ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast75b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC068924.11| Oryza sativa chromosome 10 BAC OSJNBa0026L12 gen... 40 1.9
2gb|AC004561.3| Arabidopsis thaliana chromosome 2 clone F16P2 map... 40 1.9
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 40 1.9
4gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana... 40 1.9
5gb|AC012190.3|T22I11 Arabidopsis thaliana chromosome 1 BAC T22I1... 40 1.9
6gb|AC007887.9|AC007887 Genomic sequence for Arabidopsis thaliana... 40 1.9
7dbj|AB010693.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 1.9
8dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 1.9
9gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 40 1.9
10gb|AC113122.9| Mus musculus chromosome 8, clone RP23-349P4, comp... 38 7.5
11gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete ... 38 7.5
12gb|BC010236.1| Mus musculus tetratricopeptide repeat domain 1, m... 38 7.5
13ref|NM_133795.1| Mus musculus tetratricopeptide repeat domain 1 ... 38 7.5
14gb|AC107531.8| Rattus norvegicus 1 BAC CH230-158N3 (Children's H... 38 7.5
15ref|XM_649361.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 38 7.5
16gb|AC002089.2| Homo sapiens BAC clone CTA-308B22 from 7, complet... 38 7.5
17emb|AL122003.17|HSJ659I19 Human DNA sequence from clone RP4-659I... 38 7.5
18emb|AL663045.7| Mouse DNA sequence from clone RP23-219K7 on chro... 38 7.5
19gb|AC183109.2| Pan troglodytes BAC clone CH251-317D18 from chrom... 38 7.5
20dbj|AK166431.1| Mus musculus mammary gland RCB-0527 Jyg-MC(B) cD... 38 7.5
21dbj|AK170032.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 38 7.5
22dbj|AK170230.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 38 7.5
23dbj|AK077715.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 38 7.5
24gb|AF348157.1|AF348157 Mus musculus putative prostate cancer sus... 38 7.5
25gb|AC138919.2| Homo sapiens chromosome 5 clone RP11-639O24, comp... 38 7.5
26gb|AC139491.2| Homo sapiens chromosome 5 clone RP11-826N14, comp... 38 7.5
27gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H2... 38 7.5
28emb|BX284622.3| Zebrafish DNA sequence from clone DKEY-174P10 in... 38 7.5
29gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome 38 7.5
30emb|AL662862.16| Mouse DNA sequence from clone CT7-139P23 on chr... 38 7.5
31emb|AL645968.6| Mouse DNA sequence from clone DN-25M4 on chromos... 38 7.5
32emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chro... 38 7.5

>gb|AC068924.11| Oryza sativa chromosome 10 BAC OSJNBa0026L12 genomic sequence, complete
             sequence
          Length = 152172

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 87    gtagtactattacaaatggt 106
             ||||||||||||||||||||
Sbjct: 61789 gtagtactattacaaatggt 61808



to top

>gb|AC004561.3| Arabidopsis thaliana chromosome 2 clone F16P2 map ve014, complete
             sequence
          Length = 131743

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 52    cataaggttggaattaatac 71
             ||||||||||||||||||||
Sbjct: 85519 cataaggttggaattaatac 85500



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 87       gtagtactattacaaatggt 106
                ||||||||||||||||||||
Sbjct: 19314592 gtagtactattacaaatggt 19314573



to top

>gb|AC003981.2|AC003981 Genomic sequence for Arabidopsis thaliana BAC F22O13 from chromosome I,
             complete sequence
          Length = 133843

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    cataaggttggaattaatac 71
             ||||||||||||||||||||
Sbjct: 94416 cataaggttggaattaatac 94435



to top

>gb|AC012190.3|T22I11 Arabidopsis thaliana chromosome 1 BAC T22I11 sequence, complete
             sequence
          Length = 68986

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    cataaggttggaattaatac 71
             ||||||||||||||||||||
Sbjct: 59525 cataaggttggaattaatac 59544



to top

>gb|AC007887.9|AC007887 Genomic sequence for Arabidopsis thaliana BAC F15O4 from chromosome I,
             complete sequence
          Length = 158096

