| Clone Name | rbastl40a02 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL606589.3|OSJN00021 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0008A08, complete sequence Length = 130521 Score = 61.9 bits (31), Expect = 1e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 160 tcgtattggtaatccaccaataaccgcccaatcatatacactctaca 206 |||||||| ||||||||||| || |||||||||||||||||||||| Sbjct: 80082 tcgtattgataatccaccaacaattgcccaatcatatacactctaca 80036
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 61.9 bits (31), Expect = 1e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 160 tcgtattggtaatccaccaataaccgcccaatcatatacactctaca 206 |||||||| ||||||||||| || |||||||||||||||||||||| Sbjct: 15893517 tcgtattgataatccaccaacaattgcccaatcatatacactctaca 15893471
>emb|AL670230.12| Mouse DNA sequence from clone RP23-15D12 on chromosome X, complete sequence Length = 207966 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 219 agctataagagaacttggggac 240 |||||||||||||||||||||| Sbjct: 110822 agctataagagaacttggggac 110843
>gb|AC023794.37| Homo sapiens 12 BAC RP11-834C11 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 198488 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 251 caaagggctcatttaacaaat 271 ||||||||||||||||||||| Sbjct: 98002 caaagggctcatttaacaaat 97982
>emb|AL390732.10| Human DNA sequence from clone RP11-439N12 on chromosome 9 Contains a novel gene similar to mouse 9130404H11Rik protein, the CER1 gene for cerberus 1 homolog, cysteine knot superfamily (Xenopus laevis) and the 3' end of a novel gene (FLJ25416), complete sequence Length = 143246 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 313 catcataacaagtgtgtagt 332 |||||||||||||||||||| Sbjct: 101867 catcataacaagtgtgtagt 101848
>emb|BX255965.12| Zebrafish DNA sequence from clone CH211-270C19, complete sequence Length = 148298 Score = 40.1 bits (20), Expect = 5.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 112 atggattcactgaatcctgcaacg 135 |||| ||||||||||||||||||| Sbjct: 51228 atggcttcactgaatcctgcaacg 51205
>gb|AC156016.2| Mus musculus BAC clone RP24-320A12 from chromosome 14, complete sequence Length = 154465 Score = 40.1 bits (20), Expect = 5.1 Identities = 20/20 (100%) Strand = Plus / Minus Query: 349 gcaccacccataaacaaata 368 |||||||||||||||||||| Sbjct: 96052 gcaccacccataaacaaata 96033 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,933,318 Number of Sequences: 3902068 Number of extensions: 2933318 Number of successful extensions: 86128 Number of sequences better than 10.0: 7 Number of HSP's better than 10.0 without gapping: 7 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 86106 Number of HSP's gapped (non-prelim): 22 length of query: 379 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 357 effective length of database: 17,147,199,772 effective search space: 6121550318604 effective search space used: 6121550318604 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)