| Clone Name | rbastl45f09 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AE016827.1| Mannheimia succiniciproducens MBEL55E, complete genome Length = 2314078 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 83 tacaagaacatggcaaacaa 102 |||||||||||||||||||| Sbjct: 407989 tacaagaacatggcaaacaa 407970
>ref|XM_587627.2| PREDICTED: Bos taurus similar to Down-regulated in metastasis protein (Key-1A6 protein) (Novel nucleolar protein 73) (NNP73) (LOC510487), mRNA Length = 8455 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 aaggaaaggaacagatctca 22 |||||||||||||||||||| Sbjct: 1272 aaggaaaggaacagatctca 1291
>ref|XM_746313.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g14260) partial mRNA Length = 1500 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 159 ccctttttgtggatgaacca 178 |||||||||||||||||||| Sbjct: 512 ccctttttgtggatgaacca 493
>emb|CR936846.7| Zebrafish DNA sequence from clone DKEY-20N3 in linkage group 1, complete sequence Length = 80060 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 96 caaacaacaattctaatgtc 115 |||||||||||||||||||| Sbjct: 35637 caaacaacaattctaatgtc 35656
>emb|AL159159.21| Human DNA sequence from clone RP11-88J11 on chromosome 13 Contains the 3' end of the CDK8 gene for cyclin-dependent kinase 8, complete sequence Length = 144626 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 ggaacagatctcaactcaca 29 |||||||||||||||||||| Sbjct: 17746 ggaacagatctcaactcaca 17727
>gb|AC073365.14| Homo sapiens 3 BAC RP11-479M14 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179598 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 89 aacatggcaaacaacaattc 108 |||||||||||||||||||| Sbjct: 55044 aacatggcaaacaacaattc 55025
>gb|AC098828.3| Homo sapiens BAC clone RP11-644K8 from 2, complete sequence Length = 127408 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 1 aaaaggaaaggaacagatct 20 |||||||||||||||||||| Sbjct: 11950 aaaaggaaaggaacagatct 11931
>gb|AC009303.3| Homo sapiens BAC clone RP11-98C1 from 2, complete sequence Length = 198652 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 219 caaggctctacaggaacagggcaa 242 |||||||||||||||| ||||||| Sbjct: 169450 caaggctctacaggaatagggcaa 169427
>emb|AL731828.22| Mouse DNA sequence from clone RP23-50L5 on chromosome X, complete sequence Length = 228327 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 265 atgaacttgaaacagatgag 284 |||||||||||||||||||| Sbjct: 124983 atgaacttgaaacagatgag 124964
>emb|AL732405.8| Mouse DNA sequence from clone RP23-149P4 on chromosome X, complete sequence Length = 193425 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 gaaaggaacagatctcaact 25 |||||||||||||||||||| Sbjct: 51224 gaaaggaacagatctcaact 51205
>gb|AC092891.5| Homo sapiens 12 BAC RP11-495C19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 109440 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 156 taaccctttttgtggatgaa 175 |||||||||||||||||||| Sbjct: 2952 taaccctttttgtggatgaa 2933 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,257,425 Number of Sequences: 3902068 Number of extensions: 3257425 Number of successful extensions: 66426 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 66403 Number of HSP's gapped (non-prelim): 23 length of query: 384 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 362 effective length of database: 17,147,199,772 effective search space: 6207286317464 effective search space used: 6207286317464 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)