc 410



to top

>dbj|AK103957.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-015-B02, full
            insert sequence
          Length = 1639

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1508 ttctcgctcctcgacacgtgctacaacctga 1538
            ||||||||  |||||||||||||||||||||
Sbjct: 1195 ttctcgctgttcgacacgtgctacaacctga 1225



to top

>dbj|AK070159.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023046M06, full
            insert sequence
          Length = 1714

 Score = 46.1 bits (23), Expect = 0.47
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 1508 ttctcgctcctcgacacgtgctacaacctga 1538
            ||||||||  |||||||||||||||||||||
Sbjct: 1272 ttctcgctgttcgacacgtgctacaacctga 1302



to top

>gb|CP000460.1| Burkholderia cenocepacia HI2424 chromosome 3, complete genome
          Length = 1055417

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 344     gccggcagcggcgccgtcgtcg 365
               ||||||||||||||||||||||
Sbjct: 1048777 gccggcagcggcgccgtcgtcg 1048756



to top

>emb|CT829717.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN023H03, full
           insert sequence
          Length = 1928

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 824 tgctacgagcagcgggacccgctcttcgaccccgctagctccgccacctacgcc 877
           |||||||||||||||||   ||| |||||||| || |||||  |||||||||||
Sbjct: 724 tgctacgagcagcgggagaagctgttcgacccggcgagctcgtccacctacgcc 777



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1401 tcgactcgggcacggtgatcacgcg 1425
            ||||||| |||||||||||||||||
Sbjct: 1256 tcgactccggcacggtgatcacgcg 1280



to top

>emb|CR855235.1| Oryza sativa genomic DNA, chromosome 4, BAC clone:
              OSIGBa0142I02-OSIGBa0101B20, complete sequence
          Length = 189880

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 776    gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
              |||||||||||||||||| | |||  ||||||| ||||||||
Sbjct: 187468 gacaccggcagcgacctctcgtggacgcagtgcgagccctgc 187509



to top

>ref|NM_001064590.1| Oryza sativa (japonica cultivar-group) Os06g0610800 (Os06g0610800)
           mRNA, complete cds
          Length = 1796

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 824 tgctacgagcagcgggacccgctcttcgaccccgctagctccgccacctacgcc 877
           |||||||||||||||||   ||| |||||||| || |||||  |||||||||||
Sbjct: 724 tgctacgagcagcgggagaagctgttcgacccggcgagctcgtccacctacgcc 777



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1401 tcgactcgggcacggtgatcacgcg 1425
            ||||||| |||||||||||||||||
Sbjct: 1256 tcgactccggcacggtgatcacgcg 1280



to top

>ref|NM_001060265.1| Oryza sativa (japonica cultivar-group) Os04g0595000 (Os04g0595000)
           mRNA, partial cds
          Length = 1557

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
           |||||||||||||||||| | |||  ||||||| ||||||||
Sbjct: 375 gacaccggcagcgacctctcgtggacgcagtgcgagccctgc 416



to top

>ref|NM_001059458.1| Oryza sativa (japonica cultivar-group) Os04g0448500 (Os04g0448500)
           mRNA, complete cds
          Length = 1395

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
           ||||||| ||||||||||| ||||  ||||||| ||||||||
Sbjct: 319 gacaccgccagcgacctcatctggacgcagtgccagccctgc 360



to top

>ref|NM_001054488.1| Oryza sativa (japonica cultivar-group) Os02g0720500 (Os02g0720500)
            mRNA, partial cds
          Length = 1066

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1401 tcgactcgggcacggtgatcacgcggctggcgcc 1434
            ||||| ||||||||||| ||||||||||| ||||
Sbjct: 164  tcgacacgggcacggtggtcacgcggctgccgcc 197



to top

>gb|CP000440.1| Burkholderia cepacia AMMD chromosome 1, complete sequence
          Length = 3556545

