| Clone Name | rbastl04a04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC115709.11| Mus musculus chromosome 12, clone RP23-76M3, complete sequence Length = 193170 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 aatccaacatggttccaacat 53 ||||||||||||||||||||| Sbjct: 121031 aatccaacatggttccaacat 121011
>emb|BX830450.1|CNS0A25Z Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB82ZD12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1733 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 332 gctcttctcaggcttgctctc 352 ||||||||||||||||||||| Sbjct: 1402 gctcttctcaggcttgctctc 1422
>emb|CR974583.24| Mouse DNA sequence from clone RP23-118G7 on chromosome 12, complete sequence Length = 219072 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 33 aatccaacatggttccaacat 53 ||||||||||||||||||||| Sbjct: 115812 aatccaacatggttccaacat 115792
>gb|AC131728.4| Mus musculus BAC clone RP23-122G5 from chromosome 5, complete sequence Length = 211796 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 449 tcatcaggaggacccagcag 468 |||||||||||||||||||| Sbjct: 38088 tcatcaggaggacccagcag 38107
>gb|AC156557.8| Mus musculus chromosome 7, clone RP23-321F8, complete sequence Length = 209053 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 tgcactccattcctggaagg 107 |||||||||||||||||||| Sbjct: 113931 tgcactccattcctggaagg 113912
>gb|AC113295.5| Mus musculus chromosome 5, clone RP23-424M12, complete sequence Length = 239105 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 449 tcatcaggaggacccagcag 468 |||||||||||||||||||| Sbjct: 233760 tcatcaggaggacccagcag 233779
>dbj|AB011482.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2 Length = 83478 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 166 gatccgcaaaatatacatcttttc 189 ||||||||||||||| |||||||| Sbjct: 36461 gatccgcaaaatataaatcttttc 36438
>gb|AF163823.1|AF163823 Arabidopsis thaliana endoxyloglucan transferase (XTR3) gene, complete cds Length = 2703 Score = 40.1 bits (20), Expect = 6.4 Identities = 23/24 (95%) Strand = Plus / Plus Query: 166 gatccgcaaaatatacatcttttc 189 ||||||||||||||| |||||||| Sbjct: 1982 gatccgcaaaatataaatcttttc 2005
>emb|AL391261.3|CNS06C85 Human chromosome 14 DNA sequence BAC C-2014B16 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 162144 Score = 40.1 bits (20), Expect = 6.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 441 tgcccttttcatcaggagga 460 |||||||||||||||||||| Sbjct: 69463 tgcccttttcatcaggagga 69444 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,883,607 Number of Sequences: 3902068 Number of extensions: 3883607 Number of successful extensions: 64262 Number of sequences better than 10.0: 9 Number of HSP's better than 10.0 without gapping: 9 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 64245 Number of HSP's gapped (non-prelim): 17 length of query: 472 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 450 effective length of database: 17,147,199,772 effective search space: 7716239897400 effective search space used: 7716239897400 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)