| Clone Name | FLbaf9m08 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_657696.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5184.2), mRNA Length = 2541 Score = 85.7 bits (43), Expect = 3e-13 Identities = 82/95 (86%) Strand = Plus / Plus Query: 144 ttccccggtgtcgttgtgttcagcgagatctaccaagtaaccggccccgtctcccgcttc 203 |||||||| || || || ||||||||||||||||| || |||||||||||| | |||||| Sbjct: 1798 ttccccggggtagtcgtattcagcgagatctaccaggttaccggccccgtcgcgcgcttc 1857 Query: 204 gcccgccaaatcgcatcccaaggctacatcgtcgc 238 |||||||| ||||| ||| |||||||||||||| Sbjct: 1858 gcccgccagatcgccggccagggctacatcgtcgc 1892
>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV, complete sequence Length = 1466886 Score = 69.9 bits (35), Expect = 2e-08 Identities = 41/43 (95%) Strand = Plus / Minus Query: 400 acggccgcgtcggcgccacgggcatgtgcctaggcggccacct 442 |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 1160034 acggccgcatcggcgccacgggcatgtgcctcggcggccacct 1159992
>ref|NM_209714.1| Eremothecium gossypii ADR265Cp (ADR265C), mRNA Length = 819 Score = 69.9 bits (35), Expect = 2e-08 Identities = 41/43 (95%) Strand = Plus / Plus Query: 400 acggccgcgtcggcgccacgggcatgtgcctaggcggccacct 442 |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 359 acggccgcatcggcgccacgggcatgtgcctcggcggccacct 401
>ref|XM_745367.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g07120) partial mRNA Length = 441 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Strand = Plus / Minus Query: 603 aaccatgtgccgccggaggggcgggacctgatccgcaagacgctgcatgagaaggg 658 |||||||| || |||||||| | ||||||||||||||||| |||||||||||||| Sbjct: 144 aaccatgttcccccggagggtagagacctgatccgcaagaccctgcatgagaaggg 89
>ref|XM_745366.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g07130) partial mRNA Length = 804 Score = 63.9 bits (32), Expect = 1e-06 Identities = 50/56 (89%) Strand = Plus / Plus Query: 603 aaccatgtgccgccggaggggcgggacctgatccgcaagacgctgcatgagaaggg 658 |||||||| || |||||||| | ||||||||||||||||| |||||||||||||| Sbjct: 556 aaccatgttcccccggagggtagagacctgatccgcaagaccctgcatgagaaggg 611 Score = 61.9 bits (31), Expect = 4e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 144 ttccccggtgtcgttgtgttcagcgagatctaccaagtaaccggccccgtctcccgcttc 203 ||||| |||||||| ||||||||||||||||||||||| || || || ||||| || ||| Sbjct: 100 ttccctggtgtcgtagtgttcagcgagatctaccaagtgactggacctgtctcgcggttc 159 Query: 204 gcc 206 ||| Sbjct: 160 gcc 162
>ref|XM_001211823.1| Aspergillus terreus NIH2624 Delta(24(24(1)))-sterol reductase (ATEG_02645) mRNA, complete cds Length = 2418 Score = 52.0 bits (26), Expect = 0.004 Identities = 113/142 (79%) Strand = Plus / Plus Query: 577 tgatgatgatctttgggaagcgggataaccatgtgccgccggaggggcgggacctgatcc 636 |||| |||||||| |||||| || |||||||| || ||||| || |||| |||||| Sbjct: 2144 tgatcatgatcttcgggaagaacgacaaccatgttccaccggaaggaagggatttgatcc 2203 Query: 637 gcaagacgctgcatgagaagggggtgttgtttgggtggtgggaggtggcgtgggcgcagc 696 | ||||||||||| || ||||| ||| ||||| | | | |||||||| ||||| |||| Sbjct: 2204 gaaagacgctgcacgacaagggcgtgctgtttagtttttacgaggtggcttgggctcagc 2263 Query: 697 atgcattcatccgcgatgagct 718 |||| || || ||||||||||| Sbjct: 2264 atgcgtttattcgcgatgagct 2285 Score = 42.1 bits (21), Expect = 3.7 Identities = 27/29 (93%) Strand = Plus / Plus Query: 162 ttcagcgagatctaccaagtaaccggccc 190 ||||||||||||||||| || |||||||| Sbjct: 1729 ttcagcgagatctaccaggtgaccggccc 1757
