ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast73d04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end 361 1e-96
2gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds 355 8e-95
3ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA 349 5e-93
4dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 349 5e-93
5dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D... 349 5e-93
6gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds 349 5e-93
7dbj|AB205017.1| Lolium multiflorum gene for replacement histone ... 343 3e-91
8gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence 331 1e-87
9emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3 329 4e-87
10gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ... 325 7e-86
11gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence 321 1e-84
12gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome... 307 2e-80
13gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome... 307 2e-80
14emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2 307 2e-80
15dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 307 2e-80
16gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 307 2e-80
17gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds 307 2e-80
18gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence 305 6e-80
19emb|X00937.1|TAHI02 Wheat histone H3 gene 303 3e-79
20gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence 299 4e-78
21emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene 299 4e-78
22ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic... 295 6e-77
23ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic... 295 6e-77
24ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro... 295 6e-77
25ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 295 6e-77
26ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 295 6e-77
27emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 295 6e-77
28dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D... 295 6e-77
29dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D... 295 6e-77
30gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet... 295 6e-77
31gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds 295 6e-77
32emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12 295 6e-77
33ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic... 291 1e-75
34emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11 289 4e-75
35dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 289 4e-75
36dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 289 4e-75
37dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 4e-75
38ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 287 2e-74
39emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15 287 2e-74
40emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V 287 2e-74
41gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete... 287 2e-74
42gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds 287 2e-74
43gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds 287 2e-74
44gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds 287 2e-74
45gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds 287 2e-74
46gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds 287 2e-74
47gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com... 287 2e-74
48ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic... 283 2e-73
49ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic... 283 2e-73
50ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 281 9e-73
51emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV 280 4e-72
52ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic... 276 6e-71
53gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome... 276 6e-71
54ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-... 276 6e-71
55dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 276 6e-71
56dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon... 276 6e-71
57emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 274 2e-70
58gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ... 270 4e-69
59ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic... 264 2e-67
60dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 264 2e-67
61emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,... 264 2e-67
62ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo... 262 9e-67
63ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo... 262 9e-67
64gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd... 262 9e-67
65ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 260 3e-66
66gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 260 3e-66
67ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 260 3e-66
68emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 260 3e-66
69dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI... 260 3e-66
70gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and... 260 3e-66
71gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 260 3e-66
72ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge... 260 3e-66
73gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 260 3e-66
74gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG... 260 3e-66
75gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co... 260 3e-66
76ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone... 260 3e-66
77gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl... 260 3e-66
78gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp... 260 3e-66
79gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp... 260 3e-66
80gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 260 3e-66
81gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 260 3e-66
82ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA 260 3e-66
83gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds 260 3e-66
84ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a... 258 1e-65
85ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
86ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
87ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
88ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
89ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
90ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
91ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
92ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
93ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
94ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 258 1e-65
95ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (p... 258 1e-65
96gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-I... 258 1e-65
97gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence 256 5e-65
98ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ... 256 5e-65
99gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I... 254 2e-64
100gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG... 252 8e-64
101ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA 252 8e-64
102emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 252 8e-64
103ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476... 250 3e-63
104gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence 250 3e-63
105ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2a... 250 3e-63
106ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2a... 250 3e-63
107ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2a... 250 3e-63
108ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA 250 3e-63
109emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 250 3e-63
110emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 250 3e-63
111ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, ... 250 3e-63
112gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl... 250 3e-63
113gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds 250 3e-63
114gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com... 250 3e-63
115gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequ... 246 5e-62
116ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 244 2e-61
117ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2a... 244 2e-61
118emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 244 2e-61
119ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA 242 8e-61
120gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 242 8e-61
121emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 242 8e-61
122gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, compl... 242 8e-61
123gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-I... 242 8e-61
124emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3 242 8e-61
125gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds 242 8e-61
126gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 238 1e-59
127ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA 238 1e-59
128gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds 238 1e-59
129ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA 238 1e-59
130gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI... 238 1e-59
131gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA... 238 1e-59
132ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (... 238 1e-59
133gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, co... 238 1e-59
134ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge... 238 1e-59
135ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA 238 1e-59
136gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE... 238 1e-59
137gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete... 238 1e-59
138gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co... 238 1e-59
139gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, compl... 238 1e-59
140emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for h... 236 5e-59
141ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA 234 2e-58
142ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA 234 2e-58
143emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 234 2e-58
144emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 234 2e-58
145emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 234 2e-58
146dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-... 234 2e-58
147gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 234 2e-58
148gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl... 234 2e-58
149gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl... 234 2e-58
150gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, compl... 234 2e-58
151gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histo... 234 2e-58
152gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene 232 8e-58
153ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA 230 3e-57
154ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, fa... 230 3e-57
155ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, fa... 230 3e-57
156ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 230 3e-57
157ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, fa... 230 3e-57
158gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 230 3e-57
159gb|AY125229.1| Argia vivida histone 3 gene, partial cds 230 3e-57
160dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-... 230 3e-57
161gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl... 230 3e-57
162gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 230 3e-57
163gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 230 3e-57
164gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 230 3e-57
165gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds 230 3e-57
166emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA 228 1e-56
167gb|AF361949.1| Eimeria tenella histone 3 (H3) mRNA, complete cds 228 1e-56
168gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ... 228 1e-56
169gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence 228 1e-56
170gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ... 228 1e-56
171gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ... 228 1e-56
172emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3 228 1e-56
173gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, par... 228 1e-56
174ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA 226 5e-56
175gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 226 5e-56
176ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a... 226 5e-56
177ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ... 226 5e-56
178emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene 226 5e-56
179emb|X80325.1|MPMPH315 M.pahari mpH315 gene 226 5e-56
180dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells... 226 5e-56
181gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co... 226 5e-56
182dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-... 226 5e-56
183gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl... 226 5e-56
184ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA 226 5e-56
185gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds 226 5e-56
186emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for hist... 222 7e-55
187emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3 222 7e-55
188emb|X80326.1|MPMPH312 M.pahari mpH312 gene 220 3e-54
189gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence 220 3e-54
190gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, part... 220 3e-54
191ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA 218 1e-53
192ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2a... 218 1e-53
193ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2a... 218 1e-53
194ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2a... 218 1e-53
195ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2a... 218 1e-53
196emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2... 218 1e-53
197ref|NM_001025303.1| Homo sapiens similar to histone H2B histone ... 218 1e-53
198gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 218 1e-53
199gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 218 1e-53
200gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 218 1e-53
201gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl... 218 1e-53
202gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds 212 7e-52
203ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2a... 210 3e-51
204ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 210 3e-51
205gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part... 208 1e-50
206gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, ... 206 4e-50
207ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2a... 204 2e-49
208gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds 204 2e-49
209ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 204 2e-49
210emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 204 2e-49
211gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial... 204 2e-49
212gb|AY555567.1| Heterojapyx sp. GG-2001 histone H3 gene, partial cds 202 7e-49
213gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p... 200 3e-48
214ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 196 4e-47
215ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 196 4e-47
216gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds 196 4e-47
217gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge... 194 2e-46
218ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641 ... 194 2e-46
219ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005 ... 194 2e-46
220ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387 ... 194 2e-46
221ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784 ... 194 2e-46
222gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds 194 2e-46
223gb|AY338621.1| Metretopus borealis histone 3 gene, partial cds 194 2e-46
224gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H... 194 2e-46
225emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 192 7e-46
226emb|CR733515.2|CNS0GSRE Tetraodon nigroviridis full-length cDNA 190 3e-45
227gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, parti... 190 3e-45
228ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 188 1e-44
229ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 188 1e-44
230ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 188 1e-44
231gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds 188 1e-44
232gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds 188 1e-44
233ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus simila... 186 4e-44
234ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 186 4e-44
235gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c... 186 4e-44
236gb|AF093108.1|AF093108 Tortula ruralis histone H3 (rnp49) mRNA, ... 186 4e-44
237gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone... 186 4e-44
238gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds 186 4e-44
239gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, ... 186 4e-44
240gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds 184 2e-43
241gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds 184 2e-43
242gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, par... 184 2e-43
243gb|AY655588.1| Menidia menidia histone H3a gene, partial cds 182 6e-43
244ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus simila... 182 6e-43
245emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ... 182 6e-43
246emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene 182 6e-43
247ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 182 6e-43
248gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, parti... 182 6e-43
249ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic hi... 182 6e-43
250ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 180 3e-42
251dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp... 180 3e-42
252dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp... 180 3e-42
253gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3... 180 3e-42
254gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds 180 3e-42
255emb|X82257.1|DMH33A D.melanogaster mRNA for histone H3.3 variant 178 1e-41
256gb|AY119629.1| Drosophila melanogaster RE21618 full insert cDNA 178 1e-41
257ref|NM_078755.2| Drosophila melanogaster Histone H3.3A CG5825-RA... 178 1e-41
258gb|AY071057.1| Drosophila melanogaster RE14004 full length cDNA 178 1e-41
259gb|AY539178.1| Menidia menidia histone H3 gene, partial cds 178 1e-41
260gb|AY788897.1| Mnais nawai histone 3 gene, partial cds 176 4e-41
261emb|CR541858.1| Homo sapiens full open reading frame cDNA clone ... 176 4e-41
262gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a ge... 174 2e-40
