ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf3e13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY106321.1| Zea mays PCO088178 mRNA sequence 335 1e-88
2emb|CT834956.1| Oryza sativa (indica cultivar-group) cDNA clone:... 333 5e-88
3ref|NM_001051196.1| Oryza sativa (japonica cultivar-group) Os01g... 329 8e-87
4dbj|AK242079.1| Oryza sativa (japonica cultivar-group) cDNA, clo... 325 1e-85
5dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 127 6e-26
6dbj|AP003230.4| Oryza sativa (japonica cultivar-group) genomic D... 127 6e-26
7dbj|AK239835.1| Sus scrofa mRNA, clone:UTR010001H11, expressed i... 48 0.046
8gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome... 48 0.046
9gb|AC122147.1| Oryza sativa (japonica cultivar-group) chromosome... 48 0.046
10dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.046
11gb|AC153944.3| Mus musculus 10 BAC RP24-292A13 (Roswell Park Can... 48 0.046
12ref|XM_001063038.1| PREDICTED: Rattus norvegicus similar to KIAA... 46 0.18
13emb|Z94055.1|HS24M15 Human DNA sequence from clone RP1-24M15 on ... 46 0.18
14emb|AL512594.7| Human DNA sequence from clone RP11-549A6 on chro... 46 0.18
15gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosom... 46 0.18
16emb|BX897676.1| Neurospora crassa DNA linkage group VI BAC clone... 46 0.18
17emb|CR513786.5| Zebrafish DNA sequence from clone CH211-92F19 in... 46 0.18
18ref|XM_955282.1| Neurospora crassa OR74A hypothetical protein (N... 46 0.18
19emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on ch... 46 0.18
20gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complet... 46 0.18
21gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21... 44 0.72
22gb|AC154385.2| Mus musculus BAC clone RP23-23O22 from chromosome... 44 0.72
23gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, ... 44 0.72
24gb|AC165245.2| Mus musculus BAC clone RP24-376N22 from chromosom... 44 0.72
25gb|AC115932.11| Mus musculus chromosome 1, clone RP24-538F21, co... 44 0.72
26gb|AC134243.3| Mus musculus BAC clone RP24-90E15 from chromosome... 44 0.72
27gb|AC117229.3| Mus musculus BAC clone RP23-380M1 from chromosome... 44 0.72
28gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, com... 44 0.72
29gb|AC080112.15| Homo sapiens chromosome 17, clone CTD-2267D19, c... 44 0.72
30gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, com... 44 0.72
31gb|AC164004.3| Mus musculus chromosome 5, clone RP23-58C20, comp... 44 0.72
32gb|AC011558.6| Homo sapiens chromosome 19 clone LLNLR-291F12, co... 44 0.72
33gb|AC079223.11| Mus musculus chromosome 1, clone RP22-318M10, co... 44 0.72
34gb|AC155654.16| Mus musculus 6 BAC RP24-192P21 (Roswell Park Can... 44 0.72
35gb|AC151294.3| Mus musculus BAC clone RP23-137I7 from chromosome... 44 0.72
36emb|AL713994.15| Mouse DNA sequence from clone RP23-378H5 on chr... 44 0.72
37gb|AC127372.3| Mus musculus BAC clone RP23-37F11 from chromosome... 44 0.72
38emb|AL928798.20| Mouse DNA sequence from clone RP23-7A19 on chro... 44 0.72
39gb|AC153915.5| Mus musculus 10 BAC RP23-329D23 (Roswell Park Can... 44 0.72
40gb|AC140277.3| Mus musculus BAC clone RP23-336O18 from 5, comple... 44 0.72
41gb|AC147085.3| Mus musculus BAC clone RP23-356J12 from 8, comple... 44 0.72
42emb|CT009732.8| Mouse DNA sequence from clone RP23-72O20 on chro... 44 0.72
43gb|AC158559.7| Mus musculus chromosome 1, clone RP24-300L5, comp... 44 0.72
44gb|CP000479.1| Mycobacterium avium 104, complete genome 42 2.8
45gb|AC190320.7| Mus musculus BAC RP24-328D3 () complete sequence 42 2.8
46ref|XM_001195633.1| PREDICTED: Strongylocentrotus purpuratus hyp... 42 2.8
47ref|XM_001200390.1| PREDICTED: Strongylocentrotus purpuratus hyp... 42 2.8
48emb|CT027567.10| Zebrafish DNA sequence from clone DKEY-31E3 in ... 42 2.8
49gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete s... 42 2.8
50emb|CT827801.6| Pig DNA sequence from clone CH242-209H21 on chro... 42 2.8
51gb|AC102343.8| Mus musculus chromosome 3, clone RP23-254H18, com... 42 2.8
52gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, comp... 42 2.8
53gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 2.8
54gb|AC163676.4| Mus musculus BAC clone RP24-81A22 from chromosome... 42 2.8
55gb|AC131593.16| Mus musculus chromosome 3, clone RP24-566M9, com... 42 2.8
56gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, co... 42 2.8
57gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cance... 42 2.8
58gb|AC165238.5| Mus musculus chromosome 3, clone RP23-466A3, comp... 42 2.8
59gb|AC101559.20| Mus musculus chromosome 5, clone RP23-194K16, co... 42 2.8
60gb|BC039276.1| Mus musculus pleckstrin homology domain containin... 42 2.8
61gb|AC138548.8| Mus musculus chromosome 3, clone RP24-210N9, comp... 42 2.8
62gb|AC127248.3| Mus musculus BAC clone RP24-442E2 from chromosome... 42 2.8
63gb|AC124400.4| Mus musculus BAC clone RP24-357O21 from chromosom... 42 2.8
64gb|AC122879.3| Mus musculus BAC clone RP23-76C10 from 1, complet... 42 2.8
65gb|AC164704.4| Mus musculus BAC clone RP23-238D20 from chromosom... 42 2.8
66gb|AC159816.2| Mus musculus BAC clone RP23-321A19 from chromosom... 42 2.8
67ref|XM_382069.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 42 2.8
68gb|BC040216.1| Mus musculus dynein heavy chain-related, mRNA (cD... 42 2.8
69gb|AC009840.7| Drosophila melanogaster 3L BAC RP98-2B14 (Roswell... 42 2.8
70ref|NM_175175.3| Mus musculus pleckstrin homology domain contain... 42 2.8
71dbj|AK154634.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 2.8
72gb|AC010117.6| Drosophila melanogaster 3L BAC RP98-21J2 (Roswell... 42 2.8
73gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 42 2.8
74gb|AC104333.2| Homo sapiens chromosome 1 clone RP11-348H3, compl... 42 2.8
75dbj|AK033666.1| Mus musculus adult male cecum cDNA, RIKEN full-l... 42 2.8
76gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Canc... 42 2.8
77emb|AL590302.6| Human DNA sequence from clone RP11-252P19 on chr... 42 2.8
78emb|AL445650.9| Human DNA sequence from clone RP11-152K20 on chr... 42 2.8
79gb|AC125310.5| Mus musculus BAC clone RP24-548E5 from chromosome... 42 2.8
80emb|AL805940.7| Mouse DNA sequence from clone RP24-286B19 on chr... 42 2.8
81gb|AC158651.12| Mus musculus BAC RP24-68I7 (Roswell Park Cancer... 42 2.8
82gb|AC132660.7| Homo sapiens 3 BAC RP11-482K2 (Roswell Park Cance... 42 2.8
83emb|AL512584.13| Mouse DNA sequence from clone RP23-232D1 on chr... 42 2.8
84gb|AC138229.16| Mus musculus chromosome 1, clone RP23-399N18, co... 42 2.8
85ref|XM_567746.1| Cryptococcus neoformans var. neoformans JEC21 h... 42 2.8
86emb|AL451077.9| Human DNA sequence from clone RP11-305A3 on chro... 42 2.8
87gb|AF089023.1|AF089023 Euphagus carolinus cytochrome b (cytb) ge... 42 2.8
88gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, co... 42 2.8
89emb|AL732497.15| Mouse DNA sequence from clone RP23-130H14 on ch... 42 2.8
90emb|AL844852.11| Mouse DNA sequence from clone RP23-260N23 on ch... 42 2.8
91emb|CT486006.6| Mouse DNA sequence from clone RP23-433C10 on chr... 42 2.8
92gb|AC144774.3| Mus musculus BAC clone RP24-128I18 from 6, comple... 42 2.8
93gb|AC122486.4| Mus musculus BAC clone RP24-380B9 from 12, comple... 42 2.8
94emb|AL627105.13| Mouse DNA sequence from clone RP23-383D12 on ch... 42 2.8
95gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosom... 42 2.8
96gb|AC165153.2| Mus musculus BAC clone RP23-359L1 from chromosome... 42 2.8
97emb|AL928738.8| Mouse DNA sequence from clone RP23-76M15 on chro... 42 2.8
98emb|AL928545.6| Mouse DNA sequence from clone RP23-218A13 on chr... 42 2.8 
>gb|AY106321.1| Zea mays PCO088178 mRNA sequence
          Length = 748
 Score =  335 bits (169), Expect = 1e-88
 Identities = 265/297 (89%)
 Strand = Plus / Plus

