| Clone Name | rbastl04e05 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_467482.1| Oryza sativa (japonica cultivar-group), mRNA Length = 4672 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 307 tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366 |||||||| ||||||||| || ||||||||||||| |||||| || | ||||||||||| Sbjct: 4408 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 4349 Query: 367 tgg 369 ||| Sbjct: 4348 tgg 4346
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 307 tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366 |||||||| ||||||||| || ||||||||||||| |||||| || | ||||||||||| Sbjct: 29782379 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 29782438 Query: 367 tgg 369 ||| Sbjct: 29782439 tgg 29782441
>dbj|AP004098.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ2056_H01 Length = 123428 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 307 tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366 |||||||| ||||||||| || ||||||||||||| |||||| || | ||||||||||| Sbjct: 38724 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 38783 Query: 367 tgg 369 ||| Sbjct: 38784 tgg 38786
>dbj|AP004047.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1191_G08 Length = 172832 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Plus Query: 307 tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366 |||||||| ||||||||| || ||||||||||||| |||||| || | ||||||||||| Sbjct: 151358 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 151417 Query: 367 tgg 369 ||| Sbjct: 151418 tgg 151420
>dbj|AK121612.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033043J17, full insert sequence Length = 4673 Score = 61.9 bits (31), Expect = 1e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 307 tttctatgccttctgcttcgacttctgcttcttcagctccaatgacgcacctaatcctac 366 |||||||| ||||||||| || ||||||||||||| |||||| || | ||||||||||| Sbjct: 4409 tttctatgacttctgctttgatttctgcttcttcaactccaaggaagtccctaatcctac 4350 Query: 367 tgg 369 ||| Sbjct: 4349 tgg 4347
>ref|XM_719537.1| Plasmodium yoelii yoelii str. 17XNL splicing factor 1 (PY04347) partial mRNA Length = 930 Score = 46.1 bits (23), Expect = 0.085 Identities = 23/23 (100%) Strand = Plus / Minus Query: 316 cttctgcttcgacttctgcttct 338 ||||||||||||||||||||||| Sbjct: 707 cttctgcttcgacttctgcttct 685
>gb|U40412.1| Caenorhabditis elegans cosmid F46G11, complete sequence Length = 21731 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 156 tattatttttattgcactcattctac 181 ||||||||||| |||||||||||||| Sbjct: 549 tattatttttaatgcactcattctac 574
>gb|CP000016.1| Candidatus Blochmannia pennsylvanicus str. BPEN, complete genome Length = 791654 Score = 44.1 bits (22), Expect = 0.34 Identities = 25/26 (96%) Strand = Plus / Plus Query: 35 aaacaaattggtgtagccagtttaca 60 |||||||||||||||| ||||||||| Sbjct: 430558 aaacaaattggtgtagtcagtttaca 430583
>gb|AC160248.6| Pan troglodytes BAC clone CH251-541A22 from chromosome unknown, complete sequence Length = 182426 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 300 aaattcatttctatgccttct 320 ||||||||||||||||||||| Sbjct: 154173 aaattcatttctatgccttct 154193
>gb|AC124450.3| Mus musculus BAC clone RP24-215C4 from chromosome 13, complete sequence Length = 157531 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 184 acccccaccccaccacaaataaaat 208 |||||||||||||| |||||||||| Sbjct: 75543 acccccaccccaccccaaataaaat 75519
>gb|AC008883.6| Homo sapiens chromosome 5 clone CTD-2215E18, complete sequence Length = 127144 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 300 aaattcatttctatgccttct 320 ||||||||||||||||||||| Sbjct: 24397 aaattcatttctatgccttct 24377
>gb|AC009232.3| Homo sapiens BAC clone RP11-352J11 from 2, complete sequence Length = 139885 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 282 ggagaaaacagccattgcaaa 302 ||||||||||||||||||||| Sbjct: 136563 ggagaaaacagccattgcaaa 136583