263gb|AY662897.1| Paretroplus cf. kieneri 'Ravelobe' histone H3a ge... 174 2e-40
264gb|AY662895.1| Paretroplus kieneri 'Kinkony' histone H3a gene, p... 174 2e-40
265gb|AY539181.1| Pegasus volitans histone H3 gene, partial cds 174 2e-40
266gb|DQ028108.1| Gazza achlamys histone H3 gene, partial cds 172 6e-40
267gb|DQ028107.1| Gazza achlamys histone H3 gene, partial cds 172 6e-40
268ref|NG_001335.1| Homo sapiens genomic large histone family clust... 172 6e-40
269gb|AY520705.1| Tetraclitella divisa histone H3 gene, partial cds 172 6e-40
270gb|AY520695.1| Semibalanus cariosus histone H3 gene, partial cds 172 6e-40
271gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds 172 6e-40
272ref|XM_686806.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 172 6e-40
273gb|DQ028154.1| Leiognathus rivulatus histone H3 gene, partial cds 170 2e-39
274gb|DQ028149.1| Leiognathus elongatus histone H3 gene, partial cds 170 2e-39
275gb|DQ028130.1| Leiognathus robustus isolate LEQ1s histone H3 gen... 170 2e-39
276gb|DQ028113.1| Gazza squamiventralis isolate WLS52 histone H3 ge... 170 2e-39
277gb|DQ028112.1| Gazza squamiventralis isolate WLS51 histone H3 ge... 170 2e-39
278gb|DQ028111.1| Gazza minuta isolate L29 histone H3 gene, partial... 170 2e-39
279gb|DQ028110.1| Gazza minuta isolate L4 histone H3 gene, partial cds 170 2e-39
280gb|DQ028109.1| Gazza minuta isolate GM1 histone H3 gene, partial... 170 2e-39
281gb|DQ028106.1| Gazza sp. WLS56 histone H3 gene, partial cds 170 2e-39
282gb|AY520694.1| Semibalanus balanoides histone H3 gene, partial cds 170 2e-39
283ref|XM_356549.3| PREDICTED: Mus musculus similar to histone 1, H... 170 2e-39
284gb|AY521732.1| Zorotypus hubbardi voucher BYU_ACZO001 histone H3... 170 2e-39
285gb|DQ079978.1| Austrognathia christianae histone H3 gene, partia... 170 2e-39
286gb|AY662905.1| Paretroplus sp. 'Kamoro' histone H3a gene, partia... 170 2e-39
287emb|AL662809.14| Mouse DNA sequence from clone RP23-441I8 on chr... 170 2e-39
288gb|AY338642.1| Malenka californica histone 3 gene, partial cds 170 2e-39
289gb|AY749710.1| Centroptilum luteolum histone H3 (H3) gene, parti... 170 2e-39
290gb|AY655584.1| Iso rhothophilus histone H3a gene, partial cds 168 1e-38
291gb|BC069303.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 168 1e-38
292gb|BC067490.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 168 1e-38
293gb|BC067491.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 168 1e-38
294ref|NM_003529.2| Homo sapiens histone 1, H3a (HIST1H3A), mRNA 168 1e-38
295gb|AF531274.1| Homo sapiens histone H3 (HIST1H3A) gene, complete... 168 1e-38
296gb|DQ284249.1| Iguana iguana histone H3a gene, partial cds 168 1e-38
297gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, h... 168 1e-38
298gb|BC066246.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 168 1e-38
299gb|BC066245.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 168 1e-38
300gb|BC066247.1| Homo sapiens histone 1, H3a, mRNA (cDNA clone MGC... 168 1e-38
301emb|Z46261.1|HSHISH3A H.sapiens DNA for histone H3a 168 1e-38
302gb|DQ028162.1| Secutor megalolepis histone H3 gene, partial cds 167 4e-38
303gb|DQ028156.1| Secutor sp. L26 histone H3 gene, partial cds 167 4e-38
304gb|DQ028152.1| Leiognathus leuciscus histone H3 gene, partial cds 167 4e-38
305gb|DQ028151.1| Leiognathus leuciscus histone H3 gene, partial cds 167 4e-38
306gb|DQ028150.1| Leiognathus leuciscus histone H3 gene, partial cds 167 4e-38
307gb|DQ028139.1| Leiognathus nuchalis histone H3 gene, partial cds 167 4e-38
308gb|DQ028134.1| Leiognathus decorus histone H3 gene, partial cds 167 4e-38
309gb|DQ028131.1| Leiognathus sp. Philippines histone H3 gene, part... 167 4e-38
310gb|DQ028129.1| Leiognathus robustus isolate L35 histone H3 gene,... 167 4e-38
311gb|DQ028124.1| Leiognathus equulus histone H3 gene, partial cds 167 4e-38
312gb|DQ028122.1| Leiognathus equulus histone H3 gene, partial cds 167 4e-38
313gb|DQ028105.1| Gazza sp. WLS54 histone H3 gene, partial cds 167 4e-38
314gb|DQ028104.1| Gazza sp. T240 histone H3 gene, partial cds 167 4e-38
315gb|DQ028103.1| Gazza sp. L22 histone H3 gene, partial cds 167 4e-38
316gb|DQ284377.1| Rana guentheri histone H3a gene, partial cds 167 4e-38
317gb|DQ284287.1| Rana guentheri histone H3a gene, partial cds 167 4e-38
318gb|DQ284223.1| Rana aurora histone H3a gene, partial cds 167 4e-38
319gb|DQ284177.1| Rana japonica histone H3a gene, partial cds 167 4e-38
320ref|XM_687893.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 167 4e-38
321gb|AY923971.1| Anatoma euglypta isolate S34 histone H3 (H3) gene... 167 4e-38
322gb|AY662930.1| Crenicichla alta histone H3a gene, partial cds 167 4e-38
323gb|AY662904.1| Paretroplus tsimoly histone H3a gene, partial cds 167 4e-38
324gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, p... 167 4e-38
325gb|AY662902.1| Paretroplus nourissati histone H3a gene, partial cds 167 4e-38
326gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds 167 4e-38
327gb|AY662890.1| Etroplus canarensis histone H3a gene, partial cds 167 4e-38
328gb|DQ028146.1| Leiognathus bindus histone H3 gene, partial cds 165 2e-37
329gb|DQ028119.1| Leiognathus sp. L2 histone H3 gene, partial cds 165 2e-37
330ref|XM_527253.1| PREDICTED: Pan troglodytes similar to histone 1... 165 2e-37
331gb|BC054666.1| Danio rerio zgc:66241, mRNA (cDNA clone MGC:66241... 165 2e-37
332gb|AY521728.1| Aphanicerca capensis voucher BYU_ACPL028 histone ... 165 2e-37
333ref|NM_199745.1| Danio rerio zgc:66241 (zgc:66241), mRNA 165 2e-37
334gb|AF370818.1|AF370818 Balanus balanus histone H3 gene, partial cds 165 2e-37
335gb|AY923975.1| Stomatella sp. CET-2005 histone H3 (H3) gene, par... 165 2e-37
336gb|AY749724.1| Nesameletus ornatus histone H3 (H3) gene, partial... 165 2e-37
337gb|AY749712.1| Euthyplocia hecuba histone H3 (H3) gene, partial cds 165 2e-37
338gb|AY655591.1| Cololabis saira histone H3a gene, partial cds 163 6e-37
339gb|AY655585.1| Atherinella panamensis histone H3a gene, partial cds 163 6e-37
340gb|DQ028161.1| Secutor cf. insidiator JS-2005 histone H3 gene, p... 163 6e-37
341gb|DQ028160.1| Secutor indicius histone H3 gene, partial cds 163 6e-37
342gb|DQ028159.1| Secutor indicius histone H3 gene, partial cds 163 6e-37
343gb|DQ028155.1| Leiognathus stercorarius histone H3 gene, partial... 163 6e-37
344gb|DQ028153.1| Leiognathus lineolatus histone H3 gene, partial cds 163 6e-37
345gb|DQ028138.1| Leiognathus dussumieri isolate L30 histone H3 gen... 163 6e-37
346gb|DQ028123.1| Leiognathus equulus histone H3 gene, partial cds 163 6e-37
347gb|DQ028121.1| Leiognathus equulus histone H3 gene, partial cds 163 6e-37
348gb|DQ028114.1| Leiognathus sp. Fiji histone H3 gene, partial cds 163 6e-37
349gb|DQ079679.1| Lithodes santolla voucher KClisa histone H3 (H3) ... 163 6e-37
350gb|AY520720.1| Capitulum mitella histone H3 gene, partial cds 163 6e-37
351gb|AY520703.1| Elminius modestus histone H3 gene, partial cds 163 6e-37
352gb|AY520693.1| Balanus glandula histone H3 gene, partial cds 163 6e-37
353gb|AY520692.1| Balanus crenatus histone H3 gene, partial cds 163 6e-37
354ref|XM_905850.2| PREDICTED: Mus musculus similar to histone 1, H... 163 6e-37
355gb|DQ284224.1| Rana muscosa histone H3a gene, partial cds 163 6e-37
356emb|X85102.1|OSRNAHIS3 O.sativa mRNA for histone H3 163 6e-37
357gb|AY662925.1| Apistogramma sp. JSS-2004 histone H3a gene, parti... 163 6e-37
358gb|AY662883.1| Cetoscarus bicolor histone H3a gene, partial cds 163 6e-37
359gb|AY662879.1| Hermosilla azurea histone H3a gene, partial cds 163 6e-37
360gb|DQ028164.1| Secutor cf. ruconius JS-2005 histone H3 gene, par... 161 2e-36
361emb|X52393.1|TCH3H4 Tigriopus californicus DNA for histone H3 an... 161 2e-36
362gb|M84797.1|TIGH1234A Tigriopus californicus histone H1 gene, co... 161 2e-36
363gb|AY749736.1| Atopopus sp. EP134 histone H3 (H3) gene, partial cds 161 2e-36
364gb|AY655569.1| Bedotia sp. 'Vevembe' histone H3a gene, partial cds 159 9e-36
365gb|AY655567.1| Bedotia sp. 'Ranomafana' histone H3a gene, partia... 159 9e-36
366gb|AY655566.1| Bedotia sp. 'Manombo' histone H3a gene, partial cds 159 9e-36
367gb|AY655563.1| Bedotia sp. 'Ivoloina' histone H3a gene, partial cds 159 9e-36
368gb|AY655562.1| Bedotia sp. 'Betampona' histone H3a gene, partial... 159 9e-36
369gb|AY655558.1| Rheocles wrightae histone H3a gene, partial cds 159 9e-36
370gb|AY655553.1| Bedotia tricolor histone H3a gene, partial cds 159 9e-36
371gb|AY655549.1| Bedotia longianalis isolate 2 histone H3a gene, p... 159 9e-36
372gb|AY655548.1| Bedotia longianalis isolate 1 histone H3a gene, p... 159 9e-36
373gb|AY655547.1| Bedotia geayi histone H3a gene, partial cds 159 9e-36
374gb|DQ028163.1| Secutor megalolepis histone H3 gene, partial cds 159 9e-36
375gb|DQ028148.1| Photoplagios sp. Madagascar histone H3 gene, part... 159 9e-36
376gb|DQ028127.1| Leiognathus fasciatus histone H3 gene, partial cds 159 9e-36
377gb|DQ028120.1| Leiognathus sp. L9 histone H3 gene, partial cds 159 9e-36
378gb|DQ028102.1| Gazza sp. Fiji histone H3 gene, partial cds 159 9e-36
379gb|DQ028095.1| Cepola pauciradiata histone H3 gene, partial cds 159 9e-36
380gb|DQ028094.1| Cepola macrophthalma histone H3 gene, partial cds 159 9e-36
381gb|DQ028083.1| Lota lota histone H3 gene, partial cds 159 9e-36