>emb|BX284745.1|NCB18E6 Neurospora crassa DNA linkage group II BAC clone B18E6 Length = 68593 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 684 gcgtgggcgcagcatgcattcatccgcgatgagctaagtaaagggcggtacgat 737 ||||||||||| ||||| |||||| | |||||| | || ||||||||||||||| Sbjct: 40202 gcgtgggcgcaacatgcgttcatcagggatgagttgagcaaagggcggtacgat 40255 Score = 46.1 bits (23), Expect = 0.24 Identities = 50/59 (84%) Strand = Plus / Plus Query: 183 accggccccgtctcccgcttcgcccgccaaatcgcatcccaaggctacatcgtcgcggc 241 ||||| ||||| |||| || |||||||||||||| |||||||||||||||||||| Sbjct: 39566 accggtcccgttgcccgttttgcccgccaaatcgccggtcaaggctacatcgtcgcggc 39624
>ref|XM_958271.1| Neurospora crassa OR74A hypothetical protein (NCU09600.1) partial mRNA Length = 804 Score = 52.0 bits (26), Expect = 0.004 Identities = 47/54 (87%) Strand = Plus / Plus Query: 684 gcgtgggcgcagcatgcattcatccgcgatgagctaagtaaagggcggtacgat 737 ||||||||||| ||||| |||||| | |||||| | || ||||||||||||||| Sbjct: 637 gcgtgggcgcaacatgcgttcatcagggatgagttgagcaaagggcggtacgat 690 Score = 46.1 bits (23), Expect = 0.24 Identities = 50/59 (84%) Strand = Plus / Plus Query: 183 accggccccgtctcccgcttcgcccgccaaatcgcatcccaaggctacatcgtcgcggc 241 ||||| ||||| |||| || |||||||||||||| |||||||||||||||||||| Sbjct: 67 accggtcccgttgcccgttttgcccgccaaatcgccggtcaaggctacatcgtcgcggc 125
>ref|XM_381008.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00832.1) partial mRNA Length = 852 Score = 48.1 bits (24), Expect = 0.060 Identities = 84/104 (80%) Strand = Plus / Plus Query: 162 ttcagcgagatctaccaagtaaccggccccgtctcccgcttcgcccgccaaatcgcatcc 221 ||||| ||||| |||||||| ||||| || || | ||||| |||||||| ||||| | Sbjct: 130 ttcagtgagatttaccaagtcaccggtcctgtggctcgctttgcccgccagatcgctggc 189 Query: 222 caaggctacatcgtcgcggcgccctcatcctaccacgaattcac 265 || ||||||||||| || || || ||||| |||||||| ||||| Sbjct: 190 cagggctacatcgttgccgctccttcatcataccacgacttcac 233
>gb|CP000469.1| Shewanella sp. ANA-3, complete genome Length = 4972204 Score = 44.1 bits (22), Expect = 0.94 Identities = 25/26 (96%) Strand = Plus / Plus Query: 432 ggcggccacctagcctaccgcgccgc 457 ||||||||| |||||||||||||||| Sbjct: 3982047 ggcggccacttagcctaccgcgccgc 3982072
>gb|AC190391.4| Canis Familiaris chromosome 2, clone XX-25C16, complete sequence Length = 194249 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Minus Query: 935 ggaagacatccagcaatagaca 956 |||||||||||||||||||||| Sbjct: 32329 ggaagacatccagcaatagaca 32308
>gb|CP000444.1| Shewanella sp. MR-7, complete genome Length = 4792610 Score = 44.1 bits (22), Expect = 0.94 Identities = 25/26 (96%) Strand = Plus / Plus Query: 432 ggcggccacctagcctaccgcgccgc 457 ||||||||| |||||||||||||||| Sbjct: 3811134 ggcggccacttagcctaccgcgccgc 3811159
>gb|CP000446.1| Shewanella sp. MR-4, complete genome Length = 4706287 Score = 44.1 bits (22), Expect = 0.94 Identities = 25/26 (96%) Strand = Plus / Minus Query: 432 ggcggccacctagcctaccgcgccgc 457 ||||||||| |||||||||||||||| Sbjct: 941734 ggcggccacttagcctaccgcgccgc 941709
>ref|NM_102971.1| Arabidopsis thaliana unknown protein (AT1G32375) mRNA, complete cds Length = 1269 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Plus Query: 759 tttgagatgctcaaggagttgt 780 |||||||||||||||||||||| Sbjct: 1201 tttgagatgctcaaggagttgt 1222
>gb|AC007767.3|F5D14 Sequence of BAC F5D14 from Arabidopsis thaliana chromosome 1, complete sequence Length = 127462 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Plus Query: 759 tttgagatgctcaaggagttgt 780 |||||||||||||||||||||| Sbjct: 42398 tttgagatgctcaaggagttgt 42419