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 52    cataaggttggaattaatac 71
             ||||||||||||||||||||
Sbjct: 31351 cataaggttggaattaatac 31332



to top

>dbj|AB010693.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21C13
          Length = 75709

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    cataaggttggaattaatac 71
             ||||||||||||||||||||
Sbjct: 24037 cataaggttggaattaatac 24056



to top

>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16
          Length = 82646

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 52    cataaggttggaattaatac 71
             ||||||||||||||||||||
Sbjct: 24542 cataaggttggaattaatac 24561



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 87       gtagtactattacaaatggt 106
                ||||||||||||||||||||
Sbjct: 19325868 gtagtactattacaaatggt 19325849



to top

>gb|AC113122.9| Mus musculus chromosome 8, clone RP23-349P4, complete sequence
          Length = 203728

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    cacaatagttacttgtagt 91
             |||||||||||||||||||
Sbjct: 75184 cacaatagttacttgtagt 75166



to top

>gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete genome
          Length = 1913428

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 91      tactattacaaatggtggc 109
               |||||||||||||||||||
Sbjct: 1808994 tactattacaaatggtggc 1808976



to top

>gb|BC010236.1| Mus musculus tetratricopeptide repeat domain 1, mRNA (cDNA clone
           MGC:7871 IMAGE:3581904), complete cds
          Length = 1469

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 130 gaagagaggagagcgctaa 148
           |||||||||||||||||||
Sbjct: 420 gaagagaggagagcgctaa 438



to top

>ref|NM_133795.1| Mus musculus tetratricopeptide repeat domain 1 (Ttc1), mRNA
          Length = 1469

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 130 gaagagaggagagcgctaa 148
           |||||||||||||||||||
Sbjct: 420 gaagagaggagagcgctaa 438



to top

>gb|AC107531.8| Rattus norvegicus 1 BAC CH230-158N3 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 173190

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 6      acatatcttatgctcaaatgcac 28
              |||||||||||||| ||||||||
Sbjct: 132353 acatatcttatgctaaaatgcac 132331



to top

>ref|XM_649361.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (53.t00011)
            partial mRNA
          Length = 1761

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                       
Query: 52   cataaggttggaattaatacgcacaat 78
            ||||||||||||| |||||| ||||||
Sbjct: 1561 cataaggttggaaataatacccacaat 1535



to top

>gb|AC002089.2| Homo sapiens BAC clone CTA-308B22 from 7, complete sequence
          Length = 148416

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    aaatgcacgagttcatatt 39
             |||||||||||||||||||
Sbjct: 58086 aaatgcacgagttcatatt 58104



to top

>emb|AL122003.17|HSJ659I19 Human DNA sequence from clone RP4-659I19 on chromosome 1q42.11-42.3
              Contains a chromosome 9 open reading frame 78 (C9orf78)
              pseudogene, a novel gene (MGC13186), the 3' end of a novel
              gene (FLJ11383) and a CpG island, complete sequence
          Length = 155065

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     ttggaataaacacacataa 56
              |||||||||||||||||||
Sbjct: 102926 ttggaataaacacacataa 102944



to top

>emb|AL663045.7| Mouse DNA sequence from clone RP23-219K7 on chromosome 11 Contains the
             Elac2 gene for elaC homolog 2 (E. coli), a novel gene, a
             peroxiredoxin 6 (Prdx6) pseudogene, a novel gene
             (1700086D15Rik), a novel pseudogene, and two CpG islands,
             complete sequence
          Length = 196566

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 85    ttgtagtactattacaaat 103
             |||||||||||||||||||
Sbjct: 13569 ttgtagtactattacaaat 13587



to top

>gb|AC183109.2| Pan troglodytes BAC clone CH251-317D18 from chromosome 5, complete
              sequence
          Length = 169688