382gb|DQ284391.1| Scaphiophryne marmorata histone H3a gene, partial... 159 9e-36
383gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds 159 9e-36
384gb|DQ284356.1| Fejervarya limnocharis histone H3a gene, partial cds 159 9e-36
385gb|DQ284267.1| Rana grahami histone H3a gene, partial cds 159 9e-36
386gb|DQ284242.1| Batrachylodes vertebralis histone H3a gene, parti... 159 9e-36
387gb|DQ284219.1| Rana clamitans histone H3a gene, partial cds 159 9e-36
388gb|DQ284185.1| Chaperina fusca histone H3a gene, partial cds 159 9e-36
389gb|DQ284180.1| Staurois tuberilinguis histone H3a gene, partial cds 159 9e-36
390gb|DQ284168.1| Pseudoamolops sauteri histone H3a gene, partial cds 159 9e-36
391gb|DQ284163.1| Rana adenopleura histone H3a gene, partial cds 159 9e-36
392gb|DQ284081.1| Leptobrachium chapaense histone H3a gene, partial... 159 9e-36
393gb|AF404629.1| Lewia infectoria isolate CR30 histone gene, parti... 159 9e-36
394gb|AY662899.1| Paretroplus maculatus histone H3a gene, partial cds 159 9e-36
395gb|AY662894.1| Paretroplus damii histone H3a gene, partial cds 159 9e-36
396gb|AY662893.1| Paretroplus dambabe histone H3a gene, partial cds 159 9e-36
397gb|AY539266.1| Haemulon plumieri histone H3 gene, partial cds 159 9e-36
398gb|AY539176.1| Chilara taylori histone H3 gene, partial cds 159 9e-36
399gb|AY338638.1| Hetaerina americana histone 3 gene, partial cds 159 9e-36
400gb|AY125243.1| Anisomorpha ferruginea histone 3 gene, partial cds 157 4e-35
401emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 157 4e-35
402gb|AY749721.1| Coloburiscoides sp. EP094 histone H3 (H3) gene, p... 157 4e-35
403gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 157 4e-35
404gb|AY655580.1| Atherinomorus lacunosus histone H3a gene, partial... 155 1e-34
405gb|DQ028157.1| Secutor sp. L37 histone H3 gene, partial cds 155 1e-34
406gb|DQ028126.1| Leiognathus fasciatus isolate L36 histone H3 gene... 155 1e-34
407gb|DQ028118.1| Leiognathus sp. Singapore histone H3 gene, partia... 155 1e-34
408gb|DQ079694.1| Pachygrapsus marmoratus voucher KCpama histone H3... 155 1e-34
409gb|DQ284393.1| Stumpffia cf. psologlossa AMNH A167359 histone H3... 155 1e-34
410gb|DQ284352.1| Rana chapaensis histone H3a gene, partial cds 155 1e-34
411gb|DQ284170.1| Rana temporaria histone H3a gene, partial cds 155 1e-34
412gb|AY662926.1| Astronotus ocellatus histone H3a gene, partial cds 155 1e-34
413gb|DQ284373.1| Rana sylvatica histone H3a gene, partial cds 153 6e-34
414gb|DQ284368.1| Ctenophryne geayi histone H3a gene, partial cds 153 6e-34
415dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histo... 153 6e-34
416gb|AY555569.1| Choroterpes sp. GG-2004 histone H3 gene, partial cds 153 6e-34
417gb|AF185247.1| Paralepidonotus ampulliferus histone H3 (H3) gene... 153 6e-34
418gb|AY539183.1| Dactylopterus volitans histone H3 gene, partial cds 153 6e-34
419gb|AY428836.1| Pycnophyes greenlandicus histone H3 gene, partial... 151 2e-33
420gb|AY655578.1| Pseudomugil signifer histone H3a gene, partial cds 151 2e-33
421gb|AY655568.1| Bedotia sp. 'Sambava' histone H3a gene, partial cds 151 2e-33
422gb|AY655565.1| Bedotia sp. Makira histone H3a gene, partial cds 151 2e-33
423gb|AY655564.1| Bedotia sp. 'Mahanara' histone H3a gene, partial cds 151 2e-33
424gb|AY655561.1| Bedotia sp. Bemarivo histone H3a gene, partial cds 151 2e-33
425gb|AY655560.1| Bedotia sp. 'Beforana' histone H3a gene, partial cds 151 2e-33
426gb|AY655559.1| Bedotia sp. 'Antalaha' histone H3a gene, partial cds 151 2e-33
427gb|AY655552.1| Bedotia masoala histone H3a gene, partial cds 151 2e-33
428gb|AY655551.1| Bedotia marojejy histone H3a gene, partial cds 151 2e-33
429gb|AY655550.1| Bedotia madagascariensis histone H3a gene, partia... 151 2e-33
430gb|DQ028144.1| Photopectoralis sp. Taiwan histone H3 gene, parti... 151 2e-33
431gb|DQ028128.1| Leiognathus fasciatus histone H3 gene, partial cds 151 2e-33
432gb|DQ028125.1| Leiognathus fasciatus isolate L16 histone H3 gene... 151 2e-33
433gb|DQ028117.1| Leiognathus sp. L41 histone H3 gene, partial cds 151 2e-33
434gb|DQ028116.1| Leiognathus sp. L39 histone H3 gene, partial cds 151 2e-33
435gb|DQ028115.1| Leiognathus sp. L25 histone H3 gene, partial cds 151 2e-33
436gb|DQ028086.1| Zeus faber histone H3 gene, partial cds 151 2e-33
437gb|DQ284354.1| Amnirana albilabris histone H3a gene, partial cds 151 2e-33
438gb|DQ284309.1| Rana maculata histone H3a gene, partial cds 151 2e-33
439gb|DQ284245.1| Rana johnsi histone H3a gene, partial cds 151 2e-33
440gb|DQ284187.1| Meristogenys orphnocnemis histone H3a gene, parti... 151 2e-33
441gb|DQ284094.1| Synapturanus mirandaribeiroi histone H3a gene, pa... 151 2e-33
442dbj|AB185056.1| Conocephalum conicum H3 gene for histone 3, comp... 151 2e-33
443dbj|AB185050.1| Conocephalum conicum H3 gene for histone 3, comp... 151 2e-33
444dbj|AB185049.1| Conocephalum conicum H3 gene for histone 3, comp... 151 2e-33
445dbj|AB185046.1| Conocephalum conicum H3 gene for histone 3, comp... 151 2e-33
446gb|AY218163.1| Echinorhynchus gadi histone H3 gene, partial cds 151 2e-33
447gb|DQ275324.1| Acilius sulcatus voucher BYU KBMAcsu49 histone 3 ... 151 2e-33
448gb|AY662931.1| Dicrossus sp. JSS-2004 histone H3a gene, partial cds 151 2e-33
449gb|AY662912.1| Paratilapia sp. 'Ifasy' histone H3a gene, partial... 151 2e-33
450gb|AY662911.1| Paratilapia sp. 'East' histone H3a gene, partial cds 151 2e-33
451gb|AY662908.1| Paratilapia cf. bleekeri JSS-2004 histone H3a gen... 151 2e-33
452gb|AY662901.1| Paretroplus menarambo histone H3a gene, partial cds 151 2e-33
453gb|AY662900.1| Paretroplus maromandia histone H3a-like gene, par... 151 2e-33
454gb|AY662888.1| Embiotoca jacksoni histone H3a gene, partial cds 151 2e-33
455gb|AY539264.1| Perca flavescens histone H3 gene, partial cds 151 2e-33
456gb|AY539263.1| Etheostoma blennioides histone H3 gene, partial cds 151 2e-33
457gb|AY539257.1| Diplectrum formosum histone H3 gene, partial cds 151 2e-33
458gb|AY655557.1| Rheocles vatosoa histone H3a gene, partial cds 149 9e-33
459gb|AY655555.1| Rheocles derhami histone H3a gene, partial cds 149 9e-33
460gb|AY520717.1| Verruca stroemia histone H3 gene, partial cds 149 9e-33
461gb|AY520706.1| Tetraclitella purpurascens histone H3 gene, parti... 149 9e-33
462gb|AY230984.1| Nesticus sp. X132 histone H3A (H3A) gene, partial... 149 9e-33
463gb|AY923967.1| Peltospira delicata isolate PS1 histone H3 (H3) g... 149 9e-33
464emb|Z56112.1|HS89C12R H.sapiens CpG island DNA genomic Mse1 frag... 149 9e-33
465emb|Z56111.1|HS89C12F H.sapiens CpG island DNA genomic Mse1 frag... 149 9e-33
466emb|Z63365.1|HS81H7R H.sapiens CpG island DNA genomic Mse1 fragm... 149 9e-33
467gb|AY655586.1| Atherinops affinis histone H3a gene, partial cds 147 4e-32
468gb|AY520707.1| Tetraclita squamosa histone H3 gene, partial cds 147 4e-32
469gb|AY520704.1| Elminius kingii histone H3 gene, partial cds 147 4e-32
470gb|AY707444.1| Grylloblattina djakonovi histone 3 gene, partial cds 147 4e-32
471gb|DQ284333.1| Huia nasica histone H3a gene, partial cds 147 4e-32
472gb|DQ284292.1| Rana yavapaiensis histone H3a gene, partial cds 147 4e-32
473gb|DQ284237.1| Sphenophryne sp. 989 histone H3a gene, partial cds 147 4e-32
474gb|AY662936.1| Teleocichla sp. JSS-2004 histone H3a gene, partia... 147 4e-32
475gb|AY662910.1| Paratilapia polleni 'Ravelobe' histone H3a gene, ... 147 4e-32
476gb|AY662887.1| Cymatogaster aggregata histone H3a gene, partial cds 147 4e-32
477gb|AY662881.1| Polycentropsis abbreviata histone H3a gene, parti... 147 4e-32
478gb|AY539267.1| Kuhlia rupestris histone H3 gene, partial cds 147 4e-32
479gb|AY655596.1| Atherinomorus sp. Karianga histone H3a gene, part... 145 1e-31
480gb|DQ028093.1| Scomberoides lysan histone H3 gene, partial cds 145 1e-31
481gb|AF517876.1| Griffithsia japonica isolate Gj410 putative histo... 145 1e-31
482gb|AY655583.1| Teramulus waterloti histone H3a gene, partial cds 143 6e-31
483gb|AY655556.1| Rheocles lateralis histone H3a gene, partial cds 143 6e-31
484gb|AY655554.1| Rheocles alaotrensis histone H3a gene, partial cds 143 6e-31
485gb|DQ028100.1| Nematistius pectoralis histone H3 gene, partial cds 143 6e-31
486gb|DQ028081.1| Trachipterus trachypterus histone H3 gene, partia... 143 6e-31
487gb|DQ079682.1| Lysmata wurdemanni voucher MLP120 histone H3 (H3)... 143 6e-31
488gb|AY870292.1| Pantala flavescens histone H3 gene, partial cds 143 6e-31
489emb|Z30939.1|MDH3HIST Mus domesticus partial mRNA for histone H3... 143 6e-31
490gb|DQ284414.1| Hamptophryne boliviana histone H3a gene, partial cds 143 6e-31
491gb|DQ284411.1| Dyscophus guineti histone H3a gene, partial cds 143 6e-31
492gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds 143 6e-31
493gb|DQ284369.1| Rana palmipes histone H3a gene, partial cds 143 6e-31
494gb|DQ284358.1| Amolops chapaensis histone H3a gene, partial cds 143 6e-31
495gb|DQ284314.1| Pseudophryne coriacea histone H3a gene, partial cds 143 6e-31
496gb|DQ284269.1| Rana temporaria histone H3a gene, partial cds 143 6e-31
497gb|DQ284241.1| Genyophryne thomsoni histone H3a gene, partial cds 143 6e-31
498gb|DQ284179.1| Rana chalconota histone H3a gene, partial cds 143 6e-31
499gb|DQ284178.1| Rana nigromaculata histone H3a gene, partial cds 143 6e-31
500gb|DQ284167.1| Rana pipiens histone H3a gene, partial cds 143 6e-31

