Clone Name	FLbaf76g16
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|DQ057344.1| Triticum aestivum mitochondrial L2 ribosomal prot...	1417	0.0
2	gb|DQ057345.1| Triticum aestivum mitochondrial L2 ribosomal prot...	1415	0.0
3	gb|AY044158.1| Zea mays ribosomal protein L2 mRNA, complete cds;...	127	1e-25
4	gb|AY108838.1| Zea mays PCO101143 mRNA sequence	127	1e-25
5	dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochond...	111	6e-21
6	gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar N...	111	6e-21
7	gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA...	111	6e-21
8	gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-1...	111	6e-21
9	dbj|D13109.1|RICMT13 Oryza sativa (japonica cultivar-group) mito...	111	6e-21
10	dbj|D78336.1| Oryza sativa (japonica cultivar-group) mitochondri...	111	6e-21
11	gb|AY832244.1| Eichhornia crassipes ribosomal protein L2 (rpl2) ...	88	9e-14
12	gb|AF387188.1|AF387188 Ulmus thomasii ribosomal protein L2 (rpl2...	84	1e-12
13	gb|AF387187.1|AF387187 Gossypium arboreum ribosomal protein L2 (...	84	1e-12
14	emb|X80170.1|OBRP12 O.berteriana rpl2 gene	84	1e-12
15	gb|AY832246.1| Platanus occidentalis ribosomal protein L2 (rpl2)...	84	1e-12
16	gb|AY832245.1| Mahonia bealei ribosomal protein L2 (rpl2) gene, ...	84	1e-12
17	gb|AY832243.1| Amborella trichopoda ribosomal protein L2 (rpl2) ...	84	1e-12
18	gb|AF387182.1|AF387182 Viburnum sp. Qiu95083 ribosomal protein L...	82	6e-12
19	gb|AF387175.1|AF387175 Platanus occidentalis ribosomal protein L...	82	6e-12
20	gb|AF387174.1|AF387174 Dicentra sp. Qiu 95026 ribosomal protein ...	82	6e-12
21	gb|AF387183.1|AF387183 Lonicera sp. Palmer 679 ribosomal protein...	78	9e-11
22	gb|AY832242.1| Liriodendron tulipifera ribosomal protein L2 (rpl...	78	9e-11
23	gb|AY832248.1| Zamia integrifolia ribosomal protein L2 (rpl2) ge...	76	4e-10
24	gb|AF387180.1|AF387180 Diospyros virginiana ribosomal protein L2...	74	1e-09
25	gb|AF387184.1|AF387184 Abutilon theophrasti ribosomal protein L2...	70	2e-08
26	gb|AY832247.1| Pinus thunbergii ribosomal protein L2 (rpl2) gene...	70	2e-08
27	gb|AF387185.1|AF387185 Quercus alba ribosomal protein L2 (rpl2) ...	68	9e-08
28	dbj|BA000042.1| Nicotiana tabacum mitochondrial DNA, complete ge...	68	9e-08
29	emb|X66519.1|MTNSUA N.sylvestris mitochondrion DNA	68	9e-08
30	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	66	3e-07
31	gb|AF387179.1|AF387179 Hydrangea arborescens ribosomal protein L...	66	3e-07
32	dbj|AP002521.1| Oryza sativa (japonica cultivar-group) genomic D...	66	3e-07
33	dbj|AP002539.2| Oryza sativa (japonica cultivar-group) genomic D...	66	3e-07
34	dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete ge...	62	5e-06
35	gb|AY109618.1| Zea mays CL8996_1 mRNA sequence	62	5e-06
36	emb|AJ295995.1|TAE295995 Triticum aestivum mitochondrial partial...	62	5e-06
37	dbj|AK229943.1| Arabidopsis thaliana mRNA for hypothetical prote...	60	2e-05
38	ref|NM_126755.1| Arabidopsis thaliana structural constituent of ...	60	2e-05
39	gb|AC007729.3| Arabidopsis thaliana chromosome 2 BAC T18C6 genom...	60	2e-05
40	gb|AF387186.1|AF387186 Lonicera sp. Palmer 679 ribosomal protein...	60	2e-05
41	emb|Y08501.2|MIATGENA Arabidopsis thaliana mitochondrial genome	60	2e-05
42	gb|AF095278.1| Solanum tuberosum ribosomal protein large subunit...	60	2e-05
43	dbj|AP006444.1| Brassica napus mitochondrial DNA, complete genome	60	2e-05
44	emb|X82565.1|MIATRPL2 A.thaliana mitochondrial gene rp12 (5' end)	60	2e-05
45	gb|AC172860.1| Brassica rapa subsp. pekinensis clone KBrB042G11,...	60	2e-05
46	gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ...	58	8e-05
47	gb|DQ246077.1| Zea mays clone 14417 mRNA sequence	56	3e-04
48	ref|NM_114978.1| Arabidopsis thaliana structural constituent of ...	56	3e-04
49	gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, part...	56	3e-04
50	gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At...	56	3e-04
51	gb|AF387177.1|AF387177 Corylopsis glabrescens f. gotoana ribosom...	56	3e-04
52	emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B...	56	3e-04
53	gb|AY105581.1| Zea mays PCO150618 mRNA sequence	56	3e-04
54	dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase...	54	0.001
55	gb|CP000454.1| Arthrobacter sp. FB24, complete genome	52	0.005
56	dbj|AB251495.1| Physcomitrella patens mitochondrial DNA, complet...	52	0.005
57	gb|M68929.1|MPOMTCG Marchantia polymorpha mitochondrion, complet...	52	0.005
58	gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal ...	52	0.005
59	gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal ...	52	0.005
60	gb|BT012998.1| Lycopersicon esculentum clone 114219R, mRNA sequence	52	0.005
61	gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome	52	0.005
62	gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds	52	0.005
63	gb|AY044159.1| Lycopersicon esculentum ribosomal protein L2 gene...	52	0.005
64	gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mR...	52	0.005
65	gb|CP000325.1| Mycobacterium ulcerans Agy99, complete genome	50	0.020
66	gb|CP000479.1| Mycobacterium avium 104, complete genome	50	0.020
67	gb|CP000088.1| Thermobifida fusca YX, complete genome	50	0.020
68	emb|CT834502.1| Oryza sativa (indica cultivar-group) cDNA clone:...	48	0.080
69	emb|CT834501.1| Oryza sativa (indica cultivar-group) cDNA clone:...	48	0.080
70	ref|NM_001073594.1| Oryza sativa (japonica cultivar-group) Os12g...	48	0.080
71	emb|AM286690.1| Alcanivorax borkumensis SK2, complete genome	48	0.080
72	gb|AC189627.1| Brassica rapa subsp. pekinensis clone KBrS001M03,...	48	0.080
73	gb|AC189569.1| Brassica rapa subsp. pekinensis clone KBrH009I12,...	48	0.080
74	ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural consti...	48	0.080
75	gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal ...	48	0.080
76	gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal ...	48	0.080
77	gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At...	48	0.080
78	gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g...	48	0.080
79	gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma...	48	0.080
80	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	48	0.080
81	gb|AF387178.1|AF387178 Cornus foemina ribosomal protein L2 (rpl2...	48	0.080
82	dbj|AP003933.4| Oryza sativa (japonica cultivar-group) genomic D...	48	0.080
83	emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2	48	0.080
84	dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.080
85	emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Co...	48	0.080
86	emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Co...	48	0.080
87	emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Co...	48	0.080
88	emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Co...	48	0.080
89	emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Co...	48	0.080
90	dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clon...	48	0.080
91	gb|AY108123.1| Zea mays PCO067267 mRNA sequence	48	0.080
92	emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa...	48	0.080
93	emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1	48	0.080
94	gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At...	48	0.080
95	gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete ge...	46	0.31
96	ref|XM_001229815.1| Chaetomium globosum CBS 148.51 hypothetical ...	46	0.31
97	ref|XM_505841.1| Yarrowia lipolytica CLIB122, YALI0F24739g predi...	46	0.31
98	gb|AY083306.1| Mycoplasma hominis 50S ribosomal protein L3 (rplC...	46	0.31
99	gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein...	46	0.31
100	emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1...	46	0.31
101	gb|AY832249.1| Ginkgo biloba ribosomal protein L2 (rpl2) gene, p...	46	0.31
102	gb|CP000482.1| Pelobacter propionicus DSM 2379, complete genome	44	1.2
103	gb|AY465723.1| Xyris jupicai ribosomal protein L2 (rpl2) gene, p...	44	1.2
104	gb|AY465720.1| Flagellaria indica ribosomal protein L2 (rpl2) ge...	44	1.2
105	gb|AY465719.1| Elegia fenestrata ribosomal protein L2 (rpl2) gen...	44	1.2
106	ref|XM_001178161.1| PREDICTED: Strongylocentrotus purpuratus sim...	44	1.2
107	ref|XM_790908.2| PREDICTED: Strongylocentrotus purpuratus simila...	44	1.2
108	gb|CP000453.1| Alkalilimnicola ehrlichei MLHE-1, complete genome	44	1.2
109	gb|AY699151.1| Lepidozamia hopei ribosomal protein L2 (rpl2) gen...	44	1.2
110	gb|CP000362.1| Roseobacter denitrificans OCh 114, complete genome	44	1.2
111	gb|CP000377.1| Silicibacter sp. TM1040, complete genome	44	1.2
112	gb|AY147698.1| Mayaca fluviatilis ribosomal protein L2 (rpl2) ge...	44	1.2
113	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	44	1.2
114	dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisu...	44	1.2
115	dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g...	44	1.2
116	gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal pro...	44	1.2
117	gb|DQ206555.1| Leucosolenia sp. AR-2003 isolate TOA23 ribosomal ...	44	1.2
118	gb|AE017221.1| Thermus thermophilus HB27, complete genome	44	1.2
119	gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene e...	44	1.2
120	gb|EF044213.1| Coffea arabica chloroplast, complete genome	42	4.9
121	emb|CR790361.11| Zebrafish DNA sequence from clone DKEY-29N19, c...	42	4.9
122	gb|CP000431.1| Rhodococcus sp. RHA1, complete genome	42	4.9
123	gb|CP000113.1| Myxococcus xanthus DK 1622, complete genome	42	4.9
124	gb|AY147721.1| Allium textile ribosomal protein L2 (rpl2) gene, ...	42	4.9
125	gb|AY596744.1| Lepistemon owariensis ribosomal protein L2 (rpl2)...	42	4.9
126	gb|DQ069411.1| Nuphar advena ribosomal protein L2 (rpl2) gene, p...	42	4.9
127	gb|AF033858.2| Pediococcus pentosaceus strain ATCC43200 plasmid ...	42	4.9
128	gb|AC127298.4| Mus musculus BAC clone RP23-264F2 from 3, complet...	42	4.9
129	gb|AY007489.1| Austrobaileya scandens ribosomal protein L2 (rpl2...	42	4.9
130	gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ...	42	4.9
131	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	42	4.9
132	gb|AF426458.1| Primary endosymbiont of Sitophilus zeamais riboso...	42	4.9
133	gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome	42	4.9
134	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	42	4.9
135	ref|XM_757274.1| Ustilago maydis 521 hypothetical protein (UM062...	42	4.9
136	emb|BX649221.3| Chicken DNA sequence from clone WAG-43K7, comple...	42	4.9
137	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	42	4.9
138	emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on ...	42	4.9
139	emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete ...	42	4.9
140	gb|AF188855.1|AF188855 Nymphaea odorata ribosomal protein L2 (rp...	42	4.9
141	emb|AL096859.2|ATT6H20 Arabidopsis thaliana DNA chromosome 3, BA...	42	4.9
142	emb|AJ627251.1| Nymphaea alba chloroplast, complete genome	42	4.9
143	gb|AF123787.1|AF123787 Cabomba caroliniana ribosomal protein L2 ...	42	4.9
144	gb|AC007250.2| Homo sapiens BAC clone RP11-334G22 from 2, comple...	42	4.9
145	dbj|AP004070.3| Oryza sativa (japonica cultivar-group) genomic D...	42	4.9
146	dbj|AP000423.1| Arabidopsis thaliana chloroplast genomic DNA, co...	42	4.9
147	gb|AY007498.1| Schisandra chinensis ribosomal protein L2 (rpl2) ...	42	4.9
148	gb|AY007491.1| Gunnera chilensis ribosomal protein L2 (rpl2) gen...	42	4.9
149	gb|AY007488.1| Arabidopsis thaliana ribosomal protein L2 (rpl2) ...	42	4.9
150	emb|BX322622.10| Zebrafish DNA sequence from clone DKEYP-14D3 in...	42	4.9
151	emb|BX088532.7| Zebrafish DNA sequence from clone CH211-127E17 i...	42	4.9
152	gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c...	42	4.9
153	gb|AY105270.1| Zea mays PCO089214 mRNA sequence	42	4.9
154	gb|AF069302.1|AF069302 Pediococcus pentosaceus plasmid pMD136, c...	42	4.9
155	emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1	42	4.9
156	emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1	42	4.9
157	emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1	42	4.9
158	emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1	42	4.9
159	emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1	42	4.9
160	emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1	42	4.9
161	emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1	42	4.9
162	emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1	42	4.9
163	emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1	42	4.9
164	emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1	42	4.9
165	emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1	42	4.9
166	emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1	42	4.9
167	emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1	42	4.9
168	emb|AJ343462.1|HSA343462 Homo sapiens genomic sequence surroundi...	42	4.9

