ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf12p19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL589862.28| Human DNA sequence from clone GS1-165F21 on chr... 46 0.080
2gb|AC114763.6| Homo sapiens BAC clone RP11-369K2 from 2, complet... 44 0.32
3gb|AC016737.8| Homo sapiens BAC clone RP11-394I13 from 2, comple... 44 0.32
4emb|X92428.1|ZMHOX1BGN Z.mays mRNA for Hox1b protein 42 1.3
5gb|AC005375.4|AC005375 Homo sapiens chromosome 17, clone hRPK.38... 42 1.3
6ref|XM_763280.1| Giardia lamblia ATCC 50803 hypothetical protein... 42 1.3
7ref|XM_763279.1| Giardia lamblia ATCC 50803 hypothetical protein... 42 1.3
8gb|CP000448.1| Syntrophomonas wolfei subsp. wolfei str. Goetting... 40 4.9
9gb|DQ516066.1| Ictalurus punctatus tissue-type liver matrix meta... 40 4.9
10gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118... 40 4.9
11gb|AC091726.2| Gallus gallus clone WAG-126P17, complete sequence 40 4.9
12emb|AL021069.1|HS970D1 Human DNA sequence from clone RP5-970D1 o... 40 4.9

>emb|AL589862.28| Human DNA sequence from clone GS1-165F21 on chromosome 10 Contains the 5'
              end of the PAX2 gene for paired box gene 2 and fifteen CpG
              islands, complete sequence
          Length = 187101
 Score = 46.1 bits (23), Expect = 0.080
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 20     aagaagaatggtctggcgctgta 42
              |||||||||||||||||||||||
Sbjct: 138992 aagaagaatggtctggcgctgta 139014



to top

>gb|AC114763.6| Homo sapiens BAC clone RP11-369K2 from 2, complete sequence
          Length = 87248

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 215   aagacggttgtacgccaagctgctgt 240
             |||||||||||| |||||||||||||
Sbjct: 13313 aagacggttgtaagccaagctgctgt 13338



to top

>gb|AC016737.8| Homo sapiens BAC clone RP11-394I13 from 2, complete sequence
          Length = 196085

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 278    tagttgaatattctgtaacttg 299
              ||||||||||||||||||||||
Sbjct: 126177 tagttgaatattctgtaacttg 126156



to top

>emb|X92428.1|ZMHOX1BGN Z.mays mRNA for Hox1b protein
          Length = 2790

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 15   tgatgaagaagaatggtctgg 35
            |||||||||||||||||||||
Sbjct: 1612 tgatgaagaagaatggtctgg 1632



to top

>gb|AC005375.4|AC005375 Homo sapiens chromosome 17, clone hRPK.388_F_14, complete sequence
          Length = 149030

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 115   catttttaggggaaataatta 135
             |||||||||||||||||||||
Sbjct: 90895 catttttaggggaaataatta 90915



to top

>ref|XM_763280.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_15_13494_12943) partial mRNA
          Length = 552

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 253 agctgatgagaacctgctcaa 273
           |||||||||||||||||||||
Sbjct: 168 agctgatgagaacctgctcaa 148



to top

>ref|XM_763279.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_15_12905_13390) partial mRNA
          Length = 486

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 253 agctgatgagaacctgctcaa 273
           |||||||||||||||||||||
Sbjct: 423 agctgatgagaacctgctcaa 443



to top

>gb|CP000448.1| Syntrophomonas wolfei subsp. wolfei str. Goettingen, complete genome
          Length = 2936195

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 272     aaacaatagttgaatattct 291
               ||||||||||||||||||||
Sbjct: 2769397 aaacaatagttgaatattct 2769416



to top

>gb|DQ516066.1| Ictalurus punctatus tissue-type liver matrix metalloproteinase 9
            mRNA, complete cds
          Length = 2551

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 183  tgccttttcccctctgcaat 202
            ||||||||||||||||||||
Sbjct: 1919 tgccttttcccctctgcaat 1900



to top

>gb|CP000233.1| Lactobacillus salivarius subsp. salivarius UCC118, complete genome
          Length = 1827111

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 221    gttgtacgccaagctgctgttagg 244
              |||||||||||||| |||||||||
Sbjct: 609632 gttgtacgccaagcagctgttagg 609609



to top

>gb|AC091726.2| Gallus gallus clone WAG-126P17, complete sequence
          Length = 129285

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 192   ccctctgcaatcagtgctca 211
             ||||||||||||||||||||
Sbjct: 58127 ccctctgcaatcagtgctca 58108



to top

>emb|AL021069.1|HS970D1 Human DNA sequence from clone RP5-970D1 on chromosome 1q24 Contains the
             3' end of a variant of the gene for expressed in
             hematopoietic cells (heart, liver) (HLL), complete
             sequence
          Length = 100496

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 119   tttaggggaaataattagtt 138
             ||||||||||||||||||||
Sbjct: 64969 tttaggggaaataattagtt 64950


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 66,887,174
Number of extensions: 3632040
Number of successful extensions: 271996
Number of sequences better than 10.0: 12
Number of HSP's gapped: 271996
Number of HSP's successfully gapped: 12
Length of query: 346
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 324
Effective length of database: 18,508,616,841
Effective search space: 5996791856484
Effective search space used: 5996791856484
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)
to top