| Clone Name | rbastl02d06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY657321.1| Synthetic construct Peudomonas aeruginosa clone FLH043437.01F PA1870 gene, partial cds Length = 426 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 245 acgatggttaccagcataacgtcg 268 |||||||||||||| ||||||||| Sbjct: 206 acgatggttaccaggataacgtcg 229
>emb|AL157363.9| Human DNA sequence from clone RP11-268K3 on chromosome 13 Contains the 3' end of the GPC5 gene for glypican 5, complete sequence Length = 164732 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 311 cctaggatgctggtccaaga 330 |||||||||||||||||||| Sbjct: 163261 cctaggatgctggtccaaga 163280
>emb|BX530073.9| Zebrafish DNA sequence from clone CH211-201D22 in linkage group 21, complete sequence Length = 47127 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 128 cacaagtagtgttgcttcag 147 |||||||||||||||||||| Sbjct: 20711 cacaagtagtgttgcttcag 20692
>gb|AC091894.2| Homo sapiens chromosome 5 clone RP11-138J23, complete sequence Length = 175552 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 122 atactgcacaagtagtgttgcttc 145 |||||||||| ||||||||||||| Sbjct: 154242 atactgcacatgtagtgttgcttc 154265
>gb|AC010588.8| Homo sapiens chromosome 5 clone CTC-409M18, complete sequence Length = 131689 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 122 atactgcacaagtagtgttgcttc 145 |||||||||| ||||||||||||| Sbjct: 123449 atactgcacatgtagtgttgcttc 123426
>gb|AE004613.1| Pseudomonas aeruginosa PAO1, section 174 of 529 of the complete genome Length = 20342 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 245 acgatggttaccagcataacgtcg 268 |||||||||||||| ||||||||| Sbjct: 3990 acgatggttaccaggataacgtcg 4013
>gb|AC154123.9| Mus musculus chromosome 5, clone RP24-324D14, complete sequence Length = 175751 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 catcctgcctcctgtcaatg 239 |||||||||||||||||||| Sbjct: 105908 catcctgcctcctgtcaatg 105889
>gb|AC113082.6| Mus musculus chromosome 9, clone RP23-291C4, complete sequence Length = 218087 Score = 40.1 bits (20), Expect = 5.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 172 tttgcgtgtacctcaaacgttgtc 195 |||||||||||||||||| ||||| Sbjct: 170000 tttgcgtgtacctcaaacattgtc 169977
>gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, complete sequence Length = 2914771 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 352 gtgcgcttgagcgccggatg 371 |||||||||||||||||||| Sbjct: 2765221 gtgcgcttgagcgccggatg 2765240
>emb|AL671925.4| Mouse DNA sequence from clone RP23-236O21 on chromosome 4, complete sequence Length = 218429 Score = 40.1 bits (20), Expect = 5.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 2 catctgaactaaaacatttc 21 |||||||||||||||||||| Sbjct: 80816 catctgaactaaaacatttc 80797 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,076,446 Number of Sequences: 3902068 Number of extensions: 3076446 Number of successful extensions: 51727 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 51703 Number of HSP's gapped (non-prelim): 24 length of query: 417 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 395 effective length of database: 17,147,199,772 effective search space: 6773143909940 effective search space used: 6773143909940 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)