---

>gb|DQ057344.1| Triticum aestivum mitochondrial L2 ribosomal protein mRNA, complete
            cds; nuclear gene for mitochondrial product
          Length = 960
 Score = 1417 bits (715), Expect = 0.0
 Identities = 894/953 (93%), Gaps = 3/953 (0%)
 Strand = Plus / Plus

                                                                        
Query: 131  atgcagaagttcaagaccctggccaaggccttgaccggcaagaccgtcaccgctgggagg 190
            |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||
Sbjct: 1    atgcagaagttcaagaccttggccaaggccttgaccggcaagaccgtcaccgccgggagg 60

                                                                        
Query: 191  aactcttccgggcgaatcacttcttttcaccgagggggtggatccaagcgctcgcttagg 250
            |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 61   aactcttctgggcgaatcacttcttttcaccgagggggtggatccaagcgatcgcttagg 120

                                                                        
Query: 251  gacattgaccttaaaaggaacaactgttcagttggcattgtggaaaggattgaatatgac 310
            ||||||||||| ||||||||||  || || ||||||||||||||||||||||| ||||||
Sbjct: 121  gacattgacctcaaaaggaacacttgctcggttggcattgtggaaaggattgagtatgac 180

                                                                        
Query: 311  cctaatcgttcttctcggatcgcacttctccgatggatcgaaggggtacctcagaaggat 370
            ||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 181  cctaaccgttcttctcggatcgctcttctccgatggatcgaaggggtaccacagaaggat 240

                                                                        
Query: 371  gcagcatacaaggccgagcgtgcacctgtcaactacataatagccagccatcaaatggaa 430
             ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 241  ccagcatacaaggccgagcgtgcacctgtcaattacataatagccagccatcaaatggaa 300

                                                                        
Query: 431  ccgggcagcatggtggtgaacagcgactcctccaaaccttccacgaccggctccttgatg 490
            |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 301  ccgggcagcatggtggtgaacagcgactcctccaaaccctccacgaccggctccttgatg 360

                                                                        
Query: 491  cgacctgcacacaatgccgattccttccttcggttccaagagcttttccgcaaggccagc 550
            || ||||| ||||||||| ||||| ||||||||||||||||||| |||||||| ||||||
Sbjct: 361  cggcctgcccacaatgccaattccatccttcggttccaagagctgttccgcaaagccagc 420

                                                                        
Query: 551  caag---gcgaagagggcactgatgaccaagcaaaggatgctgcggtcaccacagcagca 607
            ||||   ||||||||||||||||||| |||||||||||||| |||||  |  ||||||||
Sbjct: 421  caagaaggcgaagagggcactgatgatcaagcaaaggatgcggcggttcctgcagcagca 480

                                                                        
Query: 608  ccgctcatgcctgccgatctgctggacctcaactccaaggtgggaaactgcatgccactg 667
            ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||  ||
Sbjct: 481  ccgctcatgccagccgatctactggacctcaattccaaggtgggaaactgcatgccgttg 540

                                                                        
Query: 668  tccgacatccgcatgggaacgtgggtgcacagcatcgagctgcgtcacggccagggcgcg 727
            |||||||||||||||||||| ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 541  tccgacatccgcatgggaacatgggtgcacagcatcgaactgcgtcatggccagggggcg 600

                                                                        
Query: 728  aagctcgtccgggccgctggagcgtacgccaaggtggtcaaggagtcggcgacgcagtgc 787
            ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 601  aagctcgtccgggccgctggagcctacgccaaggtggtcaaggagtcggccacgcagtgc 660

                                                                        
Query: 788  cttgtgcggctgccgtcgggcgtcgagaagctgatagactcgcggtgccgggccaccatc 847
            ||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 661  cttgtgcggctgccgtcgggcgtcgagaagctgatcgactcccggtgccgagccaccatc 720

                                                                        
Query: 848  ggcatcgtctccaacccgacccacggtgcgcggaagctgaggaaggcagggcacagccgg 907
            ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 721  ggcatcgtctccaaccccacccatggtgcacggaagctgaggaaggcggggcacagccgg 780

                                                                        
Query: 908  tggctgggcaggcggccggtcgtccgtggtgtggcgatgaacccggtggaccatccccat 967
            |||||||||||||| ||||| ||||||||||| ||||||||||||||||| |||||||||
Sbjct: 781  tggctgggcaggcgcccggttgtccgtggtgtcgcgatgaacccggtggatcatccccat 840

                                                                        
Query: 968  ggaggaggcgaggggcgcaccaagggcggcaggccgtcggtgtcgccctgggggaagccc 1027
            |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 841  ggaggaggcgaggggcgcaccaagggtggcaggccctcggtgtcgccctgggggaagccc 900

                                                                 
Query: 1028 accaaggcagggtatcggaccgtgccgaagaagccgaaggcccagctgtcccg 1080
            |||||||| ||||||||||||||||| |||||||| ||||| |||||||||||
Sbjct: 901  accaaggctgggtatcggaccgtgcccaagaagccaaaggctcagctgtcccg 953

---

>gb|DQ057345.1| Triticum aestivum mitochondrial L2 ribosomal protein mRNA, complete
            cds; nuclear gene for mitochondrial product
          Length = 957

 Score = 1415 bits (714), Expect = 0.0
 Identities = 891/950 (93%)
 Strand = Plus / Plus

                                                                        
Query: 131  atgcagaagttcaagaccctggccaaggccttgaccggcaagaccgtcaccgctgggagg 190
            |||||||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||
Sbjct: 1    atgcagaagttcaagaccttggccaaagccttgaccggcaagaccgtcaccgccgggagg 60

                                                                        
Query: 191  aactcttccgggcgaatcacttcttttcaccgagggggtggatccaagcgctcgcttagg 250
            |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 61   aactcttccgggcggatcacttcttttcaccgagggggtggatccaagcgatcgcttagg 120

                                                                        
Query: 251  gacattgaccttaaaaggaacaactgttcagttggcattgtggaaaggattgaatatgac 310
            ||||||||||| ||||||||||  ||||| |||||| |||||||||||||||| || |||
Sbjct: 121  gacattgacctcaaaaggaacacttgttctgttggcgttgtggaaaggattgagtacgac 180

                                                                        
Query: 311  cctaatcgttcttctcggatcgcacttctccgatggatcgaaggggtacctcagaaggat 370
            ||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||||||
Sbjct: 181  cctaatcgttcttctcggatcgctcttctccgatggattgaaggggtgcctcagaaggat 240

                                                                        
Query: 371  gcagcatacaaggccgagcgtgcacctgtcaactacataatagccagccatcaaatggaa 430
             ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||
Sbjct: 241  ccagcatacaaggccgagcgtgcacctgtcaattacataatagccagccatcagatggaa 300

                                                                        
Query: 431  ccgggcagcatggtggtgaacagcgactcctccaaaccttccacgaccggctccttgatg 490
            |||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||
Sbjct: 301  ccgggcagcatggtggtgaatagcgattcctccaaaccctccacgaccggctccttgatg 360