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 245     tcggcaccaatggcggccgcttcttc 270
               ||||||||||||||||| ||||||||
Sbjct: 2564921 tcggcaccaatggcggcggcttcttc 2564896



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 31/33 (93%), Gaps = 1/33 (3%)
 Strand = Plus / Minus

                                               
Query: 333    atgcggccgctgccggcagcggcgccgtcgtcg 365
              |||||||||| ||||||| ||||||||||||||
Sbjct: 206371 atgcggccgc-gccggcatcggcgccgtcgtcg 206340



to top

>emb|AM236085.1| Rhizobium leguminosarum bv. viciae plasmid pRL11 complete genome, strain
              3841
          Length = 684202

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 245    tcggcaccaatggcggccgcttcttc 270
              ||||||||||||||||| ||||||||
Sbjct: 414115 tcggcaccaatggcggcggcttcttc 414090



to top

>gb|CP000380.1| Burkholderia cenocepacia AU 1054 chromosome 3, complete sequence
          Length = 1196094

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 344   gccggcagcggcgccgtcgtcg 365
             ||||||||||||||||||||||
Sbjct: 15539 gccggcagcggcgccgtcgtcg 15518



to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Minus

                                                 
Query: 913     gctgaaggagg-ccaccggcgcgcccggattctg 945
               ||||||||||| |||||| |||||||||||||||
Sbjct: 1538272 gctgaaggaggaccaccgccgcgcccggattctg 1538239



to top

>gb|AC125180.6| Mus musculus BAC clone RP23-322K1 from chromosome 14, complete sequence
          Length = 200560

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 115   tcctctccttctctcacattca 136
             ||||||||||||||||||||||
Sbjct: 40185 tcctctccttctctcacattca 40206



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 891    acgcctccgcctgcgcggcctcgctg 916
              |||||||||||| |||||||||||||
Sbjct: 783014 acgcctccgcctccgcggcctcgctg 783039



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 891    acgcctccgcctgcgcggcctcgctg 916
              |||||||||||| |||||||||||||
Sbjct: 783782 acgcctccgcctccgcggcctcgctg 783807



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 891    acgcctccgcctgcgcggcctcgctg 916
              |||||||||||| |||||||||||||
Sbjct: 784550 acgcctccgcctccgcggcctcgctg 784575



to top

>gb|AC133003.3| Oryza sativa chromosome 3 BAC OSJNBa0010D22 genomic sequence, complete
              sequence
          Length = 190055

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 769    catcgtggacaccggcagcgacctca 794
              |||||| |||||||||||||||||||
Sbjct: 120241 catcgtcgacaccggcagcgacctca 120266



to top

>gb|AY261359.1| Bovine herpesvirus 5 strain SV507/99, complete genome
          Length = 138390

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 338  gccgctgccggcagcggcgccg 359
            ||||||||||||||||||||||
Sbjct: 6842 gccgctgccggcagcggcgccg 6821



to top

>gb|CP000137.1| Rhizobium etli CFN 42 plasmid p42e, complete sequence
          Length = 505334

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 245    tcggcaccaatggcggccgcttcttc 270
              ||||||||||||||||| ||||||||
Sbjct: 300947 tcggcaccaatggcggcggcttcttc 300922



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 245     tcggcaccaatggcggccgcttcttc 270
               ||||||||||||||||| ||||||||
Sbjct: 5251744 tcggcaccaatggcggcggcttcttc 5251769



to top

>gb|AC136213.2| Leishmania major strain Friedlin chromosome 27 clone LB02059, complete
             sequence
          Length = 102826

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 891   acgcctccgcctgcgcggcctcgctg 916
             |||||||||||| |||||||||||||
Sbjct: 37837 acgcctccgcctccgcggcctcgctg 37862



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 891   acgcctccgcctgcgcggcctcgctg 916
             |||||||||||| |||||||||||||
Sbjct: 38605 acgcctccgcctccgcggcctcgctg 38630