                                                                       
Query: 215 caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 274
           |||||||||||| || || | |||||||||||||||||||||||||||||||||||||||
Sbjct: 148 caagcagtccctcttcggaagcatcaccgaggcgctggacttctcgcaggtccggtcgga 207

                                                                       
Query: 275 gaaggacgcggagctgctgtacgaggccagggattccatcaaagatgaagggaggatgac 334
           ||||||||| ||||||||||||||||||||||| |||| || || || ||||||||||||
Sbjct: 208 gaaggacgccgagctgctgtacgaggccagggagtccaccagaggtggagggaggatgac 267

                                                                       
Query: 335 aagggaacagtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaa 394
            ||||| ||||| | ||| ||| || |||||||||||||||||||| |||||||||||||
Sbjct: 268 gagggagcagtacggagcacttaggcggaagattggtggcacctaccaggatttcttcaa 327

                                                                       
Query: 395 gtcatatgttgaagttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaa 454
           ||||||||||||||| || ||  ||||||||||||| |||||||| ||||||||||||||
Sbjct: 328 gtcatatgttgaagtcgacgggcaatacgtggaggagggttgggtcgacaagacctgcaa 387

                                                                    
Query: 455 agtttgcaagaaagacacaagaggggagccaaggcaagttgacaatctaggaagata 511
             | |||||||| |||||||| |||||||| ||||| |||||||| |||||||||||
Sbjct: 388 gatctgcaagaaggacacaaggggggagccgaggcaggttgacaagctaggaagata 444
to top
>emb|CT834956.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN007P01, full
           insert sequence
          Length = 677

 Score =  333 bits (168), Expect = 5e-88
 Identities = 330/384 (85%)
 Strand = Plus / Plus

                                                                       
Query: 215 caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 274
           |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 198 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 257

                                                                       
Query: 275 gaaggacgcggagctgctgtacgaggccagggattccatcaaagatgaagggaggatgac 334
           ||||||||||||||| ||||| || ||||| ||  |||  || |||| ||| ||||||||
Sbjct: 258 gaaggacgcggagcttctgtatgaagccagagaggccacaaaggatggaggaaggatgac 317

                                                                       
Query: 335 aagggaacagtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaa 394
           || ||| ||||||| ||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 318 aaaggagcagtatggagcacttcggaggaagatcggtggcacctacaaggatttcttcaa 377