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 73     cacaatagttacttgtagt 91
              |||||||||||||||||||
Sbjct: 107643 cacaatagttacttgtagt 107661



to top

>dbj|AK166431.1| Mus musculus mammary gland RCB-0527 Jyg-MC(B) cDNA, RIKEN
           full-length enriched library, clone:G930017N08
           product:tetratricopeptide repeat domain 1, full insert
           sequence
          Length = 1444

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 130 gaagagaggagagcgctaa 148
           |||||||||||||||||||
Sbjct: 427 gaagagaggagagcgctaa 445



to top

>dbj|AK170032.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630011A06
           product:tetratricopeptide repeat domain 1, full insert
           sequence
          Length = 1440

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 130 gaagagaggagagcgctaa 148
           |||||||||||||||||||
Sbjct: 430 gaagagaggagagcgctaa 448



to top

>dbj|AK170230.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630034G09
           product:tetratricopeptide repeat domain 1, full insert
           sequence
          Length = 1439

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 130 gaagagaggagagcgctaa 148
           |||||||||||||||||||
Sbjct: 430 gaagagaggagagcgctaa 448



to top

>dbj|AK077715.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730547M21 product:SIMILAR TO
           TETRATRICOPEPTIDE REPEAT DOMAIN 1, full insert sequence
          Length = 1939

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 130 gaagagaggagagcgctaa 148
           |||||||||||||||||||
Sbjct: 433 gaagagaggagagcgctaa 451



to top

>gb|AF348157.1|AF348157 Mus musculus putative prostate cancer susceptibility protein (Elac2)
             gene, complete cds, alternatively spliced
          Length = 34593

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 85    ttgtagtactattacaaat 103
             |||||||||||||||||||
Sbjct: 19207 ttgtagtactattacaaat 19225



to top

>gb|AC138919.2| Homo sapiens chromosome 5 clone RP11-639O24, complete sequence
          Length = 165870

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 73   cacaatagttacttgtagt 91
            |||||||||||||||||||
Sbjct: 3259 cacaatagttacttgtagt 3277



to top

>gb|AC139491.2| Homo sapiens chromosome 5 clone RP11-826N14, complete sequence
          Length = 186722

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 73    cacaatagttacttgtagt 91
             |||||||||||||||||||
Sbjct: 27508 cacaatagttacttgtagt 27526



to top

>gb|AC008469.4|AC008469 Homo sapiens chromosome 5 clone CTC-365H24, complete sequence
          Length = 104325

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 73    cacaatagttacttgtagt 91
             |||||||||||||||||||
Sbjct: 83740 cacaatagttacttgtagt 83758



to top

>emb|BX284622.3| Zebrafish DNA sequence from clone DKEY-174P10 in linkage group 19,
             complete sequence
          Length = 126451

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 38    ttggaataaacacacataa 56
             |||||||||||||||||||
Sbjct: 32970 ttggaataaacacacataa 32952



to top

>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome
          Length = 1830138

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 91      tactattacaaatggtggc 109
               |||||||||||||||||||
Sbjct: 1728426 tactattacaaatggtggc 1728408



to top

>emb|AL662862.16| Mouse DNA sequence from clone CT7-139P23 on chromosome 3, complete
              sequence
          Length = 120808

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 31     gttcatattggaataaaca 49
              |||||||||||||||||||
Sbjct: 119111 gttcatattggaataaaca 119093



to top

>emb|AL645968.6| Mouse DNA sequence from clone DN-25M4 on chromosome 3, complete sequence
          Length = 161821

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 31     gttcatattggaataaaca 49
              |||||||||||||||||||
Sbjct: 136339 gttcatattggaataaaca 136357



to top

>emb|AL669911.16| Mouse DNA sequence from clone RP23-65G8 on chromosome 11, complete
            sequence
          Length = 205030

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 130  gaagagaggagagcgctaa 148
            |||||||||||||||||||
Sbjct: 8109 gaagagaggagagcgctaa 8091


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,311,062
Number of Sequences: 3902068
Number of extensions: 1311062
Number of successful extensions: 83631
Number of sequences better than 10.0: 32
Number of HSP's better than 10.0 without gapping: 32
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83497
Number of HSP's gapped (non-prelim): 134
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top