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 891   acgcctccgcctgcgcggcctcgctg 916
             |||||||||||| |||||||||||||
Sbjct: 39373 acgcctccgcctccgcggcctcgctg 39398



to top

>emb|AL731579.4|OSJN00225 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0006A01,
             complete sequence
          Length = 143157

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 776   gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
             |||||||||||||||||| | |||  ||||||| ||||||||
Sbjct: 88726 gacaccggcagcgacctctcgtggacgcagtgcgagccctgc 88767



to top

>gb|AC154563.2| Mus musculus BAC clone RP23-401E22 from chromosome 14, complete
             sequence
          Length = 206798

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 115   tcctctccttctctcacattca 136
             ||||||||||||||||||||||
Sbjct: 51323 tcctctccttctctcacattca 51302



to top

>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome
          Length = 7036071

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 245     tcggcaccaatggcggccgcttcttc 270
               ||||||||||||||||| ||||||||
Sbjct: 2515492 tcggcaccaatggcggcggcttcttc 2515467



to top

>dbj|AP003616.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0490F09
          Length = 149542

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                   
Query: 824   tgctacgagcagcgggacccgctcttcgaccccgctagctccgccacctacgcc 877
             |||||||||||||||||   ||| |||||||| || |||||  |||||||||||
Sbjct: 98838 tgctacgagcagcgggagaagctgttcgacccggcgagctcgtccacctacgcc 98891



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1401  tcgactcgggcacggtgatcacgcg 1425
             ||||||| |||||||||||||||||
Sbjct: 99370 tcgactccggcacggtgatcacgcg 99394



to top

>dbj|AK108932.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-A08, full
            insert sequence
          Length = 1066

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                              
Query: 1401 tcgactcgggcacggtgatcacgcggctggcgcc 1434
            ||||| ||||||||||| ||||||||||| ||||
Sbjct: 164  tcgacacgggcacggtggtcacgcggctgccgcc 197



to top

>dbj|AK106907.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-119-A03, full
           insert sequence
          Length = 1557

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 776 gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
           |||||||||||||||||| | |||  ||||||| ||||||||
Sbjct: 375 gacaccggcagcgacctctcgtggacgcagtgcgagccctgc 416



to top

>dbj|AK066754.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013074G14, full
           insert sequence
          Length = 1797

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 824 tgctacgagcagcgggacccgctcttcgaccccgctagctccgccacctacgcc 877
           |||||||||||||||||   ||| |||||||| || |||||  |||||||||||
Sbjct: 725 tgctacgagcagcgggagaagctgttcgacccggcgagctcgtccacctacgcc 778



 Score = 42.1 bits (21), Expect = 7.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1401 tcgactcgggcacggtgatcacgcg 1425
            ||||||| |||||||||||||||||
Sbjct: 1257 tcgactccggcacggtgatcacgcg 1281



to top

>ref|XM_843045.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0443)
            partial mRNA
          Length = 6774

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 891  acgcctccgcctgcgcggcctcgctg 916
            |||||||||||| |||||||||||||
Sbjct: 2662 acgcctccgcctccgcggcctcgctg 2637



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 891  acgcctccgcctgcgcggcctcgctg 916
            |||||||||||| |||||||||||||
Sbjct: 3430 acgcctccgcctccgcggcctcgctg 3405



 Score = 44.1 bits (22), Expect = 1.8
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 891  acgcctccgcctgcgcggcctcgctg 916
            |||||||||||| |||||||||||||
Sbjct: 4198 acgcctccgcctccgcggcctcgctg 4173



to top

>emb|AL607004.4|OSJN00129 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNba0093F12,
            complete sequence
          Length = 186142

