| Clone Name | rbastl47b08 |
|---|---|
| Clone Library Name | barley_pub |
>emb|BX284692.14| Zebrafish DNA sequence from clone CH211-282O22 in linkage group 17, complete sequence Length = 162970 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 254 aaaagttccatgtaaaattaa 274 ||||||||||||||||||||| Sbjct: 15660 aaaagttccatgtaaaattaa 15640
>ref|XM_648854.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (68.t00042) partial mRNA Length = 621 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 254 aaaagttccatgtaaaatta 273 |||||||||||||||||||| Sbjct: 57 aaaagttccatgtaaaatta 76
>emb|AL390765.17| Human DNA sequence from clone RP11-509I1 on chromosome 1 Contains the 5' end of the GNG4 gene for guanine nucleotide binding (G protein) gamma 4 protein, the 3' end of the CHS1 gene for Chediak-Higashi syndrome 1 protein and a CpG island, complete sequence Length = 80101 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 256 aagttccatgtaaaattaag 275 |||||||||||||||||||| Sbjct: 68261 aagttccatgtaaaattaag 68280
>emb|AL356534.12| Human DNA sequence from clone RP11-629P13 on chromosome 6, complete sequence Length = 175757 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 263 atgtaaaattaagcaagaca 282 |||||||||||||||||||| Sbjct: 97977 atgtaaaattaagcaagaca 97958
>gb|AF461197.1| Medicago sativa cytosolic malate dehydrogenase gene, exons 1 and 2 and partial cds Length = 3482 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 238 gactcagatgcagttgaaaa 257 |||||||||||||||||||| Sbjct: 1759 gactcagatgcagttgaaaa 1778
>emb|CR925789.6| Zebrafish DNA sequence from clone DKEY-47M9 in linkage group 14, complete sequence Length = 173071 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 174 caacacaggcacatacagtc 193 |||||||||||||||||||| Sbjct: 15222 caacacaggcacatacagtc 15203
>gb|AC100834.3| Homo sapiens chromosome 15, clone CTD-2125J1, complete sequence Length = 152005 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 tataatttacacaatcacaa 53 |||||||||||||||||||| Sbjct: 49479 tataatttacacaatcacaa 49498
>gb|AC159216.2| Pan troglodytes BAC clone CH251-477A18 from chromosome unknown, complete sequence Length = 206361 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 251 ttgaaaagttccatgtaaaa 270 |||||||||||||||||||| Sbjct: 36625 ttgaaaagttccatgtaaaa 36606
>gb|AC006432.15| Homo sapiens 12p13 PAC RPCI11-726G1 (Roswell Park Cancer Institute Human PAC Library) complete sequence Length = 180685 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 atgaaaacccagccgcttgg 74 |||||||||||||||||||| Sbjct: 149997 atgaaaacccagccgcttgg 150016
>gb|AC027671.9| Homo sapiens chromosome 10 clone RP11-183F21, complete sequence Length = 152867 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 251 ttgaaaagttccatgtaaaa 270 |||||||||||||||||||| Sbjct: 68713 ttgaaaagttccatgtaaaa 68732
>gb|AC104040.3| Homo sapiens chromosome 8, clone CTD-2023L15, complete sequence Length = 136646 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 80 atagtttttacccttgcata 99 |||||||||||||||||||| Sbjct: 126304 atagtttttacccttgcata 126323
>gb|AC009334.8| Homo sapiens chromosome 1, clone RP11-45L2, complete sequence Length = 165618 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 aagttccatgtaaaattaag 275 |||||||||||||||||||| Sbjct: 99816 aagttccatgtaaaattaag 99797
>gb|AC092821.11| Homo sapiens 12 BAC RP11-525E9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 121181 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 55 atgaaaacccagccgcttgg 74 |||||||||||||||||||| Sbjct: 43656 atgaaaacccagccgcttgg 43637
>gb|AC104257.12| Homo sapiens chromosome 8, clone CTD-2501M5, complete sequence Length = 167787 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 80 atagtttttacccttgcata 99 |||||||||||||||||||| Sbjct: 111632 atagtttttacccttgcata 111613
>emb|AL669898.17| Mouse DNA sequence from clone RP23-6C3 on chromosome X, complete sequence Length = 220201 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 95 gcataacaatgcttagaaga 114 |||||||||||||||||||| Sbjct: 156998 gcataacaatgcttagaaga 157017
>gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, complete sequence Length = 211079 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 111 aagatttcagcatgaacaaa 130 |||||||||||||||||||| Sbjct: 157591 aagatttcagcatgaacaaa 157572 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,904,320 Number of Sequences: 3902068 Number of extensions: 2904320 Number of successful extensions: 51716 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 51687 Number of HSP's gapped (non-prelim): 29 length of query: 365 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 343 effective length of database: 17,147,199,772 effective search space: 5881489521796 effective search space used: 5881489521796 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)