| Clone Name | rbastl41c02 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT008920.1| Triticum aestivum clone wyr1c.pk001.j6:fis, full insert mRNA sequence Length = 955 Score = 190 bits (96), Expect = 3e-45 Identities = 146/164 (89%), Gaps = 9/164 (5%) Strand = Plus / Minus Query: 297 ttctgtaggggtccaatctcgagggggcaagtgggcaatctgggcagccagccatgtcat 356 |||||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||| Sbjct: 694 ttctgtaggggtccaatctcaagggggcaagtgggcaatttgggcagcgagccatgtcat 635 Query: 357 gtagttccggtagtaccgtccgtggatgttgtagttgcaatcctagtcttttcaggcaat 416 |||||||| ||| | | ||| ||||||||||||||||||||||| ||||||| Sbjct: 634 gtagttccagtaatgcagtcagtggatgttgtagttgcaatcct---------aggcaat 584 Query: 417 cagtgtgatgaagcggcatgttgcttgtgtcaccctgtttcttt 460 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 583 tagtgtgatgaagcggcatgttgcttgtgtcaccctgtttcttt 540 Score = 85.7 bits (43), Expect = 1e-13 Identities = 110/131 (83%), Gaps = 11/131 (8%) Strand = Plus / Minus Query: 140 aagccacattaggcactccttgccgcactaggacaaaatgcgggatgtg--------aac 191 |||||||| ||||||||||||| ||||||| ||||||||| ||||||| ||| Sbjct: 854 aagccacagtaggcactccttgttgcactag-acaaaatgcaggatgtgcctatgggaac 796 Query: 192 acacccaaaatcgttgtgcatgctaaagcggcaacataagccaggtgagatttcacatct 251 |||||||| || |||| ||||| ||||||||||||||| |||||||||||||| ||||| Sbjct: 795 acacccaacatagttg--catgccaaagcggcaacataaaccaggtgagatttcgcatct 738 Query: 252 actccgtttgg 262 ||||| ||||| Sbjct: 737 actccatttgg 727
>gb|AC150774.2| Xenopus tropicalis clone CH216-82E5, complete sequence Length = 87104 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 50 tttgacaaaatggaacaactg 70 ||||||||||||||||||||| Sbjct: 14614 tttgacaaaatggaacaactg 14634
>ref|XM_968049.1| PREDICTED: Tribolium castaneum similar to CG8520-PA (LOC661919), mRNA Length = 1317 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 413 caatcagtgtgatgaagcggc 433 ||||||||||||||||||||| Sbjct: 1057 caatcagtgtgatgaagcggc 1037
>dbj|AP006127.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT48O21, TM0211, complete sequence Length = 137303 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 176 aatgcgggatgtgaacacacc 196 ||||||||||||||||||||| Sbjct: 109744 aatgcgggatgtgaacacacc 109764
>gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome Length = 3481691 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 327 gtgggcaatctgggcagcca 346 |||||||||||||||||||| Sbjct: 1903831 gtgggcaatctgggcagcca 1903812
>ref|XM_414496.1| PREDICTED: Gallus gallus similar to Methionine adenosyltransferase II, beta (LOC416164), mRNA Length = 771 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 54 acaaaatggaacaactgata 73 |||||||||||||||||||| Sbjct: 642 acaaaatggaacaactgata 661
>gb|AY339245.1| Malacocottus zonurus isolate Malzon ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 839 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339243.1| Myoxocephalus sp. M_sp207 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 839 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339241.1| Myoxocephalus octodecemspinosus isolate Moct2179 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 839 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339240.1| Myoxocephalus aenaeus isolate Maen2128 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 839 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339239.1| Myoxocephalus aenaeus isolate Maen2126 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 839 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339235.1| Triglopsis quadricornis haplotype Arc2 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 832 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339234.1| Triglopsis quadricornis haplotype Arc1 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 837 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339233.1| Triglopsis quadricornis haplotype Eur5 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 837 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339232.1| Triglopsis quadricornis haplotype Eur4 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 839 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339231.1| Triglopsis quadricornis haplotype Eur3 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 839 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY339230.1| Triglopsis quadricornis haplotype Eur1 ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 832 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>emb|AL049591.12|HSJ878I13 Human DNA sequence from clone RP5-878I13 on chromosome Xq23-25 Contains an alpha tubulin pseudogene, complete sequence Length = 122400 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 56 aaaatggaacaactgatatgcaca 79 ||||||||||||||||| |||||| Sbjct: 113972 aaaatggaacaactgatttgcaca 113995
>gb|AC021224.7|AC021224 Homo sapiens chromosome 18, clone RP11-158N19, complete sequence Length = 151794 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 230 agccaggtgagatttcacat 249 |||||||||||||||||||| Sbjct: 59283 agccaggtgagatttcacat 59302
>gb|AY833325.1| Scorpaenichthys marmoratus ATPase 8 (ATP8) gene, complete cds; and ATPase 6 (ATP6) gene, partial cds; mitochondrial Length = 841 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY116339.1| Triglopsis quadricornis ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 837 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AY116308.1| Malacocottus zonurus ATPase 8 gene, complete cds; and ATPase 6 gene, partial cds; mitochondrial genes for mitochondrial products Length = 841 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 29 ttgcaatcctagtcttttca 48
>gb|AE001439.1| Helicobacter pylori J99, complete genome Length = 1643831 Score = 40.1 bits (20), Expect = 6.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 197 caaaatcgttgtgcatgctaaagc 220 ||||||| |||||||||||||||| Sbjct: 992030 caaaatctttgtgcatgctaaagc 992053
>gb|AC092479.16| Mus musculus strain C57BL/6J chromosome 3 clone rp23-231l15, complete sequence Length = 142159 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 atttgacaaaatggaacaac 68 |||||||||||||||||||| Sbjct: 61986 atttgacaaaatggaacaac 61967
>gb|AC093317.22| Mus musculus strain C57BL/6J chromosome 3 clone rp23-218k6, complete sequence Length = 214004 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 atttgacaaaatggaacaac 68 |||||||||||||||||||| Sbjct: 201231 atttgacaaaatggaacaac 201212
>dbj|AP004449.1| Enedrias crassispina mitochondrial DNA, complete genome Length = 16522 Score = 40.1 bits (20), Expect = 6.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 391 ttgcaatcctagtcttttca 410 |||||||||||||||||||| Sbjct: 7985 ttgcaatcctagtcttttca 8004 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,568,503 Number of Sequences: 3902068 Number of extensions: 3568503 Number of successful extensions: 73177 Number of sequences better than 10.0: 26 Number of HSP's better than 10.0 without gapping: 26 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 73130 Number of HSP's gapped (non-prelim): 47 length of query: 460 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 438 effective length of database: 17,147,199,772 effective search space: 7510473500136 effective search space used: 7510473500136 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)