 Score = 44.1 bits (22), Expect = 1.8
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 776  gacaccggcagcgacctcacctgggtgcagtgcaagccctgc 817
            |||||||||||||||||| | |||  ||||||| ||||||||
Sbjct: 6158 gacaccggcagcgacctctcgtggacgcagtgcgagccctgc 6199



to top

>gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete genome
          Length = 6988209

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 339     ccgctgccggcagcggcgccgtcgtcgtt 367
               |||| |||| |||||||||||||||||||
Sbjct: 2724614 ccgccgccgacagcggcgccgtcgtcgtt 2724586



to top

>ref|XM_001233592.1| PREDICTED: Gallus gallus hypothetical protein LOC770262
           (LOC770262), mRNA
          Length = 1031

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 483 aagcagagggagcaagaagag 503
           |||||||||||||||||||||
Sbjct: 139 aagcagagggagcaagaagag 159



to top

>ref|XM_001225566.1| Chaetomium globosum CBS 148.51 conserved hypothetical protein
           (CHGG_07911) mRNA, complete cds
          Length = 408

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 295 tcttcttcgcctcctcgcgct 315
           |||||||||||||||||||||
Sbjct: 334 tcttcttcgcctcctcgcgct 314



to top

>ref|NM_001072450.1| Oryza sativa (japonica cultivar-group) Os11g0184800 (Os11g0184800)
           mRNA, complete cds
          Length = 1463

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 776 gacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||||  |||||||||| ||||||||
Sbjct: 266 gacaccggcagcaccctcacctggctgcagtgc 298



to top

>ref|NM_001069871.1| Oryza sativa (japonica cultivar-group) Os09g0452400 (Os09g0452400)
           mRNA, complete cds
          Length = 1492

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 776 gacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||||||||||| ||||  |||||||
Sbjct: 396 gacaccggcagcgacctcatctggacgcagtgc 428



to top

>ref|NM_001063168.1| Oryza sativa (japonica cultivar-group) Os06g0119600 (Os06g0119600)
           mRNA, complete cds
          Length = 1898

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 867 ccacctacgccgccgtcccgtgcaacgcctccgcctgcgcg 907
           |||| |||||||||||||| |||| | || |||||||||||
Sbjct: 676 ccacgtacgccgccgtcccctgcacctccgccgcctgcgcg 716



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 245     tcggcaccaatggcggccgcttctt 269
               ||||||||||||||||| |||||||
Sbjct: 5081911 tcggcaccaatggcggcggcttctt 5081887



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 347     ggcagcggcgccgtcgtcgtt 367
               |||||||||||||||||||||
Sbjct: 1281238 ggcagcggcgccgtcgtcgtt 1281258



to top

>gb|AC119252.10| Mus musculus chromosome 8, clone RP24-279M13, complete sequence
          Length = 176594

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 666   cccaggtccctctgacctctg 686
             |||||||||||||||||||||
Sbjct: 14293 cccaggtccctctgacctctg 14273



to top

>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome
          Length = 3402093

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 743    tcgggcgccgccgccaagctc 763
              |||||||||||||||||||||
Sbjct: 463148 tcgggcgccgccgccaagctc 463128



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 1043    ggcggcgccaagctcgacgcc 1063
               |||||||||||||||||||||
Sbjct: 2379659 ggcggcgccaagctcgacgcc 2379679



to top

>gb|AC113016.7| Mus musculus chromosome 9, clone RP23-181L13, complete sequence
          Length = 213244

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1822  agtggaattttattcaactgt 1842
             |||||||||||||||||||||
Sbjct: 52951 agtggaattttattcaactgt 52971



to top

>gb|AF308692.1| Oryza sativa nucellin-like protein (OSAP1) mRNA, complete cds
          Length = 1417

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 776 gacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||||  |||||||||| ||||||||
Sbjct: 220 gacaccggcagcaccctcacctggctgcagtgc 252



to top

>gb|AF308691.1| Oryza sativa nucellin-like protein (OSAP1) gene, complete cds
          Length = 2245

