>gb|AC182700.2| Populus trichocarpa clone Pop1-73H20, complete sequence
          Length = 90044

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacacacattgaaaccatca 90
             ||||||||||||||||||||
Sbjct: 84383 cacacacattgaaaccatca 84402



 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    cacacacattgaaaccatca 90
             ||||||||||||||||||||
Sbjct: 76631 cacacacattgaaaccatca 76650

>ref|XM_534067.2| PREDICTED: Canis familiaris similar to Spondin-1 precursor
           (F-spondin) (Vascular smooth muscle cell growth
           promoting factor) (LOC476864), mRNA
          Length = 2659

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 232 cgtgccgccgtcacgcgacgccgg 255
           |||||||||| |||||||||||||
Sbjct: 104 cgtgccgccgccacgcgacgccgg 81

>gb|AC122923.4| Mus musculus BAC clone RP23-36G5 from 10, complete sequence
          Length = 242112

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 134   ttcagtgccccggtgctgga 153
             ||||||||||||||||||||
Sbjct: 66380 ttcagtgccccggtgctgga 66399

>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence
          Length = 3288558

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 185    tgatcacgctagcacttctt 204
              ||||||||||||||||||||
Sbjct: 120655 tgatcacgctagcacttctt 120674

>gb|AC079681.38| Mus musculus strain C57BL/6J chromosome 10 clone rp23-310n21, complete
              sequence
          Length = 216807

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    ttcagtgccccggtgctgga 153
              ||||||||||||||||||||
Sbjct: 203119 ttcagtgccccggtgctgga 203138


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,728,509
Number of Sequences: 3902068
Number of extensions: 1728509
Number of successful extensions: 52564
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52547
Number of HSP's gapped (non-prelim): 17
length of query: 262
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 240
effective length of database: 17,147,199,772
effective search space: 4115327945280
effective search space used: 4115327945280
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)