                                                                       
Query: 395 gtcatatgttgaagttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaa 454
           ||||||||| || ||||| || |||||||| ||||||||||||||||| |||||||||||
Sbjct: 378 gtcatatgtggatgttgacggggaatacgtagaggaaggttgggtggataagacctgcaa 437

                                                                       
Query: 455 agtttgcaagaaagacacaagaggggagccaaggcaagttgacaatctaggaagatatat 514
           |||||||||||| ||||| |||||||| || ||||| || ||||| ||||||||||||  
Sbjct: 438 agtttgcaagaaggacactagaggggaacccaggcaggtcgacaagctaggaagatatgc 497

                                                                       
Query: 515 gcatgtggcgtgcgcagagaactcgaaaccaacaaacttcttttccaaactcttcggcag 574
            ||||| || |||   |||||| | ||||| || ||| ||||  ||||| | |||| |||
Sbjct: 498 acatgtcgcatgcttggagaacccaaaaccgaccaacatcttcgccaaattgttcgccag 557

                                   
Query: 575 atgaacttcttttgtaccatcaaa 598
           |||||||||  |||||| ||||||
Sbjct: 558 atgaacttcaattgtacaatcaaa 581
to top
>ref|NM_001051196.1| Oryza sativa (japonica cultivar-group) Os01g0823600 (Os01g0823600)
           mRNA, complete cds
          Length = 513

 Score =  329 bits (166), Expect = 8e-87
 Identities = 265/298 (88%)
 Strand = Plus / Plus

                                                                       
Query: 215 caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 274
           |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 150 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 209

                                                                       
Query: 275 gaaggacgcggagctgctgtacgaggccagggattccatcaaagatgaagggaggatgac 334
           ||||||||||||||| ||||| || ||||| ||  |||  || |||| ||| ||||||||
Sbjct: 210 gaaggacgcggagcttctgtatgaagccagagaggccacaaaggatggaggaaggatgac 269

                                                                       
Query: 335 aagggaacagtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaa 394
           || ||| ||||||| ||| |||||||||||||| ||||||||||||||||||||||||||
Sbjct: 270 aaaggagcagtatggagcacttcggaggaagatcggtggcacctacaaggatttcttcaa 329

                                                                       
Query: 395 gtcatatgttgaagttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaa 454
           ||||||||| || ||||| || |||||||| ||||||||||||||||| |||||||||||
Sbjct: 330 gtcatatgtggatgttgacggggaatacgtagaggaaggttgggtggataagacctgcaa 389

                                                                     
Query: 455 agtttgcaagaaagacacaagaggggagccaaggcaagttgacaatctaggaagatat 512
           |||||||||||| ||||| |||||||| || ||||| || ||||| ||||||||||||
Sbjct: 390 agtttgcaagaaggacactagaggggaacccaggcaggtcgacaagctaggaagatat 447
to top
>dbj|AK242079.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J075136P07,
           full insert sequence
          Length = 712

 Score =  325 bits (164), Expect = 1e-85
 Identities = 329/384 (85%)
 Strand = Plus / Plus

                                                                       
Query: 215 caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 274
           |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 202 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 261

                                                                       
Query: 275 gaaggacgcggagctgctgtacgaggccagggattccatcaaagatgaagggaggatgac 334
           ||||||||||||||| ||||| || ||||| ||  |||  || |||| ||| ||||||||
Sbjct: 262 gaaggacgcggagcttctgtatgaagccagagaggccacaaaggatggaggaaggatgac 321

                                                                       
Query: 335 aagggaacagtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaa 394
           || ||| ||||||| ||| ||||||||||||||  |||||||||||||||||||||||||
Sbjct: 322 aaaggagcagtatggagcacttcggaggaagatcagtggcacctacaaggatttcttcaa 381

                                                                       
Query: 395 gtcatatgttgaagttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaa 454
           ||||||||| || ||||| || |||||||| ||||||||||||||||| |||||||||||
Sbjct: 382 gtcatatgtggatgttgacggggaatacgtagaggaaggttgggtggataagacctgcaa 441

                                                                       
Query: 455 agtttgcaagaaagacacaagaggggagccaaggcaagttgacaatctaggaagatatat 514
           |||||||||||| ||||| |||||||| || ||||| || ||||| ||||||||||||  
Sbjct: 442 agtttgcaagaaggacactagaggggaacccaggcaggtcgacaagctaggaagatatgc 501

                                                                       
Query: 515 gcatgtggcgtgcgcagagaactcgaaaccaacaaacttcttttccaaactcttcggcag 574
            ||||| || |||   |||||| | ||||| || ||| ||||  ||||| | |||| |||
Sbjct: 502 acatgtcgcatgcttggagaacccaaaaccgaccaacatcttcgccaaattgttcgccag 561

                                   
Query: 575 atgaacttcttttgtaccatcaaa 598
           |||||||||  |||||| ||||||
Sbjct: 562 atgaacttcaattgtacaatcaaa 585
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  127 bits (64), Expect = 6e-26
 Identities = 160/192 (83%)
 Strand = Plus / Plus

                                                                            
Query: 407      agttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaaagtttgcaagaa 466
                |||||| || |||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 35169399 agttgacggggaatacgtagaggaaggttgggtggataagacctgcaaagtttgcaagaa 35169458

                                                                            
Query: 467      agacacaagaggggagccaaggcaagttgacaatctaggaagatatatgcatgtggcgtg 526
                 ||||| |||||||| || ||||| || ||||| ||||||||||||   ||||| || ||
Sbjct: 35169459 ggacactagaggggaacccaggcaggtcgacaagctaggaagatatgcacatgtcgcatg 35169518

                                                                            
Query: 527      cgcagagaactcgaaaccaacaaacttcttttccaaactcttcggcagatgaacttcttt 586
                |   |||||| | ||||| || ||| ||||  ||||| | |||| ||||||||||||  |
Sbjct: 35169519 cttggagaacccaaaaccgaccaacatcttcgccaaattgttcgccagatgaacttcaat 35169578