                                                                        
Query: 491  cgacctgcacacaatgccgattccttccttcggttccaagagcttttccgcaaggccagc 550
            |||||||| |||||||| ||||||||||| |||||||||||||| |||||||||||||||
Sbjct: 361  cgacctgcccacaatgctgattccttcctgcggttccaagagctgttccgcaaggccagc 420

                                                                        
Query: 551  caaggcgaagagggcactgatgaccaagcaaaggatgctgcggtcaccacagcagcaccg 610
            ||||||||||||||||||||||| ||||  |||||||| |||||  | ||||||||||||
Sbjct: 421  caaggcgaagagggcactgatgatcaagtgaaggatgcggcggttcctacagcagcaccg 480

                                                                        
Query: 611  ctcatgcctgccgatctgctggacctcaactccaaggtgggaaactgcatgccactgtcc 670
            |||||||| |||||||| ||||||||||| |||||||||||||||||||||||  |||| 
Sbjct: 481  ctcatgccagccgatctactggacctcaattccaaggtgggaaactgcatgccgttgtct 540

                                                                        
Query: 671  gacatccgcatgggaacgtgggtgcacagcatcgagctgcgtcacggccagggcgcgaag 730
            |||||||| |||||||| ||||||||||||||||| ||||||||||||||||| ||||||
Sbjct: 541  gacatccgtatgggaacatgggtgcacagcatcgaactgcgtcacggccagggggcgaag 600

                                                                        
Query: 731  ctcgtccgggccgctggagcgtacgccaaggtggtcaaggagtcggcgacgcagtgcctt 790
            |||||||| ||||||||||| ||||||||||||||||||||||| || ||||||||||||
Sbjct: 601  ctcgtccgagccgctggagcctacgccaaggtggtcaaggagtcagccacgcagtgcctt 660

                                                                        
Query: 791  gtgcggctgccgtcgggcgtcgagaagctgatagactcgcggtgccgggccaccatcggc 850
            ||||| |||||||||||||||||||||||||||||||| || ||||||||||||||||||
Sbjct: 661  gtgcgtctgccgtcgggcgtcgagaagctgatagactcccgctgccgggccaccatcggc 720

                                                                        
Query: 851  atcgtctccaacccgacccacggtgcgcggaagctgaggaaggcagggcacagccggtgg 910
            |||||||||||||| ||||| || |||||||||||||||||||| |||||||||||||||
Sbjct: 721  atcgtctccaaccccacccatggcgcgcggaagctgaggaaggcggggcacagccggtgg 780

                                                                        
Query: 911  ctgggcaggcggccggtcgtccgtggtgtggcgatgaacccggtggaccatccccatgga 970
            ||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 781  ctgggcaggcgcccggtcgtccgtggtgtcgcgatgaacccggtggaccatccccatgga 840

                                                                        
Query: 971  ggaggcgaggggcgcaccaagggcggcaggccgtcggtgtcgccctgggggaagcccacc 1030
            |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
Sbjct: 841  ggaggcgaggggcgcaccaagggcggcaggccctcggtgtcgccctgggggaagcccacc 900

                                                              
Query: 1031 aaggcagggtatcggaccgtgccgaagaagccgaaggcccagctgtcccg 1080
            ||||| |||||||||||||||||||||||||| ||||| |||||||||||
Sbjct: 901  aaggctgggtatcggaccgtgccgaagaagccaaaggctcagctgtcccg 950

---

>gb|AY044158.1| Zea mays ribosomal protein L2 mRNA, complete cds; nuclear gene for
            mitochondrial product
          Length = 1347

 Score =  127 bits (64), Expect = 1e-25
 Identities = 157/188 (83%)
 Strand = Plus / Plus

                                                                        
Query: 854  gtctccaacccgacccacggtgcgcggaagctgaggaaggcagggcacagccggtggctg 913
            ||||||||||| | ||| ||| | || ||||| || ||||||||||||||| ||||| | 
Sbjct: 1093 gtctccaacccaagccatggtacacgcaagctaagaaaggcagggcacagcaggtggtta 1152

                                                                        
Query: 914  ggcaggcggccggtcgtccgtggtgtggcgatgaacccggtggaccatccccatggagga 973
            ||||| || || || ||||||||||| || ||||| || ||||| ||||||||||| |||
Sbjct: 1153 ggcagacgccctgttgtccgtggtgttgctatgaatcctgtggatcatccccatggtgga 1212

                                                                        
Query: 974  ggcgaggggcgcaccaagggcggcaggccgtcggtgtcgccctgggggaagcccaccaag 1033
            ||||||||||| || || || |||||||| || || || |||||||| ||||||||||| 
Sbjct: 1213 ggcgaggggcgtactaaaggaggcaggccttcagtttctccctggggaaagcccaccaaa 1272

                    
Query: 1034 gcagggta 1041
            ||||||||
Sbjct: 1273 gcagggta 1280



 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 182 gctgggaggaactcttccgggcgaatcacttcttttcaccg 222
           |||||||||||||| || ||||| ||||| ||||| |||||
Sbjct: 88  gctgggaggaactcgtctgggcgcatcacctctttccaccg 128

---

>gb|AY108838.1| Zea mays PCO101143 mRNA sequence
          Length = 985

 Score =  127 bits (64), Expect = 1e-25
 Identities = 157/188 (83%)
 Strand = Plus / Plus

                                                                        
Query: 854  gtctccaacccgacccacggtgcgcggaagctgaggaaggcagggcacagccggtggctg 913
            ||||||||||| | ||| ||| | || ||||| || ||||||||||||||| ||||| | 
Sbjct: 354  gtctccaacccaagccatggtacacgcaagctaagaaaggcagggcacagcaggtggtta 413

                                                                        
Query: 914  ggcaggcggccggtcgtccgtggtgtggcgatgaacccggtggaccatccccatggagga 973
            ||||| || || || ||||||||||| || ||||| || ||||| ||||||||||| |||
Sbjct: 414  ggcagacgccctgttgtccgtggtgttgctatgaatcctgtggatcatccccatggtgga 473

                                                                        
Query: 974  ggcgaggggcgcaccaagggcggcaggccgtcggtgtcgccctgggggaagcccaccaag 1033
            ||||||||||| || || || |||||||| || || || |||||||| ||||||||||| 
Sbjct: 474  ggcgaggggcgtactaaaggaggcaggccttcagtttctccctggggaaagcccaccaaa 533

                    
Query: 1034 gcagggta 1041
            ||||||||
Sbjct: 534  gcagggta 541

---

>dbj|BA000029.3| Oryza sativa (japonica cultivar-group) mitochondrial DNA, complete genome
          Length = 490520

 Score =  111 bits (56), Expect = 6e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 282    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 341
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 294852 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 294911

                              
Query: 342    gatggatcgaaggggt 357
              ||||||||||||||||
Sbjct: 294912 gatggatcgaaggggt 294927



 Score = 85.7 bits (43), Expect = 4e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                          
Query: 932    cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
              |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 297535 cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 297594

                                                             
Query: 992    ggcggcaggccgtcggtgtcgccctgggggaagcccaccaaggcagg 1038
              || || || || |||||||| || ||||||||||||||||| |||||
Sbjct: 297595 ggaggtagaccttcggtgtcaccttgggggaagcccaccaaagcagg 297641



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 180    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 239
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 294750 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 294809

               
Query: 240    g 240
              |
Sbjct: 294810 g 294810

---

>gb|DQ167400.1| Oryza sativa (japonica cultivar-group) cultivar Nipponbare mitochondrion,
              complete genome
          Length = 490669

 Score =  111 bits (56), Expect = 6e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 282    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 341
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 295000 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 295059

                              
Query: 342    gatggatcgaaggggt 357
              ||||||||||||||||
Sbjct: 295060 gatggatcgaaggggt 295075



 Score = 85.7 bits (43), Expect = 4e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                          
Query: 932    cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
              |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 297683 cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 297742

                                                             
Query: 992    ggcggcaggccgtcggtgtcgccctgggggaagcccaccaaggcagg 1038
              || || || || |||||||| || ||||||||||||||||| |||||
Sbjct: 297743 ggaggtagaccttcggtgtcaccttgggggaagcccaccaaagcagg 297789



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 180    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 239
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 294898 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 294957

               
Query: 240    g 240
              |
Sbjct: 294958 g 294958

---

>gb|DQ167807.1| Oryza sativa (japonica cultivar-group) isolate PA64S mitochondrion,
              complete genome
          Length = 490673

 Score =  111 bits (56), Expect = 6e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 282    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 341
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 295003 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 295062

                              
Query: 342    gatggatcgaaggggt 357
              ||||||||||||||||
Sbjct: 295063 gatggatcgaaggggt 295078



 Score = 85.7 bits (43), Expect = 4e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                          
Query: 932    cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
              |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 297686 cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 297745

                                                             
Query: 992    ggcggcaggccgtcggtgtcgccctgggggaagcccaccaaggcagg 1038
              || || || || |||||||| || ||||||||||||||||| |||||
Sbjct: 297746 ggaggtagaccttcggtgtcaccttgggggaagcccaccaaagcagg 297792



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 180    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 239
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 294901 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 294960

               
Query: 240    g 240
              |
Sbjct: 294961 g 294961

---

>gb|DQ167399.1| Oryza sativa (indica cultivar-group) isolate 93-11 mitochondrion,
              complete genome
          Length = 491515

 Score =  111 bits (56), Expect = 6e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                          
Query: 282    ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 341
              ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 295813 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 295872

                              
Query: 342    gatggatcgaaggggt 357
              ||||||||||||||||
Sbjct: 295873 gatggatcgaaggggt 295888



 Score = 85.7 bits (43), Expect = 4e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                          
Query: 932    cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
              |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 298496 cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 298555

                                                             
Query: 992    ggcggcaggccgtcggtgtcgccctgggggaagcccaccaaggcagg 1038
              || || || || |||||||| || ||||||||||||||||| |||||
Sbjct: 298556 ggaggtagaccttcggtgtcaccttgggggaagcccaccaaagcagg 298602



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                          
Query: 180    ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 239
              |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 295711 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 295770

               
Query: 240    g 240
              |
Sbjct: 295771 g 295771

---

>dbj|D13109.1|RICMT13 Oryza sativa (japonica cultivar-group) mitochondrial gene for rpoB
           protein, partial cds
          Length = 1639