>gb|AC122424.4| Mus musculus BAC clone RP24-173E19 from 8, complete sequence Length = 175181 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Plus Query: 930 agaaaggaagacatccagcaat 951 |||||||||||||||||||||| Sbjct: 64449 agaaaggaagacatccagcaat 64470
>gb|AC142262.3| Mus musculus BAC clone RP24-486I4 from 8, complete sequence Length = 204183 Score = 44.1 bits (22), Expect = 0.94 Identities = 22/22 (100%) Strand = Plus / Minus Query: 930 agaaaggaagacatccagcaat 951 |||||||||||||||||||||| Sbjct: 2508 agaaaggaagacatccagcaat 2487
>ref|XM_001225916.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_08261) mRNA, complete cds Length = 732 Score = 42.1 bits (21), Expect = 3.7 Identities = 45/53 (84%) Strand = Plus / Plus Query: 684 gcgtgggcgcagcatgcattcatccgcgatgagctaagtaaagggcggtacga 736 |||||||| ||||| || ||||||||||| ||||| || ||||| || ||||| Sbjct: 565 gcgtgggcccagcacgccttcatccgcgacgagctgagcaaaggccgctacga 617
>gb|AC103609.6| Mus musculus chromosome 3, clone RP23-359D10, complete sequence Length = 182664 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 498 acagatatacacagccacacg 518 ||||||||||||||||||||| Sbjct: 27160 acagatatacacagccacacg 27180
>gb|AC125168.4| Mus musculus BAC clone RP24-449N2 from chromosome 3, complete sequence Length = 166604 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 498 acagatatacacagccacacg 518 ||||||||||||||||||||| Sbjct: 116674 acagatatacacagccacacg 116694
>ref|NM_001039163.1| Rattus norvegicus tumor suppressor candidate 5 (Tusc5), mRNA dbj|AB218813.1| Rattus norvegicus mRNA for hypothetical protein, complete cds, brain endothelial cell derived gene-1 Length = 3410 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 866 agacaagagccacatggaaat 886 ||||||||||||||||||||| Sbjct: 1483 agacaagagccacatggaaat 1503
>ref|XM_389378.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09202.1) partial mRNA Length = 921 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 77 caaagccggcggcgacatgcg 97 ||||||||||||||||||||| Sbjct: 920 caaagccggcggcgacatgcg 900
>emb|AL662864.14| Human DNA sequence from clone RP11-493K23 on chromosome X Contains two novel genes, two novel genes similar to poly(A) binding protein cytoplasmic 1 (LOC340530, LOC340529) and two CpG islands, complete sequence Length = 120769 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 861 agatcagacaagagccacatg 881 ||||||||||||||||||||| Sbjct: 97577 agatcagacaagagccacatg 97597
>gb|AC044802.6| Homo sapiens chromosome 16 clone RP11-61A14, complete sequence Length = 170691 Score = 42.1 bits (21), Expect = 3.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 656 gggggtgttgtttgggtggtgggag 680 ||||||||||||||||||| ||||| Sbjct: 19272 gggggtgttgtttgggtggagggag 19248
>emb|AL135750.5|HSO20 Homo sapiens chromosome X sequence from BAC CEPHB20O20 region PHKA1-DXS227 map Xq13, complete sequence Length = 115637 Score = 42.1 bits (21), Expect = 3.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 861 agatcagacaagagccacatg 881 ||||||||||||||||||||| Sbjct: 101022 agatcagacaagagccacatg 101042 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 132,066,944 Number of extensions: 7022438 Number of successful extensions: 179020 Number of sequences better than 10.0: 25 Number of HSP's gapped: 179017 Number of HSP's successfully gapped: 29 Length of query: 985 Length of database: 18,610,659,111 Length adjustment: 23 Effective length of query: 962 Effective length of database: 18,503,978,556 Effective search space: 17800827370872 Effective search space used: 17800827370872 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)