                            
Query: 587      tgtaccatcaaa 598
                ||||| ||||||
Sbjct: 35169579 tgtacaatcaaa 35169590



 Score =  123 bits (62), Expect = 1e-24
 Identities = 83/90 (92%)
 Strand = Plus / Plus

                                                                            
Query: 215      caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 274
                |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 35168960 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 35169019

                                              
Query: 275      gaaggacgcggagctgctgtacgaggccag 304
                ||||||||||||||| ||||| || |||||
Sbjct: 35169020 gaaggacgcggagcttctgtatgaagccag 35169049



 Score = 97.6 bits (49), Expect = 6e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                            
Query: 343      agtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaagtcatatg 402
                |||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 35169222 agtatggagcacttcggaggaagatcggtggcacctacaaggatttcttcaagtcatatg 35169281

                 
Query: 403      t 403
                |
Sbjct: 35169282 t 35169282
to top
>dbj|AP003230.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0031D02
          Length = 183692

 Score =  127 bits (64), Expect = 6e-26
 Identities = 160/192 (83%)
 Strand = Plus / Plus

                                                                         
Query: 407   agttgatggcgaatacgtggaggaaggttgggtggacaagacctgcaaagtttgcaagaa 466
             |||||| || |||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 48483 agttgacggggaatacgtagaggaaggttgggtggataagacctgcaaagtttgcaagaa 48542

                                                                         
Query: 467   agacacaagaggggagccaaggcaagttgacaatctaggaagatatatgcatgtggcgtg 526
              ||||| |||||||| || ||||| || ||||| ||||||||||||   ||||| || ||
Sbjct: 48543 ggacactagaggggaacccaggcaggtcgacaagctaggaagatatgcacatgtcgcatg 48602

                                                                         
Query: 527   cgcagagaactcgaaaccaacaaacttcttttccaaactcttcggcagatgaacttcttt 586
             |   |||||| | ||||| || ||| ||||  ||||| | |||| ||||||||||||  |
Sbjct: 48603 cttggagaacccaaaaccgaccaacatcttcgccaaattgttcgccagatgaacttcaat 48662

                         
Query: 587   tgtaccatcaaa 598
             ||||| ||||||
Sbjct: 48663 tgtacaatcaaa 48674



 Score =  123 bits (62), Expect = 1e-24
 Identities = 83/90 (92%)
 Strand = Plus / Plus

                                                                         
Query: 215   caagcagtccctgtttgggaacatcaccgaggcgctggacttctcgcaggtccggtcgga 274
             |||||||||  |||| |||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 48044 caagcagtcattgttcgggagcatcaccgaggcgctggacttctcgcaggtccggtcgga 48103

                                           
Query: 275   gaaggacgcggagctgctgtacgaggccag 304
             ||||||||||||||| ||||| || |||||
Sbjct: 48104 gaaggacgcggagcttctgtatgaagccag 48133



 Score = 97.6 bits (49), Expect = 6e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                         
Query: 343   agtatgcagcgcttcggaggaagattggtggcacctacaaggatttcttcaagtcatatg 402
             |||||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 48306 agtatggagcacttcggaggaagatcggtggcacctacaaggatttcttcaagtcatatg 48365

              
Query: 403   t 403
             |
Sbjct: 48366 t 48366
to top
>dbj|AK239835.1| Sus scrofa mRNA, clone:UTR010001H11, expressed in uterus
          Length = 1115

 Score = 48.1 bits (24), Expect = 0.046
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                       
Query: 189 gaggaggagggggagaagaaggtgccca 216
           |||||||||| |||||||||||||||||
Sbjct: 457 gaggaggaggaggagaagaaggtgccca 484
to top
>gb|AC145127.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone
               Pseudo10p0.0-10p4.4, complete sequence
          Length = 2331000

 Score = 48.1 bits (24), Expect = 0.046
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 185     agatgaggaggagggggagaagaa 208
               ||||||||||||||||||||||||
Sbjct: 1900619 agatgaggaggagggggagaagaa 1900642
to top
>gb|AC122147.1| Oryza sativa (japonica cultivar-group) chromosome 10 clone OSJNAb0072F04,
              complete sequence
          Length = 137724

 Score = 48.1 bits (24), Expect = 0.046
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 185    agatgaggaggagggggagaagaa 208
              ||||||||||||||||||||||||
Sbjct: 119072 agatgaggaggagggggagaagaa 119095
to top
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10
          Length = 22685906

 Score = 48.1 bits (24), Expect = 0.046
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                       
Query: 185     agatgaggaggagggggagaagaa 208
               ||||||||||||||||||||||||
Sbjct: 1900619 agatgaggaggagggggagaagaa 1900642
to top
>gb|AC153944.3| Mus musculus 10 BAC RP24-292A13 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 139203

 Score = 48.1 bits (24), Expect = 0.046
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 189    gaggaggagggggagaagaaggtg 212
              ||||||||||||||||||||||||
Sbjct: 103982 gaggaggagggggagaagaaggtg 104005
to top
>ref|XM_001063038.1| PREDICTED: Rattus norvegicus similar to KIAA1387 protein (predicted)
            (RGD1562980_predicted), mRNA
          Length = 2625

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 189  gaggaggagggggagaagaaggt 211
            |||||||||||||||||||||||
Sbjct: 2309 gaggaggagggggagaagaaggt 2331
to top
>emb|Z94055.1|HS24M15 Human DNA sequence from clone RP1-24M15 on chromosome 1q24-25 Contains
             part of the TNR gene fortenascin R (restrictin, janusin),
             complete sequence
          Length = 134539

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 677   catgtgaaatattttttgatgag 699
             |||||||||||||||||||||||
Sbjct: 78481 catgtgaaatattttttgatgag 78503
to top
>emb|AL512594.7| Human DNA sequence from clone RP11-549A6 on chromosome 9 Contains a
             pseudogene similar to part of a GTPase-activating protein,
             complete sequence
          Length = 166192