 Score =  111 bits (56), Expect = 6e-21
 Identities = 71/76 (93%)
 Strand = Plus / Minus

                                                                       
Query: 282 ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 341
           ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 565 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 506

                           
Query: 342 gatggatcgaaggggt 357
           ||||||||||||||||
Sbjct: 505 gatggatcgaaggggt 490



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 180 ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 239
           |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 666 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 607

            
Query: 240 g 240
           |
Sbjct: 606 g 606

---

>dbj|D78336.1| Oryza sativa (japonica cultivar-group) mitochondrial DNA for
            ribosomal protein L2, ribosomal protein S19, complete cds
          Length = 4565

 Score =  111 bits (56), Expect = 6e-21
 Identities = 71/76 (93%)
 Strand = Plus / Plus

                                                                        
Query: 282  ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 341
            ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||  | |
Sbjct: 1279 ttggcattgtggaaaggatcgaatatgaccctaatcgttcttctcggatcgctctagtac 1338

                            
Query: 342  gatggatcgaaggggt 357
            ||||||||||||||||
Sbjct: 1339 gatggatcgaaggggt 1354



 Score = 85.7 bits (43), Expect = 4e-13
 Identities = 91/107 (85%)
 Strand = Plus / Plus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 3962 cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 4021

                                                           
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaaggcagg 1038
            || || || || |||||||| || ||||||||||||||||| |||||
Sbjct: 4022 ggaggtagaccttcggtgtcaccttgggggaagcccaccaaagcagg 4068



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 54/61 (88%)
 Strand = Plus / Plus

                                                                        
Query: 180  ccgctgggaggaactcttccgggcgaatcacttcttttcaccgagggggtggatccaagc 239
            |||| |||||||| ||||||||||| || |||  ||||||||||||||||||||| ||||
Sbjct: 1177 ccgcagggaggaattcttccgggcgtattactgtttttcaccgagggggtggatcgaagc 1236

             
Query: 240  g 240
            |
Sbjct: 1237 g 1237

---

>gb|AY832244.1| Eichhornia crassipes ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 696

 Score = 87.7 bits (44), Expect = 9e-14
 Identities = 68/76 (89%)
 Strand = Plus / Plus

                                                                       
Query: 282 ttggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctcc 341
           |||||||||| |||||||| ||||||||||| |||||||||||||||||||| ||  | |
Sbjct: 91  ttggcattgtagaaaggatcgaatatgacccaaatcgttcttctcggatcgctctagtac 150

                           
Query: 342 gatggatcgaaggggt 357
           |||||||||| |||||
Sbjct: 151 gatggatcgagggggt 166



 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 197 tccgggcgaatcacttcttttcaccgagggggtggatccaagcg 240
           |||||||| || |||  ||||||||||||||||||||| |||||
Sbjct: 6   tccgggcgtattactgtttttcaccgagggggtggatcgaagcg 49

---

>gb|AF387188.1|AF387188 Ulmus thomasii ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 741

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 90  ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 139



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 214 ttttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||||| |||||
Sbjct: 20  ttttcaccgagggggtggatcgaagcg 46

---

>gb|AF387187.1|AF387187 Gossypium arboreum ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 812

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 121 ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 170

---

>emb|X80170.1|OBRP12 O.berteriana rpl2 gene
          Length = 3550

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                              
Query: 284  ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
            |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 1084 ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 1133



 Score = 42.1 bits (21), Expect = 4.9
 Identities = 54/65 (83%)
 Strand = Plus / Plus

                                                                        
Query: 407  ataatagccagccatcaaatggaaccgggcagcatggtggtgaacagcgactcctccaaa 466
            ||||||||||| |||||| ||||| ||||||  |||||| ||||  |||| |  ||||||
Sbjct: 3237 ataatagccagtcatcaattggaagcgggcaagatggtgatgaattgcgattggtccaaa 3296

                 
Query: 467  ccttc 471
            |||||
Sbjct: 3297 ccttc 3301

---

>gb|AY832246.1| Platanus occidentalis ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial
          Length = 655

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 81  ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 130



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 214 ttttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||||| |||||
Sbjct: 11  ttttcaccgagggggtggatcgaagcg 37

---

>gb|AY832245.1| Mahonia bealei ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 648

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 48/50 (96%)
 Strand = Plus / Plus

                                                             
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
           |||||||| |||||||| ||||||||||||||||||||||||||||||||
Sbjct: 70  ggcattgtagaaaggatagaatatgaccctaatcgttcttctcggatcgc 119

---

>gb|AY832243.1| Amborella trichopoda ribosomal protein L2 (rpl2) pseudogene,
           partial sequence; mitochondrial
          Length = 959

 Score = 83.8 bits (42), Expect = 1e-12
 Identities = 66/74 (89%)
 Strand = Plus / Plus

                                                                       
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 343
           |||||||| |||||||| ||||||||||| |||||||||||||||||||| ||  | |||
Sbjct: 93  ggcattgtagaaaggatcgaatatgacccaaatcgttcttctcggatcgctctagtacga 152

                         
Query: 344 tggatcgaaggggt 357
           |||||||| |||||
Sbjct: 153 tggatcgagggggt 166



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 214 ttttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||||| |||||
Sbjct: 23  ttttcaccgagggggtggatcgaagcg 49

---

>gb|AF387182.1|AF387182 Viburnum sp. Qiu95083 ribosomal protein L2 (rpl2) mitochondrial
            pseudogene, partial sequence
          Length = 608

 Score = 81.8 bits (41), Expect = 6e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 498  cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 557

                                                     
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaa 1032
            || || || || |||||||| || |||||||||||||||||
Sbjct: 558  ggaggtagaccttcggtgtcaccttgggggaagcccaccaa 598

---

>gb|AF387175.1|AF387175 Platanus occidentalis ribosomal protein L2 (rpl2) gene, partial cds;
            mitochondrial gene for mitochondrial product
          Length = 538

 Score = 81.8 bits (41), Expect = 6e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 436  cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 495

                                                     
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaa 1032
            || || || || |||||||| || |||||||||||||||||
Sbjct: 496  ggaggtagaccttcggtgtcaccttgggggaagcccaccaa 536

---

>gb|AF387174.1|AF387174 Dicentra sp. Qiu 95026 ribosomal protein L2 (rpl2) gene, partial cds;
            mitochondrial gene for mitochondrial product
          Length = 559

 Score = 81.8 bits (41), Expect = 6e-12
 Identities = 86/101 (85%)
 Strand = Plus / Plus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 443  cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 502

                                                     
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaa 1032
            || || || || |||||||| || |||||||||||||||||
Sbjct: 503  ggaggtagaccttcggtgtcaccttgggggaagcccaccaa 543

---

>gb|AF387183.1|AF387183 Lonicera sp. Palmer 679 ribosomal protein L2 (rpl2) mitochondrial
            pseudogene, partial sequence
          Length = 600

 Score = 77.8 bits (39), Expect = 9e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || ||||| || ||| | ||||| ||||||||||| ||||||||||| || 
Sbjct: 117  cgtggtgttgcaatgaatccagtgaatcatcctcatggaggaggtgaggggcgcacgaaa 58

                                                           
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaaggcagg 1038
            || || || || |||||||| || ||||||||||||||||| |||||
Sbjct: 57   ggaggtagaccttcggtgtcaccttgggggaagcccaccaaagcagg 11

---

>gb|AY832242.1| Liriodendron tulipifera ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial
          Length = 685

 Score = 77.8 bits (39), Expect = 9e-11
 Identities = 45/47 (95%)
 Strand = Plus / Plus

                                                          
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggat 330
           |||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 93  ggcattgtagaaaggatcgaatatgaccctaatcgttcttctcggat 139



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 214 ttttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||||| |||||
Sbjct: 23  ttttcaccgagggggtggatcgaagcg 49

---

>gb|AY832248.1| Zamia integrifolia ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 565

 Score = 75.8 bits (38), Expect = 4e-10
 Identities = 65/74 (87%)
 Strand = Plus / Plus

                                                                       
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 343
           |||||||| |||||||| ||||||||||| |||||||| |||||||| || ||  | |||
Sbjct: 55  ggcattgtagaaaggatcgaatatgacccaaatcgttcctctcggattgctctagtacga 114

                         
Query: 344 tggatcgaaggggt 357
           ||||||||||||||
Sbjct: 115 tggatcgaaggggt 128

---

>gb|AF387180.1|AF387180 Diospyros virginiana ribosomal protein L2 (rpl2) mitochondrial
            pseudogene, partial sequence
          Length = 584

 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 85/101 (84%)
 Strand = Plus / Plus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 464  cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 523

                                                     
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaa 1032
            || || || || |||||||| || ||||| |||||||||||
Sbjct: 524  ggaggtagaccttcggtgtcaccttggggaaagcccaccaa 564

---

>gb|AF387184.1|AF387184 Abutilon theophrasti ribosomal protein L2 (rpl2) mitochondrial
            pseudogene, partial sequence
          Length = 457

 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 89/107 (83%)
 Strand = Plus / Plus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || || || || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 350  cgtggtgttgcaatcaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 409

                                                           
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaaggcagg 1038
            || || || || |||||||| || || |||||||||||||| |||||
Sbjct: 410  ggaggtagaccttcggtgtcaccttgagggaagcccaccaaagcagg 456

---

>gb|AY832247.1| Pinus thunbergii ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 548

 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                          
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggat 330
           ||||||||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 93  ggcattgtggaaaggatcgaatatgacccaaatcgttcctctcggat 139



 Score = 42.1 bits (21), Expect = 4.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 216 ttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||| |||||
Sbjct: 25  ttcaccgagggggtggatcgaagcg 49

---

>gb|AF387185.1|AF387185 Quercus alba ribosomal protein L2 (rpl2) mitochondrial pseudogene,
            partial sequence
          Length = 541

 Score = 67.9 bits (34), Expect = 9e-08
 Identities = 85/102 (83%)
 Strand = Plus / Plus

                                                                        
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaag 991
            |||||||| || ||||| || ||||| ||||| ||||||||||| ||||||||||| || 
Sbjct: 438  cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaa 497

