>gb|AY701776.1| Triticum aestivum auxin amidohydrolase mRNA, complete cds
          Length = 1788

 Score =  123 bits (62), Expect = 3e-25
 Identities = 83/90 (92%)
 Strand = Plus / Minus

                                                                        
Query: 138  tcacaaggtcatctgctcgcttgtaaggcactgaaatcaggaaaccatgtacagacagtt 197
            ||||||||||||||||||||||| || || ||||||||||||||  ||||||| ||||||
Sbjct: 1558 tcacaaggtcatctgctcgcttggaatgcgctgaaatcaggaaattatgtacaaacagtt 1499

                                          
Query: 198  gcataatcacccggcgatacagaggtcctc 227
            ||||||||||| ||||||||||||||||||
Sbjct: 1498 gcataatcacctggcgatacagaggtcctc 1469



 Score = 60.0 bits (30), Expect = 4e-06
 Identities = 66/77 (85%), Gaps = 2/77 (2%)
 Strand = Plus / Minus

                                                                        
Query: 51   actgcactcaaagattacacgta--ctcggctaagggcagatacgaaaacaaacgagacc 108
            |||||||| ||||||||||| ||  | ||| |||| |||||| ||||||| |||||||||
Sbjct: 1655 actgcacttaaagattacacatagacccggataagtgcagatgcgaaaacgaacgagacc 1596

                             
Query: 109  taccacaaaatcacatg 125
            ||||||| || ||||||
Sbjct: 1595 taccacagaaacacatg 1579

>gb|AC145877.3| Pan troglodytes BAC clone RP43-20I7 from 7, complete sequence
          Length = 192794

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 172   aatcaggaaaccatgtacaga 192
             |||||||||||||||||||||
Sbjct: 98928 aatcaggaaaccatgtacaga 98908

>gb|AC009196.14| Homo sapiens chromosome 7 clone RP11-49B7, complete sequence
          Length = 170763

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 172   aatcaggaaaccatgtacaga 192
             |||||||||||||||||||||
Sbjct: 71869 aatcaggaaaccatgtacaga 71889

>gb|AC078844.2|AC078844 Homo sapiens chromosome 7 clone RP11-786M13, complete sequence
          Length = 186927

 Score = 42.1 bits (21), Expect = 0.96
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 172    aatcaggaaaccatgtacaga 192
              |||||||||||||||||||||
Sbjct: 153472 aatcaggaaaccatgtacaga 153492

>emb|AL139289.6| Human DNA sequence from clone RP1-92O14 on chromosome 1p33-34.2
            Contains the 3' end of the TIE gene for tyrosine kinase
            with immunoglobulin and epidermal growth factor homology
            domains, the MPL gene for myeloproliferative leukemia
            virus oncogene, two novel genes, the CDC20 gene for CDC20
            cell division cycle 20 homolog (S. cerevisiae), the
            ELOVL1 gene for elongation of very long chain fatty acids
            (FEN1/Elo2, SUR4/Elo3, yeast)-like 1, the MED8 gene for
            mediator of RNA polymerase II transcription subunit 8
            homolog (yeast) and the 5' end of the gene for a novel
            protein (LOC149469), complete sequence
          Length = 90433

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 4    ggcttcccaatttattctgt 23
            ||||||||||||||||||||
Sbjct: 6298 ggcttcccaatttattctgt 6317

>emb|AL136958.9| Human DNA sequence from clone RP11-147L20 on chromosome 13q14.11-14.2
             Contains the ESD gene for esterase D/formylglutathione
             hydrolase, the 3' end of the HTR2A gene for
             5-hydroxytryptamine (serotonin) receptor 2A, the 3' end of
             a variant of gene KIAA1016 and a CpG island, complete
             sequence
          Length = 106317

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 169   tgaaatcaggaaaccatgta 188
             ||||||||||||||||||||
Sbjct: 34038 tgaaatcaggaaaccatgta 34019

>gb|AC093420.2| Homo sapiens chromosome 1 clone RP11-282K6, complete sequence
          Length = 193766

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 4      ggcttcccaatttattctgt 23
              ||||||||||||||||||||
Sbjct: 140278 ggcttcccaatttattctgt 140297


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,178,935
Number of Sequences: 3902068
Number of extensions: 2178935
Number of successful extensions: 40858
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40842
Number of HSP's gapped (non-prelim): 15
length of query: 291
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 269
effective length of database: 17,147,199,772
effective search space: 4612596738668
effective search space used: 4612596738668
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)