| Clone Name | rbastl01g08 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC090527.3|AC090527 Homo sapiens chromosome 15 clone RP11-96O20 map 15q21.1, complete sequence Length = 173585 Score = 44.1 bits (22), Expect = 0.32 Identities = 28/30 (93%) Strand = Plus / Plus Query: 285 catggtataatctcatcctcattcagatct 314 |||||| ||||||||||||| ||||||||| Sbjct: 29343 catggtttaatctcatcctccttcagatct 29372
>emb|AL138787.11| Human DNA sequence from clone RP4-665N4 on chromosome 1p34.1-35.3 Contains the 3' end of the EIF2C3 gene for eukaryotic translation initiation factor 2C, 3, a putative novel transcript, a implantation-associated protein (DKFZp564K142) processed pseudogene, the TEKT2 gene for tektin 2 (testicular), the COL8A2 gene for collagen, type VIII, alpha 2, complete sequence Length = 128133 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 47 tacaaaaaatgtcaaaattag 67 ||||||||||||||||||||| Sbjct: 75058 tacaaaaaatgtcaaaattag 75078
>emb|AJ557546.1|MLI557546 Melittangium lichenicola melithiazol gene cluster Length = 51855 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 139 gccagcgcgtccccacgggca 159 ||||||||||||||||||||| Sbjct: 7948 gccagcgcgtccccacgggca 7968
>emb|CT485797.2| Medicago truncatula chromosome 5 clone mth4-11a3, COMPLETE SEQUENCE Length = 211224 Score = 42.1 bits (21), Expect = 1.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 40 tgcaacatacaaaaaatgtcaaaat 64 ||||||||| ||||||||||||||| Sbjct: 157807 tgcaacatataaaaaatgtcaaaat 157831
>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome Length = 2201561 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 46 atacaaaaaatgtcaaaatt 65 |||||||||||||||||||| Sbjct: 88329 atacaaaaaatgtcaaaatt 88348
>gb|AC155711.14| Mus musculus 10 BAC RP24-189K8 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 183897 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 aaaggatgggcagagaggaa 179 |||||||||||||||||||| Sbjct: 10149 aaaggatgggcagagaggaa 10130
>emb|CR974468.5| Pig DNA sequence from clone PigE-178B21 on chromosome 7, complete sequence Length = 120695 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 274 acattttccaacatggtata 293 |||||||||||||||||||| Sbjct: 69335 acattttccaacatggtata 69354
>gb|AC153517.8| Mus musculus 10 BAC RP23-22E18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 203981 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 aaaggatgggcagagaggaa 179 |||||||||||||||||||| Sbjct: 103870 aaaggatgggcagagaggaa 103889
>ref|XM_682242.1| PREDICTED: Danio rerio similar to establishment of cohesion 1 homolog 1 (LOC558949), mRNA Length = 2067 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 340 gactgtttttgtcctctttc 359 |||||||||||||||||||| Sbjct: 1333 gactgtttttgtcctctttc 1314
>emb|BX088586.8| Zebrafish DNA sequence from clone CH211-200H21 in linkage group 15, complete sequence Length = 159471 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 44 acatacaaaaaatgtcaaaa 63 |||||||||||||||||||| Sbjct: 22619 acatacaaaaaatgtcaaaa 22638
>gb|AC099811.7| Homo sapiens chromosome 17, clone RP11-358B23, complete sequence Length = 174902 Score = 40.1 bits (20), Expect = 5.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 41 gcaacatacaaaaaatgtcaaaattaga 68 |||||||||||||||| | ||||||||| Sbjct: 81277 gcaacatacaaaaaatttaaaaattaga 81304
>gb|AC150680.7| Monodelphis domestica, clone XX-28D5, complete sequence Length = 154058 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 166 tgggcagagaggaactggtg 185 |||||||||||||||||||| Sbjct: 131216 tgggcagagaggaactggtg 131197
>dbj|D49696.1|NILIZUMOD Nilaparvata lugens reovirus genome segment S4, complete sequence encoding 130KD protein (complete cds) Length = 3560 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 ttgtttgcaacatacaaaaa 54 |||||||||||||||||||| Sbjct: 2409 ttgtttgcaacatacaaaaa 2428
>gb|AC150274.2| Mus musculus BAC clone RP23-348G11 from 18, complete sequence Length = 194318 Score = 40.1 bits (20), Expect = 5.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 245 acttgtgtcttccaaatcta 264 |||||||||||||||||||| Sbjct: 62747 acttgtgtcttccaaatcta 62766 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,602,347 Number of Sequences: 3902068 Number of extensions: 3602347 Number of successful extensions: 65551 Number of sequences better than 10.0: 14 Number of HSP's better than 10.0 without gapping: 14 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 65516 Number of HSP's gapped (non-prelim): 35 length of query: 374 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 352 effective length of database: 17,147,199,772 effective search space: 6035814319744 effective search space used: 6035814319744 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)