>gb|AC164701.4| Mus musculus BAC clone RP24-108J12 from chromosome 17, complete sequence
          Length = 184296

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 74     aagaacttgctagcctctctg 94
              |||||||||||||||||||||
Sbjct: 111832 aagaacttgctagcctctctg 111852

>gb|AC121945.2| Mus musculus BAC clone RP24-211I4 from 17, complete sequence
          Length = 157262

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 74    aagaacttgctagcctctctg 94
             |||||||||||||||||||||
Sbjct: 43024 aagaacttgctagcctctctg 43044

>emb|AL158831.15| Human DNA sequence from clone RP11-564A4 on chromosome 9, complete
              sequence
          Length = 162700

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1      gagttttctaaccatcggtaa 21
              |||||||||||||||||||||
Sbjct: 159126 gagttttctaaccatcggtaa 159146

>ref|XM_823156.1| Trypanosoma brucei TREU927 TatD related deoxyribonuclease
           (Tb11.55.0020) partial mRNA
          Length = 1155

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 89  tctctgccgtcgctatcca 107
           |||||||||||||||||||
Sbjct: 288 tctctgccgtcgctatcca 306

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 2       agttttctaaccatcggta 20
               |||||||||||||||||||
Sbjct: 1845961 agttttctaaccatcggta 1845979

>emb|AL513211.15| Human DNA sequence from clone RP13-476E20 on chromosome 6 Contains a
             novel gene, the 5' end of the LRRC1 gene for leucine rich
             repeat containing 1 and a CpG island, complete sequence
          Length = 126228

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 39    actcgtccaagtttacaca 57
             |||||||||||||||||||
Sbjct: 86087 actcgtccaagtttacaca 86069

>gb|AC116861.27| Mus musculus chromosome 8, clone RP24-407N9, complete sequence
          Length = 173343

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 73     gaagaacttgctagcctct 91
              |||||||||||||||||||
Sbjct: 117532 gaagaacttgctagcctct 117514

>gb|AE017126.1| Prochlorococcus marinus subsp. marinus str. CCMP1375 complete genome
          Length = 1751080

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 116    atcgccatgccatgcatga 134
              |||||||||||||||||||
Sbjct: 905515 atcgccatgccatgcatga 905497


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 686,978
Number of Sequences: 3902068
Number of extensions: 686978
Number of successful extensions: 42021
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41984
Number of HSP's gapped (non-prelim): 37
length of query: 139
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 118
effective length of database: 17,151,101,840
effective search space: 2023830017120
effective search space used: 2023830017120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)