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  361 bits (182), Expect = 1e-96
 Identities = 218/230 (94%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 242 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 183

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||
Sbjct: 182 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcg 123

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
           ||||||||||||||||| |||||||||||||||||||| | |||||| ||||||||||||
Sbjct: 122 gcggcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 63

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |  |||||||||||||| || |||||||||||||||||
Sbjct: 62  tgcgcgatctccctcaccaggcgctggaacgggagcttgcggatcagcag 13



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 70/81 (86%), Gaps = 4/81 (4%)
 Strand = Plus / Minus

                                                                       
Query: 28  catcgataatggtcgatcaacagtacattaaccaacaatt----ccacagaaagcatctg 83
           |||||||||| ||| ||||||| |||||||||||||||||     ||||| ||||||| |
Sbjct: 480 catcgataattgtcaatcaacactacattaaccaacaatttgcatcacagtaagcatcgg 421

                                
Query: 84  tttgcatcaccgcaaaccaaa 104
           |||||| ||||||||||||||
Sbjct: 420 tttgcaacaccgcaaaccaaa 400



to top

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  355 bits (179), Expect = 8e-95
 Identities = 221/235 (94%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatgg 268
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 960 ccgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatgg 901

                                                                       
Query: 269 tgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacg 328
           ||||||||||||||||||||||||| ||||||||||||||||| || || |||||||| |
Sbjct: 900 tgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtagg 841

                                                                       
Query: 329 cctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttga 388
           |||||||||||||||| || |||   ||||||  |||||||||||||||||| |||||||
Sbjct: 840 cctcggcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtcttga 781

                                                                  
Query: 389 agtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 780 agtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatgagcag 726



to top

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  349 bits (176), Expect = 5e-93
 Identities = 212/224 (94%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 407 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || || |||||||| |||||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||||||||||||||| ||||||  ||||||||||||||| |||||||||||||||
Sbjct: 287 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 228

                                                       
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcag 440
           |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 227 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcag 184



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  349 bits (176), Expect = 5e-93
 Identities = 212/224 (94%)
 Strand = Plus / Plus

                                                                           
Query: 217     gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1644700 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 1644759

                                                                           
Query: 277     ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
               ||||||||||||||||| ||||||||||||||||| || || |||||||| |||||||||
Sbjct: 1644760 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 1644819

                                                                           
Query: 337     gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
               |||||||||||||||||||| ||||||  ||||||||||||||| |||||||||||||||
Sbjct: 1644820 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 1644879

                                                           
Query: 397     gcgatctcgcggaccaggcgctggaagggcagcttgcggatcag 440
               |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 1644880 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcag 1644923



 Score =  295 bits (149), Expect = 6e-77
 Identities = 212/233 (90%)
 Strand = Plus / Minus

                                                                           
Query: 211     gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 270
               ||||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 3055575 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 3055516

                                                                           
Query: 271     acgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcc 330
               ||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||
Sbjct: 3055515 acgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcc 3055456

                                                                           
Query: 331     tcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaag 390
               || ||||||||||| ||||||   ||||||  |  ||||||||||||||| |||||||||
Sbjct: 3055455 tccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaag 3055396

                                                                    
Query: 391     tcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
               ||||| |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 3055395 tcctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 3055343



 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                           
Query: 215     aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
               |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3054206 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3054265

                                                                           
Query: 275     gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
               ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||| |
Sbjct: 3054266 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 3054325

                                                                           
Query: 335     cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
               |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 3054326 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 3054385

                                                                
Query: 395     gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
               | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 3054386 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 3054434



 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                           
Query: 215     aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
               |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 3045559 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 3045618

                                                                           
Query: 275     gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
               ||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 3045619 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 3045678

                                                                           
Query: 335     cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
               |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 3045679 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 3045738

                                                                
Query: 395     gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
               | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 3045739 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 3045787



 Score =  289 bits (146), Expect = 4e-75
 Identities = 212/234 (90%)
 Strand = Plus / Plus

                                                                           
Query: 210     cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
               |||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 3039524 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 3039583

                                                                           
Query: 270     gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
               ||||||||||||||||||||| || ||||||||||||||||| ||||| |||||||||||
Sbjct: 3039584 gacgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgc 3039643

                                                                           
Query: 330     ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
               ||||||||||||||| || |||   ||||||  |  ||||||||||||||| ||||||||
Sbjct: 3039644 ctcggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaa 3039703

                                                                     
Query: 390     gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
               |||||| |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 3039704 gtcctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 3039757



to top

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  349 bits (176), Expect = 5e-93
 Identities = 212/224 (94%)
 Strand = Plus / Plus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 47871 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 47930

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| || || |||||||| |||||||||
Sbjct: 47931 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 47990

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             |||||||||||||||||||| ||||||  ||||||||||||||| |||||||||||||||
Sbjct: 47991 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 48050

                                                         
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcag 440
             |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 48051 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcag 48094



to top

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  349 bits (176), Expect = 5e-93
 Identities = 212/224 (94%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 495 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 436

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || || |||||||| |||||||||
Sbjct: 435 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 376

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||||||||||||||| ||||||  ||||||||||||||| |||||||||||||||
Sbjct: 375 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 316

                                                       
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcag 440
           |||||||||||||| |||||||||||||| ||||||||||||||
Sbjct: 315 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcag 272



to top

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  343 bits (173), Expect = 3e-91
 Identities = 218/233 (93%)
 Strand = Plus / Minus

                                                                       
Query: 211 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 270
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 577 gcctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 518

                                                                       
Query: 271 acgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcc 330
           ||||||||||||||||||||||| ||||||||||||||||| || || |||||||| |||
Sbjct: 517 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcc 458

                                                                       
Query: 331 tcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaag 390
           ||||| ||||||||||| || ||||||||||||  |||||| || |||||||||||||||
Sbjct: 457 tcggccgcctcctggagcgccagcacggcgtggctctggaaccgcaggtccgtcttgaag 398

                                                                
Query: 391 tcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 397 tcctgcgcgatctcgcggaccaggcgctggaaggggagcttgcggatgagcag 345



to top

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  331 bits (167), Expect = 1e-87
 Identities = 212/227 (93%)
 Strand = Plus / Plus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 137 gcgcgctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 196

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           || |||||||||||||| ||||||||||||||||| || || |||||||| |||||||||
Sbjct: 197 ttagcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 256

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           ||||||||||| || ||||||||||||  |||||| |||||||| |||||||||||||||
Sbjct: 257 gcctcctggagcgccagcacggcgtggctctggaatcggaggtctgtcttgaagtcctgc 316

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 317 gcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 363



to top

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  329 bits (166), Expect = 4e-87
 Identities = 214/230 (93%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 461 taggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 402

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| ||||||||||||||||| ||||| |||||||| ||||||
Sbjct: 401 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtaggcctcg 342

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
           || ||||||||||| || ||||||||||||  |||||| || |||||||| |||||||||
Sbjct: 341 gccgcctcctggagcgccagcacggcgtggctctggaaccgcaggtccgttttgaagtcc 282