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 198   ggggagaagaaggtgcccaagcagtccctgt 228
             |||||||||||||||  ||||||||||||||
Sbjct: 84304 ggggagaagaaggtgagcaagcagtccctgt 84334
to top
>gb|AC159237.2| Mus musculus BAC clone RP24-464G10 from chromosome 12, complete
             sequence
          Length = 222209

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 154   ctactaggtcagtcagggcttat 176
             |||||||||||||||||||||||
Sbjct: 53257 ctactaggtcagtcagggcttat 53235
to top
>emb|BX897676.1| Neurospora crassa DNA linkage group VI BAC clone B8I24
          Length = 83591

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 544   caacaaacttcttttccaaactcttcggcag 574
             |||||||||||| ||||| ||||||||||||
Sbjct: 73326 caacaaacttctcttccatactcttcggcag 73296
to top
>emb|CR513786.5| Zebrafish DNA sequence from clone CH211-92F19 in linkage group 14,
             complete sequence
          Length = 97391

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 179   gaaagcagatgaggaggagggggagaagaag 209
             ||||| |||||||||||||| ||||||||||
Sbjct: 47517 gaaaggagatgaggaggaggaggagaagaag 47547
to top
>ref|XM_955282.1| Neurospora crassa OR74A hypothetical protein (NCU04740.1) partial
           mRNA
          Length = 1305

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 544 caacaaacttcttttccaaactcttcggcag 574
           |||||||||||| ||||| ||||||||||||
Sbjct: 736 caacaaacttctcttccatactcttcggcag 706
to top
>emb|AL596265.12| Mouse DNA sequence from clone RP23-134O19 on chromosome 12, complete
             sequence
          Length = 205332

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 183   gcagatgaggaggagggggagaagaag 209
             ||||| |||||||||||||||||||||
Sbjct: 76157 gcagaagaggaggagggggagaagaag 76131
to top
>gb|AC127582.4| Mus musculus BAC clone RP24-89J3 from 12, complete sequence
          Length = 217949

 Score = 46.1 bits (23), Expect = 0.18
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 154   ctactaggtcagtcagggcttat 176
             |||||||||||||||||||||||
Sbjct: 54501 ctactaggtcagtcagggcttat 54523
to top
>gb|AC090426.1| Homo sapiens chromosome 17 clone 205m17 map 17q21.1, complete sequence
          Length = 138999

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 65076 gaggaggagggggagaagaagg 65097
to top
>gb|AC154385.2| Mus musculus BAC clone RP23-23O22 from chromosome 17, complete sequence
          Length = 221564

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 180   aaagcagatgaggaggagggggagaagaag 209
             |||| ||| |||||||||||||||||||||
Sbjct: 40692 aaagaagaggaggaggagggggagaagaag 40721
to top
>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 86      ccctacccagagctcctcattt 107
               ||||||||||||||||||||||
Sbjct: 3767647 ccctacccagagctcctcattt 3767626
to top
>gb|AC165245.2| Mus musculus BAC clone RP24-376N22 from chromosome 9, complete sequence
          Length = 217074

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 189    gaggaggagggggagaagaagg 210
              ||||||||||||||||||||||
Sbjct: 134156 gaggaggagggggagaagaagg 134177
to top
>gb|AC115932.11| Mus musculus chromosome 1, clone RP24-538F21, complete sequence
          Length = 205378

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 189    gaggaggagggggagaagaagg 210
              ||||||||||||||||||||||
Sbjct: 185435 gaggaggagggggagaagaagg 185456
to top
>gb|AC134243.3| Mus musculus BAC clone RP24-90E15 from chromosome 17, complete sequence
          Length = 193151

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 180    aaagcagatgaggaggagggggagaagaag 209
              |||| ||| |||||||||||||||||||||
Sbjct: 154826 aaagaagaggaggaggagggggagaagaag 154855
to top
>gb|AC117229.3| Mus musculus BAC clone RP23-380M1 from chromosome 2, complete sequence
          Length = 187221

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 539    gaaaccaacaaacttcttttcc 560
              ||||||||||||||||||||||
Sbjct: 102019 gaaaccaacaaacttcttttcc 101998
to top
>gb|AC111044.9| Mus musculus chromosome 10, clone RP23-299H4, complete sequence
          Length = 165614

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 189    gaggaggagggggagaagaagg 210
              ||||||||||||||||||||||
Sbjct: 135673 gaggaggagggggagaagaagg 135652
to top
>gb|AC080112.15| Homo sapiens chromosome 17, clone CTD-2267D19, complete sequence
          Length = 175014

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 49001 gaggaggagggggagaagaagg 49022
to top
>gb|AC018629.12| Homo sapiens chromosome 17, clone RP11-58O9, complete sequence
          Length = 166234

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 29745 gaggaggagggggagaagaagg 29724
to top
>gb|AC164004.3| Mus musculus chromosome 5, clone RP23-58C20, complete sequence
          Length = 198872

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 60381 gaggaggagggggagaagaagg 60360
to top
>gb|AC011558.6| Homo sapiens chromosome 19 clone LLNLR-291F12, complete sequence
          Length = 43128

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 25611 gaggaggagggggagaagaagg 25632
to top
>gb|AC079223.11| Mus musculus chromosome 1, clone RP22-318M10, complete sequence
          Length = 137729

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 15619 gaggaggagggggagaagaagg 15640
to top
>gb|AC155654.16| Mus musculus 6 BAC RP24-192P21 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 147486

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 185   agatgaggaggagggggagaagaagg 210
             |||||||||||||| |||||||||||
Sbjct: 67325 agatgaggaggaggaggagaagaagg 67300
to top
>gb|AC151294.3| Mus musculus BAC clone RP23-137I7 from chromosome 17, complete sequence
          Length = 206868

