| Clone Name | rbastl23b07 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL512363.11| Human DNA sequence from clone RP11-524H19 on chromosome 6 Contains the 3' end of transforming protein P21A (K-RAS) (C-K-RAS) pseudogene, a novel gene, the 5' end of the gene for a novel protein and a CpG island, complete sequence Length = 113075 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 150 aaagttacaagaacaaatgaat 171 |||||||||||||||||||||| Sbjct: 5392 aaagttacaagaacaaatgaat 5371
>emb|AL591711.22| Mouse DNA sequence from clone RP23-19L12 on chromosome 2, complete sequence Length = 197743 Score = 44.1 bits (22), Expect = 0.17 Identities = 22/22 (100%) Strand = Plus / Minus Query: 81 acacatatgtactgataataat 102 |||||||||||||||||||||| Sbjct: 118819 acacatatgtactgataataat 118798
>gb|AC158949.6| Mus musculus chromosome 7, clone RP23-305I23, complete sequence Length = 159999 Score = 42.1 bits (21), Expect = 0.66 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 aggatatattccaacacatat 88 ||||||||||||||||||||| Sbjct: 61272 aggatatattccaacacatat 61252
>gb|AC110551.9| Mus musculus chromosome 7, clone RP23-245P16, complete sequence Length = 155691 Score = 42.1 bits (21), Expect = 0.66 Identities = 21/21 (100%) Strand = Plus / Minus Query: 68 aggatatattccaacacatat 88 ||||||||||||||||||||| Sbjct: 113432 aggatatattccaacacatat 113412
>gb|AC159244.4| Mus musculus BAC clone RP24-309L4 from chromosome 12, complete sequence Length = 216500 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 gatgagaactgtaccagctt 38 |||||||||||||||||||| Sbjct: 92740 gatgagaactgtaccagctt 92721
>ref|XM_774264.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_165_15468_21509) partial mRNA Length = 6042 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 ccaacacatatgtactgata 97 |||||||||||||||||||| Sbjct: 3663 ccaacacatatgtactgata 3682
>gb|AC067940.5| Homo sapiens BAC clone RP11-818E9 from 2, complete sequence Length = 148267 Score = 40.1 bits (20), Expect = 2.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 83 acatatgtactgataataat 102 |||||||||||||||||||| Sbjct: 98980 acatatgtactgataataat 98999 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,978,385 Number of Sequences: 3902068 Number of extensions: 1978385 Number of successful extensions: 139342 Number of sequences better than 10.0: 7 Number of HSP's better than 10.0 without gapping: 7 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 139329 Number of HSP's gapped (non-prelim): 13 length of query: 206 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 184 effective length of database: 17,147,199,772 effective search space: 3155084758048 effective search space used: 3155084758048 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)