                                                      
Query: 992  ggcggcaggccgtcggtgtcgccctgggggaagcccaccaag 1033
            || || || || ||||| || || || |||||||||||||||
Sbjct: 498  ggaggtagaccttcggtttcaccttgagggaagcccaccaag 539

---

>dbj|BA000042.1| Nicotiana tabacum mitochondrial DNA, complete genome
          Length = 430597

 Score = 67.9 bits (34), Expect = 9e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                
Query: 284    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
              |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 132523 ggcattgtagaaaggatagaatatgagcctaatcgttcttctcgaatcgc 132474



 Score = 67.9 bits (34), Expect = 9e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                                
Query: 284    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
              |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 363795 ggcattgtagaaaggatagaatatgagcctaatcgttcttctcgaatcgc 363746



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 214    ttttcaccgagggggtggatccaagcg 240
              ||||||||||||||||||||| |||||
Sbjct: 132593 ttttcaccgagggggtggatcgaagcg 132567



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 214    ttttcaccgagggggtggatccaagcg 240
              ||||||||||||||||||||| |||||
Sbjct: 363865 ttttcaccgagggggtggatcgaagcg 363839

---

>emb|X66519.1|MTNSUA N.sylvestris mitochondrion DNA
          Length = 404

 Score = 67.9 bits (34), Expect = 9e-08
 Identities = 46/50 (92%)
 Strand = Plus / Plus

                                                             
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
           |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 254 ggcattgtagaaaggatagaatatgagcctaatcgttcttctcgaatcgc 303



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 214 ttttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||||| |||||
Sbjct: 184 ttttcaccgagggggtggatcgaagcg 210

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 72/85 (84%)
 Strand = Plus / Plus

                                                                           
Query: 953     gtggaccatccccatggaggaggcgaggggcgcaccaagggcggcaggccgtcggtgtcg 1012
               ||||| ||||| ||||||||||| |||||| |||| || || || || || |||||||| 
Sbjct: 3075940 gtggatcatcctcatggaggaggtgaggggtgcacgaaaggaggtagaccttcggtgtca 3075999

                                        
Query: 1013    ccctgggggaagcccaccaaggcag 1037
               || ||||||||||||||||| ||||
Sbjct: 3076000 ccttgggggaagcccaccaaagcag 3076024



 Score = 48.1 bits (24), Expect = 0.080
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 302      gaatatgaccctaatcgttcttctcggatcgc 333
                ||||||||||||||| |||||||||| |||||
Sbjct: 20734192 gaatatgaccctaattgttcttctcgaatcgc 20734223

---

>gb|AF387179.1|AF387179 Hydrangea arborescens ribosomal protein L2 (rpl2) mitochondrial
            pseudogene, partial sequence
          Length = 591

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 69/81 (85%)
 Strand = Plus / Plus

                                                                        
Query: 953  gtggaccatccccatggaggaggcgaggggcgcaccaagggcggcaggccgtcggtgtcg 1012
            ||||| ||||| ||||||||||| ||||||||||| || || || || || |||||||| 
Sbjct: 510  gtggatcatcctcatggaggaggggaggggcgcacgaaaggaggtagaccttcggtgtca 569

                                 
Query: 1013 ccctgggggaagcccaccaag 1033
             | ||||||||||||||||||
Sbjct: 570  gcttgggggaagcccaccaag 590

---

>dbj|AP002521.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0041E11
          Length = 146335

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 72/85 (84%)
 Strand = Plus / Plus

                                                                         
Query: 953   gtggaccatccccatggaggaggcgaggggcgcaccaagggcggcaggccgtcggtgtcg 1012
             ||||| ||||| ||||||||||| |||||| |||| || || || || || |||||||| 
Sbjct: 19728 gtggatcatcctcatggaggaggtgaggggtgcacgaaaggaggtagaccttcggtgtca 19787

                                      
Query: 1013  ccctgggggaagcccaccaaggcag 1037
             || ||||||||||||||||| ||||
Sbjct: 19788 ccttgggggaagcccaccaaagcag 19812

---

>dbj|AP002539.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0433F09
          Length = 150150

 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 72/85 (84%)
 Strand = Plus / Plus

                                                                         
Query: 953   gtggaccatccccatggaggaggcgaggggcgcaccaagggcggcaggccgtcggtgtcg 1012
             ||||| ||||| ||||||||||| |||||| |||| || || || || || |||||||| 
Sbjct: 43980 gtggatcatcctcatggaggaggtgaggggtgcacgaaaggaggtagaccttcggtgtca 44039

                                      
Query: 1013  ccctgggggaagcccaccaaggcag 1037
             || ||||||||||||||||| ||||
Sbjct: 44040 ccttgggggaagcccaccaaagcag 44064

---

>dbj|AP008982.1| Triticum aestivum mitochondrial DNA, complete genome
          Length = 452528

 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 79/95 (83%)
 Strand = Plus / Minus

                                                                          
Query: 944    atgaacccggtggaccatccccatggaggaggcgaggggcgcaccaagggcggcaggccg 1003
              ||||| || ||||| ||||| ||||||||||| ||||||||||| || || || || || 
Sbjct: 283578 atgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaaggaggtagacct 283519

                                                 
Query: 1004   tcggtgtcgccctgggggaagcccaccaaggcagg 1038
              |||||||| || ||||| |||| |||||| |||||
Sbjct: 283518 tcggtgtcaccttggggaaagctcaccaaagcagg 283484

---

>gb|AY109618.1| Zea mays CL8996_1 mRNA sequence
          Length = 1322

 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                          
Query: 929 gtccgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           |||||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 670 gtccgtggtgtggccatgaaccccgtggagcatccccacggaggagg 716

---

>emb|AJ295995.1|TAE295995 Triticum aestivum mitochondrial partial rpl2 pseudogene
          Length = 659

 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 79/95 (83%)
 Strand = Plus / Plus

                                                                        
Query: 944  atgaacccggtggaccatccccatggaggaggcgaggggcgcaccaagggcggcaggccg 1003
            ||||| || ||||| ||||| ||||||||||| ||||||||||| || || || || || 
Sbjct: 173  atgaatccagtggatcatcctcatggaggaggtgaggggcgcacgaaaggaggtagacct 232

                                               
Query: 1004 tcggtgtcgccctgggggaagcccaccaaggcagg 1038
            |||||||| || ||||| |||| |||||| |||||
Sbjct: 233  tcggtgtcaccttggggaaagctcaccaaagcagg 267

---

>dbj|AK229943.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds,
            clone: RAFL22-34-D13
          Length = 5934

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 284  ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
            |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 1325 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 1276

---

>ref|NM_126755.1| Arabidopsis thaliana structural constituent of ribosome (AT2G07715)
           mRNA, complete cds
          Length = 924

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
           |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 160 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 209

---

>gb|AC007729.3| Arabidopsis thaliana chromosome 2 BAC T18C6 genomic sequence, complete
             sequence
          Length = 114068

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 284   ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
             |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 82750 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 82799

---

>gb|AF387186.1|AF387186 Lonicera sp. Palmer 679 ribosomal protein L2 (rpl2) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 686

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 296 aggattgaatatgaccctaatcgttcttctcggatcgc 333
           ||||| |||||||||||||||||||||||||| |||||
Sbjct: 1   aggatagaatatgaccctaatcgttcttctcgaatcgc 38

---

>emb|Y08501.2|MIATGENA Arabidopsis thaliana mitochondrial genome
          Length = 366924

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 284    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
              |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 154903 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 154952

---

>gb|AF095278.1| Solanum tuberosum ribosomal protein large subunit 2 (rp12) gene,
           mitochondrial gene encoding mitochondrial protein,
           complete cds
          Length = 1555

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
           |||||||| |||||||| |||||||  ||||||||||||||||| |||||
Sbjct: 588 ggcattgtagaaaggatagaatatgcgcctaatcgttcttctcgaatcgc 637



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 214 ttttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||||| |||||
Sbjct: 518 ttttcaccgagggggtggatcgaagcg 544

---

>dbj|AP006444.1| Brassica napus mitochondrial DNA, complete genome
          Length = 221853

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                
Query: 284    ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
              |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 140476 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 140525

---

>emb|X82565.1|MIATRPL2 A.thaliana mitochondrial gene rp12 (5' end)
          Length = 3145

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                              
Query: 284  ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
            |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 1018 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 1067

---

>gb|AC172860.1| Brassica rapa subsp. pekinensis clone KBrB042G11, complete sequence
          Length = 124347

 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 284   ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgc 333
             |||||||| || || || ||||||||||||||||||||||||| ||||||
Sbjct: 61821 ggcattgtagagagtatagaatatgaccctaatcgttcttctcagatcgc 61870

---

>gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. k10, complete genome
          Length = 4829781

 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                                
Query: 928     cgtccgtggtgtggcgatgaacccggtggacca 960
               |||||||||||||| ||||||||||||||||||
Sbjct: 4640502 cgtccgtggtgtggtgatgaacccggtggacca 4640534

---

>gb|DQ246077.1| Zea mays clone 14417 mRNA sequence
          Length = 1040

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 663 cgtggtgtggccatgaaccctgtggagcatccccacggaggagg 706

---

>ref|NM_114978.1| Arabidopsis thaliana structural constituent of ribosome (AT3G51190)
           mRNA, complete cds
          Length = 783

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           |||||||| ||||||||||| ||||| |||||||| ||||||||
Sbjct: 601 cgtggtgttgcgatgaacccagtggaacatccccacggaggagg 644

---

>gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, partial cds
          Length = 270

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 82  cgtggtgtggccatgaaccctgtggagcatccccacggaggagg 125

---

>gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At3g51190) mRNA,
           complete cds
          Length = 783

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           |||||||| ||||||||||| ||||| |||||||| ||||||||
Sbjct: 601 cgtggtgttgcgatgaacccagtggaacatccccacggaggagg 644

---

>gb|AF387177.1|AF387177 Corylopsis glabrescens f. gotoana ribosomal protein L2 (rpl2)
           mitochondrial pseudogene, partial sequence
          Length = 522

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                   
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcac 987
           |||||||| || ||||| || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 457 cgtggtgttgcaatgaatccagtggatcatcctcatggaggaggtgaggggcgcac 512

---

>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12
          Length = 129516