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 185   agatgaggaggagggggagaag 206
             ||||||||||||||||||||||
Sbjct: 92128 agatgaggaggagggggagaag 92149
to top
>emb|AL713994.15| Mouse DNA sequence from clone RP23-378H5 on chromosome 11 Contains the 5'
              end of the Arf-1 gene for ADP-ribosylation factor 1, the
              Wnt3a gene for wingless-related MMTV integration site 3A,
              the Wnt9a gene for wingless-type MMTV integration site 9A,
              two novel genes, the 5' end of a novel gene and five CpG
              islands, complete sequence
          Length = 225396

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 189    gaggaggagggggagaagaagg 210
              ||||||||||||||||||||||
Sbjct: 165058 gaggaggagggggagaagaagg 165079
to top
>gb|AC127372.3| Mus musculus BAC clone RP23-37F11 from chromosome 8, complete sequence
          Length = 175472

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 189    gaggaggagggggagaagaagg 210
              ||||||||||||||||||||||
Sbjct: 151562 gaggaggagggggagaagaagg 151541
to top
>emb|AL928798.20| Mouse DNA sequence from clone RP23-7A19 on chromosome 2, complete
             sequence
          Length = 192734

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 539   gaaaccaacaaacttcttttcc 560
             ||||||||||||||||||||||
Sbjct: 23522 gaaaccaacaaacttcttttcc 23543
to top
>gb|AC153915.5| Mus musculus 10 BAC RP23-329D23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 207169

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 185    agatgaggaggagggggagaagaagg 210
              |||||||||||||| |||||||||||
Sbjct: 206253 agatgaggaggaggaggagaagaagg 206278
to top
>gb|AC140277.3| Mus musculus BAC clone RP23-336O18 from 5, complete sequence
          Length = 198919

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 189    gaggaggagggggagaagaagg 210
              ||||||||||||||||||||||
Sbjct: 190064 gaggaggagggggagaagaagg 190043
to top
>gb|AC147085.3| Mus musculus BAC clone RP23-356J12 from 8, complete sequence
          Length = 209306

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 189    gaggaggagggggagaagaagg 210
              ||||||||||||||||||||||
Sbjct: 149430 gaggaggagggggagaagaagg 149451
to top
>emb|CT009732.8| Mouse DNA sequence from clone RP23-72O20 on chromosome 9, complete
             sequence
          Length = 239257

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 54184 gaggaggagggggagaagaagg 54205
to top
>gb|AC158559.7| Mus musculus chromosome 1, clone RP24-300L5, complete sequence
          Length = 169324

 Score = 44.1 bits (22), Expect = 0.72
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 189   gaggaggagggggagaagaagg 210
             ||||||||||||||||||||||
Sbjct: 36709 gaggaggagggggagaagaagg 36730
to top
>gb|CP000479.1| Mycobacterium avium 104, complete genome
          Length = 5475491

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 271     cggagaaggacgcggagctgc 291
               |||||||||||||||||||||
Sbjct: 3754565 cggagaaggacgcggagctgc 3754585
to top
>gb|AC190320.7| Mus musculus  BAC RP24-328D3 () complete sequence
          Length = 171842

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 128137 gaggaggagggggagaagaag 128157
to top
>ref|XM_001195633.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC765256 (LOC765256), mRNA
          Length = 339

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 190 aggaggagggggagaagaagg 210
           |||||||||||||||||||||
Sbjct: 74  aggaggagggggagaagaagg 94
to top
>ref|XM_001200390.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein
           LOC764166 (LOC764166), mRNA
          Length = 339

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 190 aggaggagggggagaagaagg 210
           |||||||||||||||||||||
Sbjct: 74  aggaggagggggagaagaagg 94
to top
>emb|CT027567.10| Zebrafish DNA sequence from clone DKEY-31E3 in linkage group 23,
             complete sequence
          Length = 158422

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 390   ttcaagtcatatgttgaagtt 410
             |||||||||||||||||||||
Sbjct: 64128 ttcaagtcatatgttgaagtt 64148
to top
>gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete sequence
          Length = 24543557

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 679      tgtgaaatattttttgatgag 699
                |||||||||||||||||||||
Sbjct: 20542078 tgtgaaatattttttgatgag 20542098
to top
>emb|CT827801.6| Pig DNA sequence from clone CH242-209H21 on chromosome 14, complete
              sequence
          Length = 205646

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 661    atagtaatgtgttgtccatgt 681
              |||||||||||||||||||||
Sbjct: 166851 atagtaatgtgttgtccatgt 166871
to top
>gb|AC102343.8| Mus musculus chromosome 3, clone RP23-254H18, complete sequence
          Length = 220876

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 163036 gaggaggagggggagaagaag 163016
to top
>gb|AC121832.3| Mus musculus chromosome 10 clone RP24-67D23, complete sequence
          Length = 172348

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 189  gaggaggagggggagaagaag 209
            |||||||||||||||||||||
Sbjct: 3711 gaggaggagggggagaagaag 3731
to top
>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete
              sequence
          Length = 1019846

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 186    gatgaggaggagggggagaagaagg 210
              |||||||||||||||||||| ||||
Sbjct: 795846 gatgaggaggagggggagaacaagg 795870
to top
>gb|AC163676.4| Mus musculus BAC clone RP24-81A22 from chromosome 3, complete sequence
          Length = 223760

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 130120 gaggaggagggggagaagaag 130100
to top
>gb|AC131593.16| Mus musculus chromosome 3, clone RP24-566M9, complete sequence
          Length = 143352

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 24762 gaggaggagggggagaagaag 24742
to top
>gb|AC139211.13| Mus musculus chromosome 6, clone RP23-302O24, complete sequence
          Length = 154129

