| Clone Name | rbastl46e11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY485644.1| Triticum monococcum phosphatidylserine decarboxylase, ZCCT2, ZCCT1, and SNF2P genes, complete cds; nucellin pseudogene, complete sequence; putative transposase, phosphatidylinositol phosphatidylcholine transfer protein sec14 cytosolic-like protein, and phytochrome P450-like protein genes, complete cds; and unknown genes Length = 438828 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Minus Query: 1 aataaacatgcttccaaaa 19 ||||||||||||||||||| Sbjct: 390150 aataaacatgcttccaaaa 390132
>gb|AC124535.4| Mus musculus BAC clone RP23-331C24 from chromosome 18, complete sequence Length = 206191 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 acatgcttccaaaacctgg 24 ||||||||||||||||||| Sbjct: 116577 acatgcttccaaaacctgg 116595
>gb|AC165311.3| Mus musculus chromosome 18, clone RP23-352F3, complete sequence Length = 174474 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Plus Query: 6 acatgcttccaaaacctgg 24 ||||||||||||||||||| Sbjct: 145054 acatgcttccaaaacctgg 145072
>gb|AC093521.3| Homo sapiens chromosome 5 clone RP11-152P24, complete sequence Length = 143970 Score = 38.2 bits (19), Expect = 0.78 Identities = 19/19 (100%) Strand = Plus / Minus Query: 9 tgcttccaaaacctggcag 27 ||||||||||||||||||| Sbjct: 58066 tgcttccaaaacctggcag 58048
>ref|XM_523972.1| PREDICTED: Pan troglodytes similar to zinc finger protein 407 (LOC468583), mRNA Length = 5541 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 205 aataaacatgcttccaaa 222
>ref|NM_006540.2| Homo sapiens nuclear receptor coactivator 2 (NCOA2), mRNA Length = 6157 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 5627 aataaacatgcttccaaa 5610
>gb|AE017261.1| Picrophilus torridus DSM 9790, complete genome Length = 1545895 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 2 ataaacatgcttccaaaa 19 |||||||||||||||||| Sbjct: 1255475 ataaacatgcttccaaaa 1255492
>gb|AC084251.13| Homo sapiens chromosome 8, clone RP11-152C15, complete sequence Length = 181400 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 143087 aataaacatgcttccaaa 143104
>emb|AL117329.8|HSBA191L9 Human DNA sequence from clone RP11-191L9 on chromosome 22, complete sequence Length = 146438 Score = 36.2 bits (18), Expect = 3.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 2 ataaacatgcttccaaaacctg 23 ||||||||| |||||||||||| Sbjct: 130368 ataaacatgtttccaaaacctg 130389
>emb|AJ630363.1| Canis familiaris MHC class II region on chromosome CFA12, partial sequence, BAC clones 224p2 and 282j14, containing DLA-DQA1 gene, DLA-DQB1 gene and DLA-DQB pseudogene Length = 180560 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 133618 aataaacatgcttccaaa 133635
>gb|AC091589.8| Homo sapiens chromosome 18, clone RP11-635B11, complete sequence Length = 177680 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 6918 aataaacatgcttccaaa 6935
>dbj|AK056288.1| Homo sapiens cDNA FLJ31726 fis, clone NT2RI2006735, weakly similar to Neofelis nebulosa strain nnex zinc finger protein Zfx gene Length = 2451 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 304 aataaacatgcttccaaa 321
>gb|AC000040.4| Homo sapiens Chromosome 22q13 Cosmid Clone p130c12, complete sequence Length = 38134 Score = 36.2 bits (18), Expect = 3.1 Identities = 21/22 (95%) Strand = Plus / Plus Query: 2 ataaacatgcttccaaaacctg 23 ||||||||| |||||||||||| Sbjct: 28428 ataaacatgtttccaaaacctg 28449
>gb|AC138660.4| Homo sapiens chromosome 18, clone XXfos-80851B11, complete sequence Length = 37580 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 27746 aataaacatgcttccaaa 27729
>emb|AL929018.14| Mouse DNA sequence from clone RP23-253K17 on chromosome 2, complete sequence Length = 189343 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 17 aaacctggcaggtcatga 34 |||||||||||||||||| Sbjct: 71310 aaacctggcaggtcatga 71293
>emb|AJ132000.1|CPL132000 Craterostigma plantagineum mRNA sucrose synthase 2 Length = 2648 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 4 aaacatgcttccaaaacc 21 |||||||||||||||||| Sbjct: 2370 aaacatgcttccaaaacc 2353
>emb|BX640464.10| Zebrafish DNA sequence from clone DKEY-22M8 in linkage group 19, complete sequence Length = 255824 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 147392 aataaacatgcttccaaa 147375
>emb|AL627123.13| Mouse DNA sequence from clone RP23-351I23 on chromosome 4, complete sequence Length = 185022 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Plus Query: 11 cttccaaaacctggcagg 28 |||||||||||||||||| Sbjct: 79192 cttccaaaacctggcagg 79209
>emb|X97674.1|HSTIF2GEN H.sapiens mRNA for transcriptional intermediary factor 2 Length = 6156 Score = 36.2 bits (18), Expect = 3.1 Identities = 18/18 (100%) Strand = Plus / Minus Query: 1 aataaacatgcttccaaa 18 |||||||||||||||||| Sbjct: 5627 aataaacatgcttccaaa 5610 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 256,614 Number of Sequences: 3902068 Number of extensions: 256614 Number of successful extensions: 74819 Number of sequences better than 10.0: 19 Number of HSP's better than 10.0 without gapping: 19 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 74771 Number of HSP's gapped (non-prelim): 48 length of query: 34 length of database: 17,233,045,268 effective HSP length: 20 effective length of query: 14 effective length of database: 17,155,003,908 effective search space: 240170054712 effective search space used: 240170054712 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 18 (36.2 bits)