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 281 tgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 232



to top

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  325 bits (164), Expect = 7e-86
 Identities = 191/200 (95%)
 Strand = Plus / Minus

                                                                       
Query: 244 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtg 303
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                                       
Query: 304 tcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgg 363
           |||||||| |||||||| |||||||||||||| |||||||||||||| ||||||||||||
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggagggccagcacggcgtgg 360

                                                                       
Query: 364 gactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaag 423
           ||||||||||||||||||||||||||||||||||||||||| |  |||||||||||||| 
Sbjct: 359 gactggaagcggaggtccgtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 300

                               
Query: 424 ggcagcttgcggatcagcag 443
           ||||||||||||||||||||
Sbjct: 299 ggcagcttgcggatcagcag 280



to top

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  321 bits (162), Expect = 1e-84
 Identities = 216/234 (92%)
 Strand = Plus / Minus

                                                                       
Query: 210 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
           |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||
Sbjct: 356 cgcctaagcgcgctccccgcggatgcggcgggcgagctgaatgtccttgggcatgatggt 297

                                                                       
Query: 270 gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
           |||||||||||||||||||||||| ||||||||||||||||| || || |||||||| ||
Sbjct: 296 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggc 237

                                                                       
Query: 330 ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
           ||| ||||||||||| || |||   ||||||  |||||||||||||||||| ||||||||
Sbjct: 236 ctccgcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtcttgaa 177

                                                                 
Query: 390 gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||||
Sbjct: 176 gtcctgcgcgatctcgcggaccaggcgctggaaggggagcttgcggatgagcag 123



to top

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  307 bits (155), Expect = 2e-80
 Identities = 209/227 (92%)
 Strand = Plus / Minus

                                                                          
Query: 217    gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
              |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 118174 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 118115

                                                                          
Query: 277    ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
              ||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 118114 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 118055

                                                                          
Query: 337    gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
              ||||||||||| |||   ||||||  |  |||||| ||||||||||||||||||||||||
Sbjct: 118054 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 117995

                                                             
Query: 397    gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||||| ||||| || ||||||||||| |||||||||||||||||
Sbjct: 117994 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcag 117948



to top

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  307 bits (155), Expect = 2e-80
 Identities = 209/227 (92%)
 Strand = Plus / Minus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 13780 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 13721

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 13720 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 13661

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             ||||||||||| |||   ||||||  |  |||||| ||||||||||||||||||||||||
Sbjct: 13660 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 13601

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||||| ||||| || ||||||||||| |||||||||||||||||
Sbjct: 13600 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcag 13554



to top

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  307 bits (155), Expect = 2e-80
 Identities = 209/227 (92%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 807 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 748

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 747 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 688

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           ||||||||||| |||   ||||||  |  |||||| ||||||||||||||||||||||||
Sbjct: 687 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 628

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| || ||||||||||| |||||||||||||||||
Sbjct: 627 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcag 581



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  307 bits (155), Expect = 2e-80
 Identities = 209/227 (92%)
 Strand = Plus / Plus

                                                                           
Query: 217     gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2608624 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2608683

                                                                           
Query: 277     ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
               ||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 2608684 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 2608743

                                                                           
Query: 337     gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
               ||||||||||| |||   ||||||  |  |||||| ||||||||||||||||||||||||
Sbjct: 2608744 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 2608803

                                                              
Query: 397     gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
               |||||||| ||||| || ||||||||||| |||||||||||||||||
Sbjct: 2608804 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcag 2608850



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  307 bits (155), Expect = 2e-80
 Identities = 209/227 (92%)
 Strand = Plus / Plus

                                                                           
Query: 217     gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
               |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2617655 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2617714

                                                                           
Query: 277     ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
               ||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 2617715 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 2617774

                                                                           
Query: 337     gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
               ||||||||||| |||   ||||||  |  |||||| ||||||||||||||||||||||||
Sbjct: 2617775 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 2617834

                                                              
Query: 397     gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
               |||||||| ||||| || ||||||||||| |||||||||||||||||
Sbjct: 2617835 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcag 2617881



to top

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  307 bits (155), Expect = 2e-80
 Identities = 209/227 (92%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 478 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 419

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||||||||
Sbjct: 418 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 359

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           ||||||||||| |||   ||||||  |  |||||| ||||||||||||||||||||||||
Sbjct: 358 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 299

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| || ||||||||||| |||||||||||||||||
Sbjct: 298 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcag 252



to top

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  305 bits (154), Expect = 6e-80
 Identities = 214/234 (91%)
 Strand = Plus / Minus

                                                                       
Query: 210 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
           |||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 413 cgcctacgcgcgctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggt 354

                                                                       
Query: 270 gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
           |||||||||||||||||||||||| ||||||||||||||||| || || |||||||| ||
Sbjct: 353 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggc 294

                                                                       
Query: 330 ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
           ||||||||| ||||||||||| || |||||||||  |||||| || || |||||||||||
Sbjct: 293 ctcggcggcttcctggagggccaggacggcgtggctctggaaccgcagatccgtcttgaa 234

                                                                 
Query: 390 gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||| |||||||||||||||||||||| ||| |||||||||||
Sbjct: 233 gtcctgagcgatctcacggaccaggcgctggaagggcaacttccggatcagcag 180



to top

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  303 bits (153), Expect = 3e-79
 Identities = 213/233 (91%)
 Strand = Plus / Minus

                                                                       
Query: 211 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 270
           |||||||| | ||| || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 660 gcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtg 601

                                                                       
Query: 271 acgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcc 330
           ||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| |||
Sbjct: 600 acgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcc 541

                                                                       
Query: 331 tcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaag 390
           |||||||||||||| ||||||   ||||||  |||||||||||||||||| |||||||||
Sbjct: 540 tcggcggcctcctgcagggcggagacggcggaggactggaagcggaggtcggtcttgaag 481

                                                                
Query: 391 tcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| ||||||||||| || |||||||||||||| ||||||||||| |||||
Sbjct: 480 tcctgggcgatctcgcgcactaggcgctggaaggggagcttgcggatgagcag 428



to top

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  299 bits (151), Expect = 4e-78
 Identities = 199/215 (92%)
 Strand = Plus / Plus

                                                                       
Query: 229 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 238 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 297

                                                                       
Query: 289 gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
           ||||| ||||||||||||||||| || ||||||||||| ||||||||||||||||| || 
Sbjct: 298 gcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcggcctcctgcagc 357

                                                                       
Query: 349 gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
           |||  |||||||  ||||||||| |||||||||||||||||||||||||||||||| || 
Sbjct: 358 gcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgc 417

                                              
Query: 409 accaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||| |||||||| |||||||||||
Sbjct: 418 accagccgctggaacggcagcttccggatcagcag 452



to top

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  299 bits (151), Expect = 4e-78
 Identities = 199/215 (92%)
 Strand = Plus / Minus

                                                                       
Query: 229 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 779 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 720

                                                                       
Query: 289 gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
           ||||| ||||||||||||||||| || ||||||||||| ||||||||||||||||| || 
Sbjct: 719 gcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcggcctcctgcagc 660

                                                                       
Query: 349 gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
           |||  |||||||  ||||||||| |||||||||||||||||||||||||||||||| || 
Sbjct: 659 gcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgc 600

                                              
Query: 409 accaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||| |||||||| |||||||||||
Sbjct: 599 accagccgctggaacggcagcttccggatcagcag 565



to top

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 409 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 350

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||| |
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 290

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
           |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 289 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 230

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 229 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 181



to top

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 430 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 371

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 370 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 311

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
           |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 310 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 251

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 250 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 202



to top

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 598 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 539

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 538 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 479

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 478 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 419

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 418 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 370



to top

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 570 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 629

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 630 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 689

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 690 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 749

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 750 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 798



to top

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 315 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 374

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 375 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 434

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 435 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 494

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 495 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 543



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Minus

                                                                        
Query: 215  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3244 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3185

                                                                        
Query: 275  gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
            ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 3184 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 3125

                                                                        
Query: 335  cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
              |||||||| || || | ||||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 3124 tcgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttgaagtcct 3065