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 776 gacaccggcagcgacctcacctgggtgcagtgc 808
           ||||||||||||  |||||||||| ||||||||
Sbjct: 309 gacaccggcagcaccctcacctggctgcagtgc 341



to top

>dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111
          Length = 2356219

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1102   cggtggcacagcggggctcatgggc 1126
              ||||||||||||||| |||||||||
Sbjct: 164852 cggtggcacagcgggcctcatgggc 164876



to top

>gb|CP000232.1| Moorella thermoacetica ATCC 39073, complete genome
          Length = 2628784

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 334    tgcggccgctgccggcagcgg 354
              |||||||||||||||||||||
Sbjct: 964917 tgcggccgctgccggcagcgg 964897



to top

>gb|AC182231.2| Mus musculus BAC clone RP23-356C18 from chromosome 8, complete sequence
          Length = 206310

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 666   cccaggtccctctgacctctg 686
             |||||||||||||||||||||
Sbjct: 59860 cccaggtccctctgacctctg 59880



to top

>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome
          Length = 3309401

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 586     cctcctcgctgccgacgctgctcgtgctg 614
               |||| |||||||||||||||| |||||||
Sbjct: 3230127 cctcttcgctgccgacgctgcgcgtgctg 3230155



to top

>emb|BX072341.1|CNS09RZD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 710

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 547 ttcttcttcgcctcctcgcgc 567



to top

>emb|BX072340.1|CNS09RZC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 381 ttcttcttcgcctcctcgcgc 361



to top

>emb|BX071844.1|CNS09RLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 511 ttcttcttcgcctcctcgcgc 531



to top

>emb|BX071843.1|CNS09RLJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 365 ttcttcttcgcctcctcgcgc 345



to top

>emb|BX071645.1|CNS09RG1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 532 ttcttcttcgcctcctcgcgc 552



to top

>emb|BX071644.1|CNS09RG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 369 ttcttcttcgcctcctcgcgc 349



to top

>emb|BX071615.1|CNS09RF7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 520 ttcttcttcgcctcctcgcgc 540



to top

>emb|BX071614.1|CNS09RF6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 353 ttcttcttcgcctcctcgcgc 333



to top

>emb|BX071464.1|CNS09RB0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 531 ttcttcttcgcctcctcgcgc 551



to top

>emb|BX071463.1|CNS09RAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 364 ttcttcttcgcctcctcgcgc 344



to top

>emb|BX071370.1|CNS09R8E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 557

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 510 ttcttcttcgcctcctcgcgc 530



to top

>emb|BX071369.1|CNS09R8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 542

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 344 ttcttcttcgcctcctcgcgc 324



to top

>emb|BX071325.1|CNS09R75 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 504 ttcttcttcgcctcctcgcgc 524



to top

>emb|BX071324.1|CNS09R74 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 347 ttcttcttcgcctcctcgcgc 327



to top

>emb|BX071281.1|CNS09R5X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 760

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 509 ttcttcttcgcctcctcgcgc 529



to top

>emb|BX071150.1|CNS09R2A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 527 ttcttcttcgcctcctcgcgc 547



to top

>emb|BX071149.1|CNS09R29 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 342 ttcttcttcgcctcctcgcgc 322



to top

>emb|BX070669.1|CNS09QOX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 351 ttcttcttcgcctcctcgcgc 331



to top

>emb|BX071048.1|CNS09QZG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 512 ttcttcttcgcctcctcgcgc 532



to top

>emb|BX071047.1|CNS09QZF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 375 ttcttcttcgcctcctcgcgc 355



to top

>emb|BX070860.1|CNS09QU8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 473 ttcttcttcgcctcctcgcgc 493



to top

>emb|BX070859.1|CNS09QU7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 368 ttcttcttcgcctcctcgcgc 348



to top

>emb|BX070688.1|CNS09QPG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 907