>emb|AL805937.11| Mouse DNA sequence from clone RP23-139B4 on chromosome X, complete sequence Length = 178671 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 316 cttctgcttcgacttctgcttcttc 340 |||||||||| |||||||||||||| Sbjct: 110719 cttctgcttctacttctgcttcttc 110695
>gb|AC183673.2| Pan troglodytes BAC clone CH251-540O10 from chromosome 1, complete sequence Length = 185717 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cattgcaaattcatttctat 313 |||||||||||||||||||| Sbjct: 132269 cattgcaaattcatttctat 132250
>gb|M98552.2| Caenorhabditis elegans cosmid ZK370, complete sequence Length = 38725 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 327 acttctgcttcttcagctcc 346 |||||||||||||||||||| Sbjct: 26479 acttctgcttcttcagctcc 26498
>gb|AC073958.4| Homo sapiens BAC clone RP11-533L22 from 7, complete sequence Length = 168991 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 gttgctattatttttattgc 170 |||||||||||||||||||| Sbjct: 57850 gttgctattatttttattgc 57869
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome Length = 3059876 Score = 40.1 bits (20), Expect = 5.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 319 ctgcttcgacttctgcttcttcag 342 ||||||||||||||||||| |||| Sbjct: 157575 ctgcttcgacttctgcttcgtcag 157598
>emb|AL627143.13| Human DNA sequence from clone RP11-14O9 on chromosome X Contains the 3' end of the RP2 gene for retinitis pigmentosa 2 (X-linked recessive), a novel gene, the 5' end of a novel gene (KIAA0215) and a CpG island, complete sequence Length = 81195 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 gttgctattatttttattgc 170 |||||||||||||||||||| Sbjct: 19804 gttgctattatttttattgc 19785
>emb|AL139188.14| Human DNA sequence from clone RP11-90M5 on chromosome 13q12.11-12.3 Contains 2 novel genes, a translocase of inner mitochondrial membrane 8 (yeast) homolog B (TIMM8B) pseudogene, the 5' end of the UBL3 gene for ubiquitin-like 3 and a CpG island, complete sequence Length = 161538 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 301 aattcatttctatgccttct 320 |||||||||||||||||||| Sbjct: 126376 aattcatttctatgccttct 126395
>emb|AL137789.11| Human DNA sequence from clone RP11-57I17 on chromosome 1q32.1-32.3 Contains the 3' end of the CR1 gene for complement component (3b/4b) receptor 1, including Knops blood group system, a membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen) (MCP) pseudogene and the 5' end of the CR1L gene for complement component (3b/4b) receptor 1-like, complete sequence Length = 145325 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cattgcaaattcatttctat 313 |||||||||||||||||||| Sbjct: 60309 cattgcaaattcatttctat 60290
>emb|AL590445.1|CNS07EGC chromosome V of strain GB-M1 of Encephalitozoon cuniculi (Microspora) Length = 211018 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 139 caccccattctcgttgctat 158 |||||||||||||||||||| Sbjct: 20081 caccccattctcgttgctat 20062
>gb|AC016644.9| Homo sapiens chromosome 5 clone RP11-52M14, complete sequence Length = 157751 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ctagaggttcaaaattgcaa 281 |||||||||||||||||||| Sbjct: 41334 ctagaggttcaaaattgcaa 41315
>gb|AC008937.7| Homo sapiens chromosome 5 clone CTD-2310F14, complete sequence Length = 171480 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ctagaggttcaaaattgcaa 281 |||||||||||||||||||| Sbjct: 277 ctagaggttcaaaattgcaa 258
>gb|AC161621.5| Pan troglodytes BAC clone CH251-164P18 from chromosome unknown, complete sequence Length = 172032 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ctagaggttcaaaattgcaa 281 |||||||||||||||||||| Sbjct: 121151 ctagaggttcaaaattgcaa 121132
>gb|AC010364.6| Homo sapiens chromosome 5 clone CTD-2042D5, complete sequence Length = 163400 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cattgcaaattcatttctat 313 |||||||||||||||||||| Sbjct: 4638 cattgcaaattcatttctat 4619