                                                             
Query: 395  gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 3064 gcgcgatctcgcgcaccagccgctggaagggcagcttgcggatcagcag 3016



 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                        
Query: 215  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1477 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 1536

                                                                        
Query: 275  gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
            ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 1537 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 1596

                                                                        
Query: 335  cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
              |||||||| || || | ||||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 1597 tcgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttgaagtcct 1656

                                                             
Query: 395  gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 1657 gcgcgatctcgcgcaccagccgctggaagggcagcttgcggatcagcag 1705



to top

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  295 bits (149), Expect = 6e-77
 Identities = 212/233 (90%)
 Strand = Plus / Minus

                                                                          
Query: 211    gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 270
              ||||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 143524 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 143465

                                                                          
Query: 271    acgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcc 330
              ||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||
Sbjct: 143464 acgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcc 143405

                                                                          
Query: 331    tcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaag 390
              || ||||||||||| ||||||   ||||||  |  ||||||||||||||| |||||||||
Sbjct: 143404 tccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaag 143345

                                                                   
Query: 391    tcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              ||||| |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 143344 tcctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 143292



 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                          
Query: 215    aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
              |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 142155 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 142214

                                                                          
Query: 275    gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
              ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||| |
Sbjct: 142215 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 142274

                                                                          
Query: 335    cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
              |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 142275 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 142334

                                                               
Query: 395    gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 142335 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 142383



 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                          
Query: 215    aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
              |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 133508 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 133567

                                                                          
Query: 275    gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
              ||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 133568 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 133627

                                                                          
Query: 335    cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
              |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 133628 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 133687

                                                               
Query: 395    gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 133688 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 133736



 Score =  289 bits (146), Expect = 4e-75
 Identities = 212/234 (90%)
 Strand = Plus / Plus

                                                                          
Query: 210    cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
              |||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 127473 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 127532

                                                                          
Query: 270    gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
              ||||||||||||||||||||| || ||||||||||||||||| ||||| |||||||||||
Sbjct: 127533 gacgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgc 127592

                                                                          
Query: 330    ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
              ||||||||||||||| || |||   ||||||  |  ||||||||||||||| ||||||||
Sbjct: 127593 ctcggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaa 127652

                                                                    
Query: 390    gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||| |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 127653 gtcctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 127706



to top

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  295 bits (149), Expect = 6e-77
 Identities = 212/233 (90%)
 Strand = Plus / Minus

                                                                        
Query: 211  gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 270
            ||||| |||||||| |||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 9760 gcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtg 9701

                                                                        
Query: 271  acgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcc 330
            ||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||
Sbjct: 9700 acgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcc 9641

                                                                        
Query: 331  tcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaag 390
            || ||||||||||| ||||||   ||||||  |  ||||||||||||||| |||||||||
Sbjct: 9640 tccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaag 9581

                                                                 
Query: 391  tcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||| |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 9580 tcctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 9528



 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Plus

                                                                        
Query: 215  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
            |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 8391 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 8450

                                                                        
Query: 275  gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
            ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||||||| |
Sbjct: 8451 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 8510

                                                                        
Query: 335  cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
            |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 8511 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 8570

                                                             
Query: 395  gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 8571 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 8619



to top

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 880 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 821

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 820 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 761

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 760 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 701

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 700 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 652



to top

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 693 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 634

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 633 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 574

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 573 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 514

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 513 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 465



to top

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  295 bits (149), Expect = 6e-77
 Identities = 209/229 (91%)
 Strand = Plus / Minus

                                                                        
Query: 215  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
            |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1529 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 1470

                                                                        
Query: 275  gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
            ||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||
Sbjct: 1469 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 1410

                                                                        
Query: 335  cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
            |||||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||
Sbjct: 1409 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 1350

                                                             
Query: 395  gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 1349 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 1301



to top

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  291 bits (147), Expect = 1e-75
 Identities = 207/227 (91%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||| |||
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| ||||||   ||||||  |  ||||||||||||||| |||||||||||||| 
Sbjct: 287 gcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgg 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 227 gcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 181



to top

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  289 bits (146), Expect = 4e-75
 Identities = 212/234 (90%)
 Strand = Plus / Minus

                                                                       
Query: 210 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
           |||||| |||||||| |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 814 cgcctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggt 755

                                                                       
Query: 270 gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
           ||||||||||||||||||||| || ||||||||||||||||| ||||| |||||||||||
Sbjct: 754 gacgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgc 695

                                                                       
Query: 330 ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
           ||||||||||||||| || |||   ||||||  |  ||||||||||||||| ||||||||
Sbjct: 694 ctcggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaa 635

                                                                 
Query: 390 gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 634 gtcctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 581



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  289 bits (146), Expect = 4e-75
 Identities = 212/234 (90%)
 Strand = Plus / Minus

                                                                            
Query: 210      cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
                ||||||||| | ||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 37507569 cgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 37507510

                                                                            
Query: 270      gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
                |||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||| ||
Sbjct: 37507509 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggc 37507450

                                                                            
Query: 330      ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
                |||||| |||||||| || |||   ||||||  |  ||||||||||||||| ||||||||
Sbjct: 37507449 ctcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaa 37507390

                                                                      
Query: 390      gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
                ||||||||||||||| || |||||||||||||| ||||||||||||||||||||
Sbjct: 37507389 gtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcag 37507336



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 227     cgcggatgcggcgggcgagct 247
               |||||||||||||||||||||
Sbjct: 9911750 cgcggatgcggcgggcgagct 9911730



to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  289 bits (146), Expect = 4e-75
 Identities = 212/234 (90%)
 Strand = Plus / Minus

                                                                          
Query: 210    cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
              ||||||||| | ||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 102106 cgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 102047

                                                                          
Query: 270    gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
              |||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||| ||
Sbjct: 102046 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggc 101987

                                                                          
Query: 330    ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
              |||||| |||||||| || |||   ||||||  |  ||||||||||||||| ||||||||
Sbjct: 101986 ctcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaa 101927

                                                                    
Query: 390    gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              ||||||||||||||| || |||||||||||||| ||||||||||||||||||||
Sbjct: 101926 gtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcag 101873



to top

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  289 bits (146), Expect = 4e-75
 Identities = 212/234 (90%)
 Strand = Plus / Minus

                                                                       
Query: 210 cgcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggt 269
           ||||||||| | ||| || |||||||||||||||||||||||||||||||||||||||||
Sbjct: 492 cgcctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggt 433

                                                                       
Query: 270 gacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgc 329
           |||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||| ||
Sbjct: 432 gacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggc 373

                                                                       
Query: 330 ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
           |||||| |||||||| || |||   ||||||  |  ||||||||||||||| ||||||||
Sbjct: 372 ctcggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaa 313

                                                                 
Query: 390 gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||||| || |||||||||||||| ||||||||||||||||||||
Sbjct: 312 gtcctgcgcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcag 259



to top

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Plus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 378 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 437

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 438 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 497

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 498 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 557

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 558 gcgcgatctcgcgcaccaggcgctggaagggcagtttgcggatcagcag 606



to top

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Plus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 134 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 193

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 194 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 253

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 254 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 313

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 314 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 362



to top

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 823 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||| ||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 763 gcttggcatggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 704

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 703 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 644

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 643 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 595



to top

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 897 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 838

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 837 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 778

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| ||||| |||||||
Sbjct: 777 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttaaagtcct 718

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 717 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 669



to top

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 639 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 580

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||  ||| |
Sbjct: 579 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccg 520

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
           |||||||||| || ||| | ||||||   | ||||||||||||||| |||||||||||||
Sbjct: 519 cggcctcctgcagcgcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcct 460

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 459 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 411



to top

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  287 bits (145), Expect = 2e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334

                                                                       
Query: 291 gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
           ||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||
Sbjct: 333 gcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcggcctcctgcagcgc 274

                                                                       
Query: 351 gagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggac 410
           |   || |||  |||||||||||||||||| |||||||| |||||||||||||| |||||
Sbjct: 273 ggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgcgcgatctcacggac 214