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 500 ttcttcttcgcctcctcgcgc 520



to top

>emb|BX070687.1|CNS09QPF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 350 ttcttcttcgcctcctcgcgc 330



to top

>emb|BX070681.1|CNS09QP9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 148

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 87  ttcttcttcgcctcctcgcgc 67



to top

>emb|BX061534.1|CNS09JN6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 549

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 442 ttcttcttcgcctcctcgcgc 462



to top

>emb|BX061533.1|CNS09JN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 347 ttcttcttcgcctcctcgcgc 327



to top

>emb|BX061500.1|CNS09JM8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 354 ttcttcttcgcctcctcgcgc 334



to top

>emb|BX061372.1|CNS09JIO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 482 ttcttcttcgcctcctcgcgc 502



to top

>emb|BX061371.1|CNS09JIN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 329 ttcttcttcgcctcctcgcgc 309



to top

>emb|BX070196.1|CNS09QBS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 774

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 531 ttcttcttcgcctcctcgcgc 551



to top

>emb|BX070195.1|CNS09QBR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 356 ttcttcttcgcctcctcgcgc 336



to top

>emb|BX070000.1|CNS09Q6C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 533 ttcttcttcgcctcctcgcgc 553



to top

>emb|BX069999.1|CNS09Q6B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 350 ttcttcttcgcctcctcgcgc 330



to top

>emb|BX069998.1|CNS09Q6A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 514 ttcttcttcgcctcctcgcgc 534



to top

>emb|BX069997.1|CNS09Q69 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 386 ttcttcttcgcctcctcgcgc 366



to top

>emb|BX069926.1|CNS09Q4A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 364 ttcttcttcgcctcctcgcgc 344



to top

>emb|BX069764.1|CNS09PZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 545 ttcttcttcgcctcctcgcgc 565



to top

>emb|BX069763.1|CNS09PZR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 349 ttcttcttcgcctcctcgcgc 329



to top

>emb|BX069694.1|CNS09PXU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 442

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 361 ttcttcttcgcctcctcgcgc 341



to top

>emb|BX069346.1|CNS09PO6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 381 ttcttcttcgcctcctcgcgc 361



to top

>emb|BX069225.1|CNS09PKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 450 ttcttcttcgcctcctcgcgc 470



to top

>emb|BX069224.1|CNS09PKS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 324 ttcttcttcgcctcctcgcgc 304



to top

>emb|BX069119.1|CNS09PHV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 512 ttcttcttcgcctcctcgcgc 532



to top

>emb|BX069118.1|CNS09PHU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 350 ttcttcttcgcctcctcgcgc 330



to top

>emb|BX069067.1|CNS09PGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 521 ttcttcttcgcctcctcgcgc 541



to top

>emb|BX069066.1|CNS09PGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 363 ttcttcttcgcctcctcgcgc 343



to top

>emb|BX068401.1|CNS09OXX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 435 ttcttcttcgcctcctcgcgc 415



to top

>emb|BX068341.1|CNS09OW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 942

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 538 ttcttcttcgcctcctcgcgc 558



to top

>emb|BX068340.1|CNS09OW8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 360 ttcttcttcgcctcctcgcgc 340



to top

>emb|BX068787.1|CNS09P8N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 914

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 536 ttcttcttcgcctcctcgcgc 556



to top

>emb|BX068786.1|CNS09P8M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 365 ttcttcttcgcctcctcgcgc 345



to top

>emb|BX068730.1|CNS09P72 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 529 ttcttcttcgcctcctcgcgc 549



to top

>emb|BX068729.1|CNS09P71 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 356 ttcttcttcgcctcctcgcgc 336



to top

>emb|BX068402.1|CNS09OXY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52CD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 535 ttcttcttcgcctcctcgcgc 555



to top

>emb|BX067375.1|CNS09O5F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 514 ttcttcttcgcctcctcgcgc 534



to top

>emb|BX067374.1|CNS09O5E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 349 ttcttcttcgcctcctcgcgc 329