>gb|AC007822.4|AC007822 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone BACR02E04, complete sequence Length = 157607 Score = 40.1 bits (20), Expect = 5.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 319 ctgcttcgacttctgcttcttcagctcc 346 |||| ||| ||||||||||||||||||| Sbjct: 35376 ctgcatcggcttctgcttcttcagctcc 35349
>gb|AC007770.5|AC007770 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone BACR03J13, complete sequence Length = 179260 Score = 40.1 bits (20), Expect = 5.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 319 ctgcttcgacttctgcttcttcagctcc 346 |||| ||| ||||||||||||||||||| Sbjct: 163160 ctgcatcggcttctgcttcttcagctcc 163133
>gb|AC008235.4|AC008235 Drosophila melanogaster, chromosome 3R, region 94F-95A, BAC clone BACR15B19, complete sequence Length = 175669 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 296 ttgcaaattcatttctatgc 315 |||||||||||||||||||| Sbjct: 65130 ttgcaaattcatttctatgc 65111
>gb|AC009507.3| Homo sapiens BAC clone RP11-543L11 from 2, complete sequence Length = 122213 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 cccccaccccaccacaaata 204 |||||||||||||||||||| Sbjct: 26226 cccccaccccaccacaaata 26207
>gb|AC010450.6|AC010450 Homo sapiens chromosome 5 clone CTD-2242D16, complete sequence Length = 108916 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 cattgcaaattcatttctat 313 |||||||||||||||||||| Sbjct: 67858 cattgcaaattcatttctat 67839
>gb|AC092623.2| Homo sapiens BAC clone RP11-260E12 from 2, complete sequence Length = 172344 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 183 aacccccaccccaccacaaa 202 |||||||||||||||||||| Sbjct: 16323 aacccccaccccaccacaaa 16304
>gb|AY103753.1| Zea mays PCO143558 mRNA sequence Length = 2771 Score = 40.1 bits (20), Expect = 5.3 Identities = 38/44 (86%) Strand = Plus / Minus Query: 307 tttctatgccttctgcttcgacttctgcttcttcagctccaatg 350 |||||| | ||| ||||| || ||||||||||||| |||||||| Sbjct: 2436 tttctacgacttttgctttgatttctgcttcttcaactccaatg 2393
>gb|AE003743.3| Drosophila melanogaster chromosome 3R, section 81 of 118 of the complete sequence Length = 210258 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 296 ttgcaaattcatttctatgc 315 |||||||||||||||||||| Sbjct: 73436 ttgcaaattcatttctatgc 73417
>gb|AE003687.3| Drosophila melanogaster chromosome 3R, section 25 of 118 of the complete sequence Length = 260168 Score = 40.1 bits (20), Expect = 5.3 Identities = 26/28 (92%) Strand = Plus / Minus Query: 319 ctgcttcgacttctgcttcttcagctcc 346 |||| ||| ||||||||||||||||||| Sbjct: 216336 ctgcatcggcttctgcttcttcagctcc 216309
>gb|AC006406.1|AC006406 Homo sapiens, clone hRPK.25_A_1, complete sequence Length = 159115 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 cattgcaaattcatttctat 313 |||||||||||||||||||| Sbjct: 158193 cattgcaaattcatttctat 158212
>gb|AC163725.4| Pan troglodytes BAC clone CH251-612A20 from chromosome unknown, complete sequence Length = 179999 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 262 ctagaggttcaaaattgcaa 281 |||||||||||||||||||| Sbjct: 4802 ctagaggttcaaaattgcaa 4783
>emb|AL671891.12| Mouse DNA sequence from clone RP23-405E21 on chromosome X, complete sequence Length = 195749 Score = 40.1 bits (20), Expect = 5.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 161 tttttattgcactcattcta 180 |||||||||||||||||||| Sbjct: 188535 tttttattgcactcattcta 188516 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,271,963 Number of Sequences: 3902068 Number of extensions: 5271963 Number of successful extensions: 124625 Number of sequences better than 10.0: 37 Number of HSP's better than 10.0 without gapping: 37 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 124501 Number of HSP's gapped (non-prelim): 124 length of query: 393 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 371 effective length of database: 17,147,199,772 effective search space: 6361611115412 effective search space used: 6361611115412 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)