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 179   gaaagcagatgaggaggaggg 199
             |||||||||||||||||||||
Sbjct: 59222 gaaagcagatgaggaggaggg 59242
to top
>gb|AC155946.7| Mus musculus 6 BAC RP24-483K3 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 178502

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 162568 gaggaggagggggagaagaag 162548
to top
>gb|AC165238.5| Mus musculus chromosome 3, clone RP23-466A3, complete sequence
          Length = 180939

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 143072 gaggaggagggggagaagaag 143092
to top
>gb|AC101559.20| Mus musculus chromosome 5, clone RP23-194K16, complete sequence
          Length = 252554

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 194083 gaggaggagggggagaagaag 194063
to top
>gb|BC039276.1| Mus musculus pleckstrin homology domain containing, family F (with
           FYVE domain) member 2, mRNA (cDNA clone MGC:36376
           IMAGE:4987735), complete cds
          Length = 2892

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 306 gattccatcaaagatgaaggg 326
           |||||||||||||||||||||
Sbjct: 454 gattccatcaaagatgaaggg 474
to top
>gb|AC138548.8| Mus musculus chromosome 3, clone RP24-210N9, complete sequence
          Length = 155964

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 54402 gaggaggagggggagaagaag 54422
to top
>gb|AC127248.3| Mus musculus BAC clone RP24-442E2 from chromosome 5, complete sequence
          Length = 176488

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 115265 gaggaggagggggagaagaag 115285
to top
>gb|AC124400.4| Mus musculus BAC clone RP24-357O21 from chromosome 14, complete
             sequence
          Length = 191219

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 306   gattccatcaaagatgaaggg 326
             |||||||||||||||||||||
Sbjct: 90762 gattccatcaaagatgaaggg 90782
to top
>gb|AC122879.3| Mus musculus BAC clone RP23-76C10 from 1, complete sequence
          Length = 250884

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 234680 gaggaggagggggagaagaag 234660
to top
>gb|AC164704.4| Mus musculus BAC clone RP23-238D20 from chromosome 6, complete sequence
          Length = 189119

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 73     ctctcgctctttcccctaccc 93
              |||||||||||||||||||||
Sbjct: 131699 ctctcgctctttcccctaccc 131719
to top
>gb|AC159816.2| Mus musculus BAC clone RP23-321A19 from chromosome 9, complete sequence
          Length = 191274

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 106050 gaggaggagggggagaagaag 106070
to top
>ref|XM_382069.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG01893.1) partial mRNA
          Length = 2478

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                        
Query: 183 gcagatgaggaggaggg-ggagaagaagg 210
           ||||||||||||||||| |||||||||||
Sbjct: 607 gcagatgaggaggagggtggagaagaagg 635
to top
>gb|BC040216.1| Mus musculus dynein heavy chain-related, mRNA (cDNA clone
            IMAGE:5363263), with apparent retained intron
          Length = 5542

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 189  gaggaggagggggagaagaag 209
            |||||||||||||||||||||
Sbjct: 5321 gaggaggagggggagaagaag 5341
to top
>gb|AC009840.7| Drosophila melanogaster 3L BAC RP98-2B14 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 194790

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 679    tgtgaaatattttttgatgag 699
              |||||||||||||||||||||
Sbjct: 171968 tgtgaaatattttttgatgag 171988
to top
>ref|NM_175175.3| Mus musculus pleckstrin homology domain containing, family F (with
           FYVE domain) member 2 (Plekhf2), mRNA
 gb|BC016134.1| Mus musculus pleckstrin homology domain containing, family F (with
           FYVE domain) member 2, mRNA (cDNA clone MGC:28979
           IMAGE:4503757), complete cds
          Length = 2897

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 306 gattccatcaaagatgaaggg 326
           |||||||||||||||||||||
Sbjct: 444 gattccatcaaagatgaaggg 464
to top
>dbj|AK154634.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630101M03
           product:pleckstrin homology domain containing, family F
           (with FYVE domain) member 2, full insert sequence
          Length = 1964

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 306 gattccatcaaagatgaaggg 326
           |||||||||||||||||||||
Sbjct: 494 gattccatcaaagatgaaggg 514
to top
>gb|AC010117.6| Drosophila melanogaster 3L BAC RP98-21J2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 178965

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 679    tgtgaaatattttttgatgag 699
              |||||||||||||||||||||
Sbjct: 147942 tgtgaaatattttttgatgag 147922
to top
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 241     ccgaggcgctggacttctcgc 261
               |||||||||||||||||||||
Sbjct: 1358734 ccgaggcgctggacttctcgc 1358714
to top
>gb|AC104333.2| Homo sapiens chromosome 1 clone RP11-348H3, complete sequence
          Length = 162984

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 696   tgagcatatatgcacattcca 716
             |||||||||||||||||||||
Sbjct: 48503 tgagcatatatgcacattcca 48523
to top
>dbj|AK033666.1| Mus musculus adult male cecum cDNA, RIKEN full-length enriched
           library, clone:9130213H04 product:CDNA FLJ13187 FIS,
           CLONE NT2RP3004242, WEAKLY SIMILAR TO PUTATIVE RHO/RAC
           GUANINE NUCLEOTIDE EXCHANGE FACTOR (HYPOTHETICAL 27.8
           KDA PROTEIN) homolog [Homo sapiens], full insert
           sequence
          Length = 2228

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 306 gattccatcaaagatgaaggg 326
           |||||||||||||||||||||
Sbjct: 497 gattccatcaaagatgaaggg 517
to top
>gb|AC073358.14| Homo sapiens 3 BAC RP11-501M7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 164078

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 190   aggaggagggggagaagaagg 210
             |||||||||||||||||||||
Sbjct: 82730 aggaggagggggagaagaagg 82710
to top
>emb|AL590302.6| Human DNA sequence from clone RP11-252P19 on chromosome 6 Contains 2
            novel genes and 3 CpG islands, complete sequence
          Length = 105898