to top

>emb|BX068159.1|CNS09OR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 509 ttcttcttcgcctcctcgcgc 529



to top

>emb|BX068158.1|CNS09OR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 357 ttcttcttcgcctcctcgcgc 337



to top

>emb|BX067962.1|CNS09OLQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 345 ttcttcttcgcctcctcgcgc 325



to top

>emb|BX067751.1|CNS09OFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 585

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 516 ttcttcttcgcctcctcgcgc 536



to top

>emb|BX067750.1|CNS09OFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 383

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 371 ttcttcttcgcctcctcgcgc 351



to top

>emb|BX067204.1|CNS09O0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 513 ttcttcttcgcctcctcgcgc 533



to top

>emb|BX067203.1|CNS09O0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 354 ttcttcttcgcctcctcgcgc 334



to top

>emb|BX066718.1|CNS09NN6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 522 ttcttcttcgcctcctcgcgc 542



to top

>emb|BX066717.1|CNS09NN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 350 ttcttcttcgcctcctcgcgc 330



to top

>emb|BX066486.1|CNS09NGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 913

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 506 ttcttcttcgcctcctcgcgc 526



to top

>emb|BX066485.1|CNS09NGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 355 ttcttcttcgcctcctcgcgc 335



to top

>emb|BX066475.1|CNS09NGF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 506 ttcttcttcgcctcctcgcgc 526



to top

>emb|BX066474.1|CNS09NGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 352 ttcttcttcgcctcctcgcgc 332



to top

>emb|BX066450.1|CNS09NFQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 517 ttcttcttcgcctcctcgcgc 537



to top

>emb|BX066389.1|CNS09NE1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 524 ttcttcttcgcctcctcgcgc 544



to top

>emb|BX066388.1|CNS09NE0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 367 ttcttcttcgcctcctcgcgc 347



to top

>emb|BX066287.1|CNS09NB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 519 ttcttcttcgcctcctcgcgc 539



to top

>emb|BX066286.1|CNS09NB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 924

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 363 ttcttcttcgcctcctcgcgc 343



to top

>emb|BX065868.1|CNS09MZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 144

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 113 ttcttcttcgcctcctcgcgc 133



to top

>emb|BX065859.1|CNS09MZB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 577

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 360 ttcttcttcgcctcctcgcgc 340



to top

>emb|BX065782.1|CNS09MX6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 527 ttcttcttcgcctcctcgcgc 547



to top

>emb|BX065781.1|CNS09MX5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 936

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 365 ttcttcttcgcctcctcgcgc 345



to top

>emb|BX065577.1|CNS09MRH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 792

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 516 ttcttcttcgcctcctcgcgc 536



to top

>emb|BX065576.1|CNS09MRG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 231 ttcttcttcgcctcctcgcgc 211



to top

>emb|BX065497.1|CNS09MP9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 356 ttcttcttcgcctcctcgcgc 336



to top

>emb|BX065054.1|CNS09MCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48DB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 888

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 532 ttcttcttcgcctcctcgcgc 552



to top

>emb|BX064997.1|CNS09MBD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 643

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 157 ttcttcttcgcctcctcgcgc 137



to top

>emb|BX064955.1|CNS09MA7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 938

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 511 ttcttcttcgcctcctcgcgc 531



to top

>emb|BX064954.1|CNS09MA6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 382 ttcttcttcgcctcctcgcgc 362



to top

>emb|BX064806.1|CNS09M62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 357 ttcttcttcgcctcctcgcgc 337



to top

>emb|BX064779.1|CNS09M5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 503 ttcttcttcgcctcctcgcgc 523



to top

>emb|BX064778.1|CNS09M5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 319 ttcttcttcgcctcctcgcgc 299



to top

>emb|BX064711.1|CNS09M3F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 230