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 932   cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
             |||||||| ||||||||||| ||||| |||||||| ||||||||
Sbjct: 76113 cgtggtgttgcgatgaacccagtggaacatccccacggaggagg 76070

---

>gb|AY105581.1| Zea mays PCO150618 mRNA sequence
          Length = 1102

 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| ||||| |||||||| ||||||||
Sbjct: 669 cgtggtgtggccatgaaccctgtggagcatccccacggaggagg 712

---

>dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase A regulatory
            subunit, complete cds
          Length = 2300

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                               
Query: 932  cgtggtgtggcgatgaacccggtggaccatcccca 966
            ||||||||||| |||||||| ||||||||||||||
Sbjct: 1937 cgtggtgtggcaatgaaccctgtggaccatcccca 1971

---

>gb|CP000454.1| Arthrobacter sp. FB24, complete genome
          Length = 4698945

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                     
Query: 928     cgtccgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggg 981
               |||||||||||| |||||||||||||| ||||| || || || || ||||||||
Sbjct: 3331935 cgtccgtggtgtcgcgatgaacccggtcgaccacccgcacggtggtggcgaggg 3331882

---

>dbj|AB251495.1| Physcomitrella patens mitochondrial DNA, complete genome
          Length = 105340

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 80/98 (81%)
 Strand = Plus / Plus

                                                                         
Query: 935   ggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcaccaagggc 994
             ||||| || ||||| |||||||| ||||| |||||||||||||| || ||||| || || 
Sbjct: 93625 ggtgttgctatgaatccggtggatcatcctcatggaggaggcgaaggacgcacgaaagga 93684

                                                   
Query: 995   ggcaggccgtcggtgtcgccctgggggaagcccaccaa 1032
             || || || ||||| || || ||||| |||||| ||||
Sbjct: 93685 ggtagaccttcggtatcaccttggggaaagcccgccaa 93722

---

>gb|M68929.1|MPOMTCG Marchantia polymorpha mitochondrion, complete genome
          Length = 186609

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 62/74 (83%)
 Strand = Plus / Plus

                                                                         
Query: 284   ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 343
             |||||||| ||||| || ||||||||||| |||||||| ||| |||| ||  |  | |||
Sbjct: 60928 ggcattgtagaaagaatcgaatatgacccaaatcgttcgtcttggattgctttagtacga 60987

                           
Query: 344   tggatcgaaggggt 357
             ||||||||||||||
Sbjct: 60988 tggatcgaaggggt 61001

---

>gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 881

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 929 gtccgtggtgtggcgatgaacccggtggaccatccccatggaggaggcga 978
           |||||||||||||| |||||||| ||||| ||||||   |||||||||||
Sbjct: 645 gtccgtggtgtggccatgaaccctgtggagcatcccttcggaggaggcga 694

---

>gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 882

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                             
Query: 929 gtccgtggtgtggcgatgaacccggtggaccatccccatggaggaggcga 978
           |||||||||||||| |||||||| ||||| ||||||   |||||||||||
Sbjct: 645 gtccgtggtgtggccatgaaccctgtggagcatcccttcggaggaggcga 694

---

>gb|BT012998.1| Lycopersicon esculentum clone 114219R, mRNA sequence
          Length = 929

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatgg 969
           ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 500 cgtggtgtggcgatgaatccggtggatcatccacatgg 537

---

>gb|CP000267.1| Rhodoferax ferrireducens DSM 15236, complete genome
          Length = 4712337

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                     
Query: 928     cgtccgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggg 981
               ||||||||||||||  |||||||||||||| || || ||||| || ||||||||
Sbjct: 4234049 cgtccgtggtgtggttatgaacccggtggatcacccgcatggcggtggcgaggg 4233996

---

>gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds
          Length = 717

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatgg 969
           ||||||||||| |||||||| ||||| |||||||||||
Sbjct: 598 cgtggtgtggctatgaaccctgtggagcatccccatgg 635

---

>gb|AY044159.1| Lycopersicon esculentum ribosomal protein L2 gene, complete cds;
           nuclear gene for mitochondrial product
          Length = 689

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatgg 969
           ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 537 cgtggtgtggcgatgaatccggtggatcatccacatgg 574

---

>gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mRNA, partial cds
          Length = 543

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 928 cgtccgtggtgtggcgatgaacccggtggaccatccccatgg 969
           ||||||||||||||| |||||||| || || |||||||||||
Sbjct: 435 cgtccgtggtgtggctatgaaccccgttgagcatccccatgg 476

---

>gb|CP000325.1| Mycobacterium ulcerans Agy99, complete genome
          Length = 5631606

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                               
Query: 928    cgtccgtggtgtggcgatgaacccggtggacca 960
              |||||||||||||| |||||||||||| |||||
Sbjct: 839168 cgtccgtggtgtggtgatgaacccggtcgacca 839200

---

>gb|CP000479.1| Mycobacterium avium 104, complete genome
          Length = 5475491

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                                
Query: 928     cgtccgtggtgtggcgatgaacccggtggacca 960
               |||||| ||||||| ||||||||||||||||||
Sbjct: 4597682 cgtccgcggtgtggtgatgaacccggtggacca 4597650

---

>gb|CP000088.1| Thermobifida fusca YX, complete genome
          Length = 3642249

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                        
Query: 928     cgtccgtggtgtggcgatgaacccg 952
               |||||||||||||||||||||||||
Sbjct: 3106271 cgtccgtggtgtggcgatgaacccg 3106247

---

>emb|CT834502.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSN089C15, full
           insert sequence
          Length = 1052

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 669 cgtggtgtggccatgaaccccgttgagcatccccacggaggagg 712

---

>emb|CT834501.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA114N14, full
           insert sequence
          Length = 1048

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 669 cgtggtgtggccatgaaccccgttgagcatccccacggaggagg 712

---

>ref|NM_001073594.1| Oryza sativa (japonica cultivar-group) Os12g0567700 (Os12g0567700)
           mRNA, complete cds
          Length = 1071

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 663 cgtggtgtggccatgaaccccgttgagcatccccacggaggagg 706

---

>emb|AM286690.1| Alcanivorax borkumensis SK2, complete genome
          Length = 3120143

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 935    ggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgca 986
              |||| ||||||||||||||| |||||||| ||||| || || || |||||||
Sbjct: 451092 ggtgcggcgatgaacccggtagaccatccacatggtggtggtgaagggcgca 451143

---

>gb|AC189627.1| Brassica rapa subsp. pekinensis clone KBrS001M03, complete sequence
          Length = 115604

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 932   cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
             ||||||||||| |||||||| ||||| ||||| || ||||||||
Sbjct: 52320 cgtggtgtggctatgaacccagtggagcatcctcacggaggagg 52277

---

>gb|AC189569.1| Brassica rapa subsp. pekinensis clone KBrH009I12, complete sequence
          Length = 131398

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 932   cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
             ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 98541 cgtggtgtggctatgaaccctgttgagcatccccacggaggagg 98584

---

>ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural constituent of ribosome
           (EMB2296) mRNA, complete cds
          Length = 968

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 645 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 688

---

>gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 903

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 929 gtccgtggtgtggcgatgaacccggtggaccatccc 964
           |||||||||||||| |||||||| ||||| ||||||
Sbjct: 667 gtccgtggtgtggccatgaaccctgtggagcatccc 702

---

>gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 854

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 929 gtccgtggtgtggcgatgaacccggtggaccatccc 964
           |||||||||||||| |||||||| ||||| ||||||
Sbjct: 619 gtccgtggtgtggccatgaaccctgtggagcatccc 654

---

>gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 944

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 645 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 688

---

>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome
          Length = 2909809

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 51/60 (85%)
 Strand = Plus / Plus

                                                                          
Query: 928    cgtccgtggtgtggcgatgaacccggtggaccatccccatggaggaggcgaggggcgcac 987
              |||||||||||| | |||||||||||| || || || || || || ||||||||||||||
Sbjct: 439881 cgtccgtggtgtcgtgatgaacccggtcgatcacccgcacggcggtggcgaggggcgcac 439940

---

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 932   cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
             ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 37908 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 37865

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 932      cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
                ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 23385059 cgtggtgtggccatgaaccccgttgagcatccccacggaggagg 23385102

---

>gb|AF387178.1|AF387178 Cornus foemina ribosomal protein L2 (rpl2) mitochondrial
           pseudogene, partial sequence
          Length = 523

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 944 atgaacccggtggaccatccccatggaggaggcgaggggcgcac 987
           ||||| || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 459 atgaatccagtggatcatcctcatggaggaggtgaggggcgcac 502

---

>dbj|AP003933.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0066C06
          Length = 162304

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 302   gaatatgaccctaatcgttcttctcggatcgc 333
             ||||||||||||||| |||||||||| |||||
Sbjct: 77150 gaatatgaccctaattgttcttctcgaatcgc 77181

---

>emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2
          Length = 1002

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 662 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 705

---

>dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E03, full
           insert sequence
          Length = 1037

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 663 cgtggtgtggccatgaaccccgttgagcatccccacggaggagg 706

---

>emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 623 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 666

---

>emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 881

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 609 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 652

---

>emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 623 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 666

---

>emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS61ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 616 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 659

---

>emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 901

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 594 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 637

---

>dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063F19, full
           insert sequence
          Length = 1072

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 664 cgtggtgtggccatgaaccccgttgagcatccccacggaggagg 707

---

>gb|AY108123.1| Zea mays PCO067267 mRNA sequence
          Length = 1062

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| || || ||||| |||||||||||
Sbjct: 694 cgtggtgtggccatgaaccctgttgagcatcctcatggaggagg 737

---

>emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa0016C14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 162261

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                          
Query: 932    cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
              ||||||||||| |||||||| || || |||||||| ||||||||
Sbjct: 117100 cgtggtgtggccatgaaccccgttgagcatccccacggaggagg 117057

---

>emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1
          Length = 759

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| |||||||| || || ||||| |||||||||||
Sbjct: 631 cgtggtgtggctatgaaccccgttgagcatcctcatggaggagg 674

---

>gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 858

 Score = 48.1 bits (24), Expect = 0.080
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggaggagg 975
           ||||||||||| ||||| || ||||| ||||| |||||||||||
Sbjct: 598 cgtggtgtggctatgaatccagtggagcatcctcatggaggagg 641