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 186  gatgaggaggagggggagaagaagg 210
            ||||||||||||| |||||||||||
Sbjct: 6972 gatgaggaggaggaggagaagaagg 6996
to top
>emb|AL445650.9| Human DNA sequence from clone RP11-152K20 on chromosome 1 Contains the
             5' end of the USH2A gene for Usher syndrome 2A (autosomal
             recessive, mild) and the 3' end of the ESRRG gene for
             estrogen-related receptor gamma, complete sequence
          Length = 153705

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 80412 gaggaggagggggagaagaag 80432
to top
>gb|AC125310.5| Mus musculus BAC clone RP24-548E5 from chromosome 1, complete sequence
          Length = 223534

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 217892 gaggaggagggggagaagaag 217912
to top
>emb|AL805940.7| Mouse DNA sequence from clone RP24-286B19 on chromosome 4, complete
             sequence
          Length = 128829

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 89195 gaggaggagggggagaagaag 89215
to top
>gb|AC158651.12| Mus musculus  BAC RP24-68I7 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 190089

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 63490 gaggaggagggggagaagaag 63470
to top
>gb|AC132660.7| Homo sapiens 3 BAC RP11-482K2 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 64263

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 51631 gaggaggagggggagaagaag 51611
to top
>emb|AL512584.13| Mouse DNA sequence from clone RP23-232D1 on chromosome 2, complete
            sequence
          Length = 141386

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 189  gaggaggagggggagaagaag 209
            |||||||||||||||||||||
Sbjct: 5537 gaggaggagggggagaagaag 5517
to top
>gb|AC138229.16| Mus musculus chromosome 1, clone RP23-399N18, complete sequence
          Length = 211732

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 130062 gaggaggagggggagaagaag 130042
to top
>ref|XM_567746.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNK02720) partial mRNA
          Length = 4178

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 186  gatgaggaggagggggagaagaagg 210
            |||||||||||||||||||| ||||
Sbjct: 1533 gatgaggaggagggggagaacaagg 1557
to top
>emb|AL451077.9| Human DNA sequence from clone RP11-305A3 on chromosome 1, complete
            sequence
          Length = 173609

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 696  tgagcatatatgcacattcca 716
            |||||||||||||||||||||
Sbjct: 7253 tgagcatatatgcacattcca 7233
to top
>gb|AF089023.1|AF089023 Euphagus carolinus cytochrome b (cytb) gene, mitochondrial gene
           encoding mitochondrial protein, partial cds
          Length = 888

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 422 cgtggaggaaggttgggtggacaag 446
           |||||||||||||| ||||||||||
Sbjct: 487 cgtggaggaaggttaggtggacaag 463
to top
>gb|AC013622.12| Mus musculus chromosome 5, clone RP23-232H18, complete sequence
          Length = 240821

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 130484 gaggaggagggggagaagaag 130504
to top
>emb|AL732497.15| Mouse DNA sequence from clone RP23-130H14 on chromosome 4, complete
             sequence
          Length = 208663

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 306   gattccatcaaagatgaaggg 326
             |||||||||||||||||||||
Sbjct: 86024 gattccatcaaagatgaaggg 86004
to top
>emb|AL844852.11| Mouse DNA sequence from clone RP23-260N23 on chromosome 2, complete
              sequence
          Length = 257676

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 246251 gaggaggagggggagaagaag 246271
to top
>emb|CT486006.6| Mouse DNA sequence from clone RP23-433C10 on chromosome 9, complete
              sequence
          Length = 208668

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 109339 gaggaggagggggagaagaag 109319
to top
>gb|AC144774.3| Mus musculus BAC clone RP24-128I18 from 6, complete sequence
          Length = 143838

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 73     ctctcgctctttcccctaccc 93
              |||||||||||||||||||||
Sbjct: 132005 ctctcgctctttcccctaccc 131985
to top
>gb|AC122486.4| Mus musculus BAC clone RP24-380B9 from 12, complete sequence
          Length = 128253

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 190   aggaggagggggagaagaagg 210
             |||||||||||||||||||||
Sbjct: 96379 aggaggagggggagaagaagg 96359
to top
>emb|AL627105.13| Mouse DNA sequence from clone RP23-383D12 on chromosome 4, complete
             sequence
          Length = 190882

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 54679 gaggaggagggggagaagaag 54699
to top
>gb|AC164643.4| Mus musculus BAC clone RP23-254F23 from chromosome 7, complete sequence
          Length = 232098

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 189    gaggaggagggggagaagaag 209
              |||||||||||||||||||||
Sbjct: 117219 gaggaggagggggagaagaag 117199
to top
>gb|AC165153.2| Mus musculus BAC clone RP23-359L1 from chromosome 17, complete sequence
          Length = 219548

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 189   gaggaggagggggagaagaag 209
             |||||||||||||||||||||
Sbjct: 40063 gaggaggagggggagaagaag 40083
to top
>emb|AL928738.8| Mouse DNA sequence from clone RP23-76M15 on chromosome 4, complete
             sequence
          Length = 188568

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 314   caaagatgaagggaggatgacaagg 338
             ||||||||||| |||||||||||||
Sbjct: 63432 caaagatgaagagaggatgacaagg 63456
to top
>emb|AL928545.6| Mouse DNA sequence from clone RP23-218A13 on chromosome 2, complete
            sequence
          Length = 199257

 Score = 42.1 bits (21), Expect = 2.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 23   ggtgaaggagaaccaagaacc 43
            |||||||||||||||||||||
Sbjct: 6768 ggtgaaggagaaccaagaacc 6788


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 137,102,845
Number of extensions: 7726088
Number of successful extensions: 175148
Number of sequences better than 10.0: 98
Number of HSP's gapped: 175144
Number of HSP's successfully gapped: 102
Length of query: 759
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 737
Effective length of database: 18,508,616,841
Effective search space: 13640850611817
Effective search space used: 13640850611817
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top