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 190 ttcttcttcgcctcctcgcgc 210



to top

>emb|BX064710.1|CNS09M3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 762

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 333 ttcttcttcgcctcctcgcgc 313



to top

>emb|BX064612.1|CNS09M0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 514 ttcttcttcgcctcctcgcgc 534



to top

>emb|BX064611.1|CNS09M0N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 552

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 351 ttcttcttcgcctcctcgcgc 331



to top

>emb|BX064509.1|CNS09LXT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 529 ttcttcttcgcctcctcgcgc 549



to top

>emb|BX064050.1|CNS09LL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 524 ttcttcttcgcctcctcgcgc 544



to top

>emb|BX064049.1|CNS09LL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 351 ttcttcttcgcctcctcgcgc 331



to top

>emb|BX064012.1|CNS09LK0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 529 ttcttcttcgcctcctcgcgc 549



to top

>emb|BX064011.1|CNS09LJZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 371 ttcttcttcgcctcctcgcgc 351



to top

>emb|BX063943.1|CNS09LI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 539 ttcttcttcgcctcctcgcgc 559



to top

>emb|BX063942.1|CNS09LI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 392 ttcttcttcgcctcctcgcgc 372



to top

>emb|BX063825.1|CNS09LET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 594

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 308 ttcttcttcgcctcctcgcgc 328



to top

>emb|BX063745.1|CNS09LCL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 535 ttcttcttcgcctcctcgcgc 555



to top

>emb|BX063744.1|CNS09LCK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 724

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 371 ttcttcttcgcctcctcgcgc 351



to top

>emb|BX063730.1|CNS09LC6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 550 ttcttcttcgcctcctcgcgc 570



to top

>emb|BX063729.1|CNS09LC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 895

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 359 ttcttcttcgcctcctcgcgc 339



to top

>emb|BX063708.1|CNS09LBK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 526 ttcttcttcgcctcctcgcgc 546



to top

>emb|BX063707.1|CNS09LBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 931

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 351 ttcttcttcgcctcctcgcgc 331



to top

>emb|BX063617.1|CNS09L91 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 523 ttcttcttcgcctcctcgcgc 543



to top

>emb|BX063616.1|CNS09L90 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 352 ttcttcttcgcctcctcgcgc 332



to top

>emb|BX063582.1|CNS09L82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 867

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 511 ttcttcttcgcctcctcgcgc 531



to top

>emb|BX063581.1|CNS09L81 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 349 ttcttcttcgcctcctcgcgc 329



to top

>emb|BX063323.1|CNS09L0V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 934

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 530 ttcttcttcgcctcctcgcgc 550



to top

>emb|BX062417.1|CNS09KBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 524 ttcttcttcgcctcctcgcgc 544



to top

>emb|BX062744.1|CNS09KKS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 512 ttcttcttcgcctcctcgcgc 532



to top

>emb|BX062743.1|CNS09KKR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 484 ttcttcttcgcctcctcgcgc 464



to top

>emb|BX062646.1|CNS09KI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 480

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 246 ttcttcttcgcctcctcgcgc 266



to top

>emb|BX062645.1|CNS09KI1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 870

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 342 ttcttcttcgcctcctcgcgc 322



to top

>emb|BX062386.1|CNS09KAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 532 ttcttcttcgcctcctcgcgc 552



to top

>emb|BX062032.1|CNS09K10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 889

 Score = 42.1 bits (21), Expect = 7.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 294 ttcttcttcgcctcctcgcgc 314
           |||||||||||||||||||||
Sbjct: 530 ttcttcttcgcctcctcgcgc 550


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 264,766,046
Number of extensions: 14966579
Number of successful extensions: 347687
Number of sequences better than 10.0: 536
Number of HSP's gapped: 347687
Number of HSP's successfully gapped: 603
Length of query: 1903
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1880
Effective length of database: 18,503,978,556
Effective search space: 34787479685280
Effective search space used: 34787479685280
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top