---

>gb|CP000480.1| Mycobacterium smegmatis str. MC2 155, complete genome
          Length = 6988209

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 793     gcggctgccgtcgggcgtcgaga 815
               |||||||||||||||||||||||
Sbjct: 3118326 gcggctgccgtcgggcgtcgaga 3118348

---

>ref|XM_001229815.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_03300)
           mRNA, complete cds
          Length = 273

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 932 cgtggtgtggcgatgaacccggtggaccatcccca 966
           |||||||| || ||||||||||| |||||||||||
Sbjct: 106 cgtggtgttgccatgaacccggttgaccatcccca 140

---

>ref|XM_505841.1| Yarrowia lipolytica CLIB122, YALI0F24739g predicted mRNA
          Length = 765

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 935 ggtgtggcgatgaacccggtggaccatccccatgg 969
           |||||||| |||||||| || ||||||||||||||
Sbjct: 601 ggtgtggctatgaaccccgtcgaccatccccatgg 635

---

>gb|AY083306.1| Mycoplasma hominis 50S ribosomal protein L3 (rplC) gene, partial cds;
            50S ribosomal protein L4 (rplD), 50S ribosomal protein
            L23 (rplW), 50S ribosomal protein L2 (rplB), 50S
            ribosomal protein S19 (rpsS), and 50S ribosomal protein
            L22 (rplV) genes, complete cds; and 50S ribosomal protein
            S3 (rpsC) gene, partial cds
          Length = 3237

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 299  attgaatatgaccctaatcgttc 321
            |||||||||||||||||||||||
Sbjct: 1877 attgaatatgaccctaatcgttc 1899

---

>gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein L8 (rpL8) gene, complete
            cds
          Length = 1718

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 932  cgtggtgtggcgatgaacccggtggaccatcccca 966
            ||||||||||| |||||||| ||||| ||||||||
Sbjct: 1376 cgtggtgtggccatgaaccccgtggagcatcccca 1410

---

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 935     ggtgtggcgatgaacccggtggaccatccccatgg 969
               |||||||| |||||||| || ||||||||||||||
Sbjct: 3210453 ggtgtggctatgaaccccgtcgaccatccccatgg 3210487

---

>gb|AY832249.1| Ginkgo biloba ribosomal protein L2 (rpl2) gene, partial cds;
           mitochondrial
          Length = 565

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 214 ttttcaccgagggggtggatccaagcg 240
           ||||||||||||||||||||| |||||
Sbjct: 23  ttttcaccgagggggtggatcgaagcg 49



 Score = 44.1 bits (22), Expect = 1.2
 Identities = 61/74 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 ggcattgtggaaaggattgaatatgaccctaatcgttcttctcggatcgcacttctccga 343
           |||||||| |||||||| |||| |||||| |||||  | |||||||| ||  |  | |||
Sbjct: 93  ggcattgtagaaaggatcgaatgtgacccaaatcgcccctctcggattgctttagtacga 152

                         
Query: 344 tggatcgaaggggt 357
           ||||||||||||||
Sbjct: 153 tggatcgaaggggt 166

---

>gb|CP000482.1| Pelobacter propionicus DSM 2379, complete genome
          Length = 4008000

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 932    cgtggtgtggcgatgaacccggtggaccatccccatgg 969
              |||||||| || ||||||||||| ||||| ||||||||
Sbjct: 724915 cgtggtgtcgcaatgaacccggttgaccacccccatgg 724952

---

>gb|AY465723.1| Xyris jupicai ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1270

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 944  atgaacccggtggaccatccccatgg 969
            |||||||| |||||||||||||||||
Sbjct: 1196 atgaaccctgtggaccatccccatgg 1221

---

>gb|AY465720.1| Flagellaria indica ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1266

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 944  atgaacccggtggaccatccccatgg 969
            |||||||| |||||||||||||||||
Sbjct: 1192 atgaaccctgtggaccatccccatgg 1217

---

>gb|AY465719.1| Elegia fenestrata ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1265

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 944  atgaacccggtggaccatccccatgg 969
            |||||||| |||||||||||||||||
Sbjct: 1191 atgaaccctgtggaccatccccatgg 1216

---

>ref|XM_001178161.1| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L8 (LOC591341), mRNA
          Length = 851

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatgg 969
           |||||||| || |||||||| || ||||||||||||||
Sbjct: 620 cgtggtgttgctatgaaccccgttgaccatccccatgg 657

---

>ref|XM_790908.2| PREDICTED: Strongylocentrotus purpuratus similar to ribosomal
           protein L8 (LOC591341), mRNA
          Length = 851

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatgg 969
           |||||||| || |||||||| || ||||||||||||||
Sbjct: 620 cgtggtgttgctatgaaccccgttgaccatccccatgg 657

---

>gb|CP000453.1| Alkalilimnicola ehrlichei MLHE-1, complete genome
          Length = 3275944

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                    
Query: 932    cgtggtgtggcgatgaacccggtggaccatccccatgg 969
              |||||||| || ||||||||||| ||||| ||||||||
Sbjct: 520474 cgtggtgttgccatgaacccggtcgaccacccccatgg 520511

---

>gb|AY699151.1| Lepidozamia hopei ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1310

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 944  atgaacccggtggaccatccccatgg 969
            |||||||| |||||||||||||||||
Sbjct: 1236 atgaaccctgtggaccatccccatgg 1261

---

>gb|CP000362.1| Roseobacter denitrificans OCh 114, complete genome
          Length = 4133097

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 670     cgacatccgcatgggaacgtgg 691
               ||||||||||||||||||||||
Sbjct: 3906336 cgacatccgcatgggaacgtgg 3906315

---

>gb|CP000377.1| Silicibacter sp. TM1040, complete genome
          Length = 3200938

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                        
Query: 928    cgtccgtggtgtggcgatgaacccggtggaccatccccatgg 969
              ||||||||||||||  ||||||||| | ||||| ||||||||
Sbjct: 269591 cgtccgtggtgtggttatgaacccgatcgaccacccccatgg 269632

---

>gb|AY147698.1| Mayaca fluviatilis ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1258

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 944  atgaacccggtggaccatccccatgg 969
            |||||||| |||||||||||||||||
Sbjct: 1184 atgaacccagtggaccatccccatgg 1209

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 935     ggtgtggcgatgaacccggtggacca 960
               |||||||||||||||||||| |||||
Sbjct: 5989901 ggtgtggcgatgaacccggttgacca 5989926

---

>dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisum) genomic DNA, complete
              sequence
          Length = 640681

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 300    ttgaatatgaccctaatcgttcttct 325
              |||||||||| |||||||||||||||
Sbjct: 558054 ttgaatatgatcctaatcgttcttct 558029

---

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 944     atgaacccggtggaccatccccatggaggaggcgaggg 981
               ||||||||||||||||| ||||| || || ||||||||
Sbjct: 1588510 atgaacccggtggaccacccccacggcggcggcgaggg 1588473

---

>gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal protein L8 mRNA,
           complete cds
          Length = 477

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatgg 969
           ||||||||||| |||||||| || || |||||||||||
Sbjct: 214 cgtggtgtggctatgaaccctgttgagcatccccatgg 251

---

>gb|DQ206555.1| Leucosolenia sp. AR-2003 isolate TOA23 ribosomal protein 8 large
           subunit mRNA, partial cds
          Length = 385

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 928 cgtccgtggtgtggcgatgaacccggtggaccatccccatgg 969
           |||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 342 cgtccgtggtgttgctatgaacccggtagagcatcctcatgg 383

---

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 944     atgaacccggtggaccatccccatggaggaggcgaggg 981
               ||||||||||||||||| ||||| || || ||||||||
Sbjct: 1264380 atgaacccggtggaccacccccacggcggcggcgaggg 1264343

---

>gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene exons 1-3, complete cds
          Length = 2231

 Score = 44.1 bits (22), Expect = 1.2
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 932  cgtggtgtggcgatgaacccggtggaccatccccatgg 969
            ||||||||||| |||||||| || || |||||||||||
Sbjct: 1882 cgtggtgtggctatgaaccccgttgagcatccccatgg 1919

---

>gb|EF044213.1| Coffea arabica chloroplast, complete genome
          Length = 155189

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 944   atgaacccggtggaccatccccatggagg 972
             |||||||| || |||||||||||||||||
Sbjct: 85469 atgaaccctgtagaccatccccatggagg 85441



 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 944    atgaacccggtggaccatccccatggagg 972
              |||||||| || |||||||||||||||||
Sbjct: 154887 atgaaccctgtagaccatccccatggagg 154915

---

>emb|CR790361.11| Zebrafish DNA sequence from clone DKEY-29N19, complete sequence
          Length = 140025

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 426   tggaaccgggcagcatggtgg 446
             |||||||||||||||||||||
Sbjct: 70218 tggaaccgggcagcatggtgg 70198

---

>gb|CP000431.1| Rhodococcus sp. RHA1, complete genome
          Length = 7804765

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 928     cgtccgtggtgtggcgatgaacccggtggacca 960
               |||||||||||| | |||||||||||| |||||
Sbjct: 6634534 cgtccgtggtgtcgtgatgaacccggtcgacca 6634566

---

>gb|CP000113.1| Myxococcus xanthus DK 1622, complete genome
          Length = 9139763

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 928     cgtccgtggtgtggcgatgaacccggtggacca 960
               |||||| ||| |||||||||||||||| |||||
Sbjct: 3856595 cgtccgcggtctggcgatgaacccggtcgacca 3856627

---

>gb|AY147721.1| Allium textile ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast
          Length = 1260

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 944  atgaacccggtggaccatccccatggagg 972
            |||||||| || |||||||||||||||||
Sbjct: 1186 atgaaccctgtagaccatccccatggagg 1214

---

>gb|AY596744.1| Lepistemon owariensis ribosomal protein L2 (rpl2) gene, partial
           cds; chloroplast
          Length = 565

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 944 atgaacccggtggaccatccccatggagg 972
           |||||||| || |||||||||||||||||
Sbjct: 512 atgaaccctgtagaccatccccatggagg 540

---

>gb|DQ069411.1| Nuphar advena ribosomal protein L2 (rpl2) gene, partial cds;
           chloroplast
          Length = 819

