>emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chromosome 11 Contains the
Taf15 gene for TAF15 RNA polymerase II TATA box binding
protein (TBP)-associated factor, two novel genes, the Ccl5,
Ccl9, Ccl6, Ccl3 and Ccl4 genes for chemokine (C-C motif)
ligand 5, 9, 6, 3 and 4, a ribosomal protein L9 (Rpl9)
pseudogene, three extracellular proteinase inhibitor (Expi)
pseudogene and an H+ transporting mitochondrial F1F0
complex ATP synthase subunit e (Atp5k) pseudogene,,
complete sequence
Length = 211873
Score = 44.1 bits (22), Expect = 1.7
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 306 tgaatatgtgatcagtggagggatgg 331
||||||||||| ||||||||||||||
Sbjct: 185012 tgaatatgtgagcagtggagggatgg 184987
>emb|BX004808.5| Zebrafish DNA sequence from clone CH211-51B23 in linkage group 16,
complete sequence
Length = 184760
Score = 42.1 bits (21), Expect = 6.8
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 1662 ctctcctgttgtgtgtttcag 1682
|||||||||||||||||||||
Sbjct: 33178 ctctcctgttgtgtgtttcag 33198
Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
Posted date: Dec 3, 2006 5:45 PM
Number of letters in database: 18,610,659,111
Number of sequences in database: 4,638,285
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 341,522,138
Number of extensions: 18025386
Number of successful extensions: 408922
Number of sequences better than 10.0: 33
Number of HSP's gapped: 408920
Number of HSP's successfully gapped: 38
Length of query: 1773
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1750
Effective length of database: 18,503,978,556
Effective search space: 32381962473000
Effective search space used: 32381962473000
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)