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 944 atgaacccggtggaccatccccatggagg 972
           |||||||| || |||||||||||||||||
Sbjct: 670 atgaaccctgtagaccatccccatggagg 698

---

>gb|AF033858.2| Pediococcus pentosaceus strain ATCC43200 plasmid pMD136, complete
             plasmid sequence
          Length = 19515

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 130   gatgcagaagttcaagaccct 150
             |||||||||||||||||||||
Sbjct: 19373 gatgcagaagttcaagaccct 19393

---

>gb|AC127298.4| Mus musculus BAC clone RP23-264F2 from 3, complete sequence
          Length = 161266

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 759   aggtggtcaaggagtcggcga 779
             |||||||||||||||||||||
Sbjct: 96723 aggtggtcaaggagtcggcga 96703

---

>gb|AY007489.1| Austrobaileya scandens ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1268

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 944  atgaacccggtggaccatccccatggagg 972
            |||||||| || |||||||||||||||||
Sbjct: 1194 atgaaccctgtagaccatccccatggagg 1222

---

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                
Query: 928     cgtccgtggtgtggcgatgaacccggtggacca 960
               |||||||||||| | |||||||||||| |||||
Sbjct: 3477030 cgtccgtggtgtcgtgatgaacccggtcgacca 3476998

---

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 148    cctggccaaggccttgaccggcaagaccg 176
              ||||||||||||| || ||||||||||||
Sbjct: 681381 cctggccaaggccctggccggcaagaccg 681409

---

>gb|AF426458.1| Primary endosymbiont of Sitophilus zeamais ribosomal protein
           L2-like protein (rplB) gene, partial cds
          Length = 665

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 940 ggcgatgaacccggtggacca 960
           |||||||||||||||||||||
Sbjct: 77  ggcgatgaacccggtggacca 57

---

>gb|CP000236.1| Ehrlichia chaffeensis str. Arkansas, complete genome
          Length = 1176248

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1256   ataataacaagtgatgtgttt 1276
              |||||||||||||||||||||
Sbjct: 427756 ataataacaagtgatgtgttt 427776

---

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 906     ggtggctgggcaggcggccgg 926
               |||||||||||||||||||||
Sbjct: 1563437 ggtggctgggcaggcggccgg 1563417

---

>ref|XM_757274.1| Ustilago maydis 521 hypothetical protein (UM06220.1) partial mRNA
          Length = 303

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 932 cgtggtgtggcgatgaacccggtggacca 960
           ||||||||||| ||||||||||| |||||
Sbjct: 133 cgtggtgtggctatgaacccggttgacca 161

---

>emb|BX649221.3| Chicken DNA sequence from clone WAG-43K7, complete sequence
          Length = 101661

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 277   ttcagttggcattgtggaaaggatt 301
             |||||||| ||||||||||||||||
Sbjct: 33971 ttcagttgacattgtggaaaggatt 33995

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                    
Query: 287     attgtggaaaggattgaatatgaccctaatcgttctt 323
               |||||||||||||| |||||| | |||||| ||||||
Sbjct: 7495289 attgtggaaaggatagaatataatcctaatagttctt 7495253

---

>emb|Z98743.1|HS181C9 Human DNA sequence from clone RP1-181C9 on chromosome 22q13.2-13.33,
             complete sequence
          Length = 92472

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 889   gaaggcagggcacagccggtg 909
             |||||||||||||||||||||
Sbjct: 70612 gaaggcagggcacagccggtg 70592

---

>emb|AL939121.1|SCO939121 Streptomyces coelicolor A3(2) complete genome; segment 18/29
          Length = 292100

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 932   cgtggtgtggcgatgaacccggtggacca 960
             ||||||||||  |||||||||||||||||
Sbjct: 52419 cgtggtgtggtcatgaacccggtggacca 52447

---

>gb|AF188855.1|AF188855 Nymphaea odorata ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1274

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 944  atgaacccggtggaccatccccatggagg 972
            |||||||| || |||||||||||||||||
Sbjct: 1200 atgaaccctgtagaccatccccatggagg 1228

---

>emb|AL096859.2|ATT6H20 Arabidopsis thaliana DNA chromosome 3, BAC clone T6H20
          Length = 98461

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 944   atgaacccggtggaccatccccatggagg 972
             |||||||| || |||||||||||||||||
Sbjct: 89070 atgaaccctgtcgaccatccccatggagg 89098

---

>emb|AJ627251.1| Nymphaea alba chloroplast, complete genome
          Length = 159930

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 944   atgaacccggtggaccatccccatggagg 972
             |||||||| || |||||||||||||||||
Sbjct: 90205 atgaaccctgtagaccatccccatggagg 90177



 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 944    atgaacccggtggaccatccccatggagg 972
              |||||||| || |||||||||||||||||
Sbjct: 159740 atgaaccctgtagaccatccccatggagg 159768

---

>gb|AF123787.1|AF123787 Cabomba caroliniana ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1272

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 944  atgaacccggtggaccatccccatggagg 972
            |||||||| || |||||||||||||||||
Sbjct: 1200 atgaaccctgtagaccatccccatggagg 1228

---

>gb|AC007250.2| Homo sapiens BAC clone RP11-334G22 from 2, complete sequence
          Length = 180557

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 635  ctcaactccaaggtgggaaac 655
            |||||||||||||||||||||
Sbjct: 1981 ctcaactccaaggtgggaaac 1961

---

>dbj|AP004070.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1705_E12
          Length = 191416

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 287   attgtggaaaggattgaatatgaccctaatcgttctt 323
             |||||||||||||| |||||| | |||||| ||||||
Sbjct: 88995 attgtggaaaggatagaatataatcctaatagttctt 88959

---

>dbj|AP000423.1| Arabidopsis thaliana chloroplast genomic DNA, complete sequence,
             strain:Columbia
          Length = 154478

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 944   atgaacccggtggaccatccccatggagg 972
             |||||||| || |||||||||||||||||
Sbjct: 84495 atgaaccctgtcgaccatccccatggagg 84467



 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 944    atgaacccggtggaccatccccatggagg 972
              |||||||| || |||||||||||||||||
Sbjct: 154154 atgaaccctgtcgaccatccccatggagg 154182

---

>gb|AY007498.1| Schisandra chinensis ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1267

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 944  atgaacccggtggaccatccccatggagg 972
            |||||||| || |||||||||||||||||
Sbjct: 1193 atgaaccctgtagaccatccccatggagg 1221

---

>gb|AY007491.1| Gunnera chilensis ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1249

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 944  atgaacccggtggaccatccccatggagg 972
            |||||||| || |||||||||||||||||
Sbjct: 1175 atgaaccctgtagaccatccccatggagg 1203

---

>gb|AY007488.1| Arabidopsis thaliana ribosomal protein L2 (rpl2) gene, partial cds;
            chloroplast gene for chloroplast product
          Length = 1266

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 944  atgaacccggtggaccatccccatggagg 972
            |||||||| || |||||||||||||||||
Sbjct: 1212 atgaaccctgtcgaccatccccatggagg 1240

---

>emb|BX322622.10| Zebrafish DNA sequence from clone DKEYP-14D3 in linkage group 8,
             complete sequence
          Length = 162365

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1243  ttatcatgtatcaataataacaagt 1267
             ||||||||| |||||||||||||||
Sbjct: 50092 ttatcatgtctcaataataacaagt 50068

---

>emb|BX088532.7| Zebrafish DNA sequence from clone CH211-127E17 in linkage group 8,
             complete sequence
          Length = 115792

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1243  ttatcatgtatcaataataacaagt 1267
             ||||||||| |||||||||||||||
Sbjct: 39224 ttatcatgtctcaataataacaagt 39200

---

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 720     agggcgcgaagctcgtccggg 740
               |||||||||||||||||||||
Sbjct: 3127102 agggcgcgaagctcgtccggg 3127122

---

>gb|AY105270.1| Zea mays PCO089214 mRNA sequence
          Length = 735

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 182 gctgggaggaactcttccgggcgaatcacttcttttcaccg 222
           |||||||||||||| || ||||| ||||| ||||| |||||
Sbjct: 328 gctgggaggaactcgtctgggcgcatcacctctttccaccg 368

---

>gb|AF069302.1|AF069302 Pediococcus pentosaceus plasmid pMD136, complete sequence
          Length = 19533

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 130   gatgcagaagttcaagaccct 150
             |||||||||||||||||||||
Sbjct: 15474 gatgcagaagttcaagaccct 15494

---

>emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1
          Length = 884

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 634 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 674

---

>emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1
          Length = 883

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 648 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 688

---

>emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1
          Length = 814

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 237 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 197

---

>emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1
          Length = 878

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || |||||||| |||||
Sbjct: 643 cgtggtgtggctatgaaccccgttgagcatccccacggagg 683

---

>emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1
          Length = 823

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || |||||||| |||||
Sbjct: 236 cgtggtgtggctatgaaccccgttgagcatccccacggagg 196

---

>emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1
          Length = 834

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 630 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 670

---

>emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1
          Length = 838

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 237 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 197

---

>emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1
          Length = 834

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 250 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 210

---

>emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1
          Length = 854

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 634 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 674

---

>emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1
          Length = 869

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 632 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 672

---

>emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1
          Length = 844

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 237 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 197

---

>emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1
          Length = 868

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 632 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 672

---

>emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1
          Length = 822

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 932 cgtggtgtggcgatgaacccggtggaccatccccatggagg 972
           ||||||||||| |||||||| || || ||||| ||||||||
Sbjct: 237 cgtggtgtggctatgaaccccgttgagcatcctcatggagg 197

---

>emb|AJ343462.1|HSA343462 Homo sapiens genomic sequence surrounding NotI site, clone NR1-CG4R
          Length = 741

 Score = 42.1 bits (21), Expect = 4.9
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 889 gaaggcagggcacagccggtg 909
           |||||||||||||||||||||
Sbjct: 532 gaaggcagggcacagccggtg 552


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 189,575,111
Number of extensions: 11212703
Number of successful extensions: 194358
Number of sequences better than 10.0: 168
Number of HSP's gapped: 194356
Number of HSP's successfully gapped: 197
Length of query: 1295
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1272
Effective length of database: 18,503,978,556
Effective search space: 23537060723232
Effective search space used: 23537060723232
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)

---