                                            
Query: 411 caggcgctggaagggcagcttgcggatcagcag 443
            |||||||||||||||||||||||||| |||||
Sbjct: 213 gaggcgctggaagggcagcttgcggatgagcag 181



to top

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 569 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 510

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           |||||||||| |||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 509 gcttggcgtgcatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 450

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 449 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 390

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 389 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 341



to top

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 762 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 703

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 702 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 643

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 642 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 583

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 582 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 534



to top

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  287 bits (145), Expect = 2e-74
 Identities = 208/229 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 546 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 487

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||| ||||||||||| ||||| |||||||||  ||| |
Sbjct: 486 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccg 427

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
           |||||||||| || ||| | ||||||   | ||||||||||||||| |||||||||||||
Sbjct: 426 cggcctcctgcagcgcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcct 367

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           | |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 366 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 318



to top

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  287 bits (145), Expect = 2e-74
 Identities = 196/213 (92%)
 Strand = Plus / Minus

                                                                       
Query: 231 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 814 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 755

                                                                       
Query: 291 gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
           ||| ||||||||||||||||| |||||||||||||| ||||||||||||||||| || ||
Sbjct: 754 gcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcggcctcctgcagcgc 695

                                                                       
Query: 351 gagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggac 410
           |   || |||  |||||||||||||||||| |||||||| |||||||||||||| |||||
Sbjct: 694 ggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgcgcgatctcacggac 635

                                            
Query: 411 caggcgctggaagggcagcttgcggatcagcag 443
            |||||||||||||||||||||||||| |||||
Sbjct: 634 gaggcgctggaagggcagcttgcggatgagcag 602



to top

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  283 bits (143), Expect = 2e-73
 Identities = 206/227 (90%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           |||||||||||||| || ||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || |||   ||||||  |  ||||||||||||||| |||||||||||||| 
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgg 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 227 gcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcag 181



to top

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  283 bits (143), Expect = 2e-73
 Identities = 197/215 (91%)
 Strand = Plus / Minus

                                                                       
Query: 229 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 289 gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
           ||||| ||||||||||||||||| ||||| |||||||| |||||||| |||||||| || 
Sbjct: 335 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgcagc 276

                                                                       
Query: 349 gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
           |||   ||||||  |  ||||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 216

                                              
Query: 409 accaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| ||||||||||||||||||||
Sbjct: 215 accaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  281 bits (142), Expect = 9e-73
 Identities = 202/222 (90%)
 Strand = Plus / Minus

                                                                        
Query: 222  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2262 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 2203

                                                                        
Query: 282  gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
            |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 2202 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 2143

                                                                        
Query: 342  ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
            ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 2142 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 2083

                                                      
Query: 402  ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            |||||| |||||||||||||||||||||||||||||||||||
Sbjct: 2082 ctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 2041



to top

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  280 bits (141), Expect = 4e-72
 Identities = 207/229 (90%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 823 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||| 
Sbjct: 763 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 704

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
             |||||||| || || |  |||||   |  ||||||||| ||||| |||||||||||||
Sbjct: 703 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 644

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||| || |||||||||||||||||||||||||||||||||||
Sbjct: 643 gcgcgatctcacgcaccaggcgctggaagggcagcttgcggatcagcag 595



to top

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  276 bits (139), Expect = 6e-71
 Identities = 196/215 (91%)
 Strand = Plus / Minus

                                                                       
Query: 229 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 289 gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
           ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| || 
Sbjct: 335 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 276

                                                                       
Query: 349 gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
           |||   ||||||  |  ||||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 216

                                              
Query: 409 accaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||| |||||||||||||| |||||
Sbjct: 215 accagccgctggaacggcagcttgcggatgagcag 181



to top

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  276 bits (139), Expect = 6e-71
 Identities = 196/215 (91%)
 Strand = Plus / Plus

                                                                         
Query: 229   cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72777 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 72836

                                                                         
Query: 289   gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
             ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| || 
Sbjct: 72837 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 72896

                                                                         
Query: 349   gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
             |||   ||||||  |  ||||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 72897 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 72956

                                                
Query: 409   accaggcgctggaagggcagcttgcggatcagcag 443
             ||||| |||||||| |||||||||||||| |||||
Sbjct: 72957 accagccgctggaacggcagcttgcggatgagcag 72991



to top

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  276 bits (139), Expect = 6e-71
 Identities = 208/231 (90%)
 Strand = Plus / Minus

                                                                       
Query: 213 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 272
           ||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 411 ctaggcgcgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 273 gcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctc 332
           ||||||||||||||||||||| ||||||||||||||||| |||||||| ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 333 ggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtc 392
           |   |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||
Sbjct: 291 gctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtc 232

                                                              
Query: 393 ctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 231 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag 181



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  276 bits (139), Expect = 6e-71
 Identities = 196/215 (91%)
 Strand = Plus / Plus

                                                                            
Query: 229      cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355455 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 21355514

                                                                            
Query: 289      gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
                ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| || 
Sbjct: 21355515 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 21355574

                                                                            
Query: 349      gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
                |||   ||||||  |  ||||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 21355575 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 21355634

                                                   
Query: 409      accaggcgctggaagggcagcttgcggatcagcag 443
                ||||| |||||||| |||||||||||||| |||||
Sbjct: 21355635 accagccgctggaacggcagcttgcggatgagcag 21355669



to top

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  276 bits (139), Expect = 6e-71
 Identities = 196/215 (91%)
 Strand = Plus / Minus

                                                                       
Query: 229 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 480 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 421

                                                                       
Query: 289 gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
           ||||| ||||||||||||||||| ||||| |||||||| ||||||||||||||||| || 
Sbjct: 420 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 361

                                                                       
Query: 349 gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
           |||   ||||||  |  ||||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 360 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 301

                                              
Query: 409 accaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||| |||||||||||||| |||||
Sbjct: 300 accagccgctggaacggcagcttgcggatgagcag 266



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  274 bits (138), Expect = 2e-70
 Identities = 201/222 (90%)
 Strand = Plus / Plus

                                                                        
Query: 222  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3353 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 3412

                                                                        
Query: 282  gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
            |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 3413 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 3472

                                                                        
Query: 342  ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
            ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 3473 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 3532

                                                      
Query: 402  ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||| || |||||||||||||||||||||||||||||||||||
Sbjct: 3533 ctcccgcaccaggcgctggaagggcagcttgcggatcagcag 3574



to top

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  270 bits (136), Expect = 4e-69
 Identities = 184/200 (92%)
 Strand = Plus / Minus

                                                                       
Query: 244 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtg 303
           |||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                                       
Query: 304 tcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgg 363
           |||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagggccagcacggcgtgg 367

                                                                       
Query: 364 gactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaag 423
             ||||||||| || ||||||||||||||||| |||||||| || | |||||||||||| 
Sbjct: 366 ctctggaagcgcagatccgtcttgaagtcctgggcgatctcccgcagcaggcgctggaac 307

                               
Query: 424 ggcagcttgcggatcagcag 443
           |||||||||||||| |||||
Sbjct: 306 ggcagcttgcggatgagcag 287



to top

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  264 bits (133), Expect = 2e-67
 Identities = 193/213 (90%)
 Strand = Plus / Minus

                                                                       
Query: 231 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 393 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334

                                                                       
Query: 291 gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
           ||| ||||||||||||||||| || || |||||||| ||||||||||||||||| || ||
Sbjct: 333 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 274

                                                                       
Query: 351 gagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggac 410
           |   ||||||   |||||||| |||||||||||||||||||||||||||||||| || ||
Sbjct: 273 ggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgcac 214

                                            
Query: 411 caggcgctggaagggcagcttgcggatcagcag 443
           ||| |||||||| || ||||| |||||||||||
Sbjct: 213 cagccgctggaacgggagcttccggatcagcag 181



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  264 bits (133), Expect = 2e-67
 Identities = 193/213 (90%)
 Strand = Plus / Minus

                                                                            
Query: 231      gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 20749045 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 20748986

                                                                            
Query: 291      gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
                ||| ||||||||||||||||| || || |||||||| ||||||||||||||||| || ||
Sbjct: 20748985 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 20748926

                                                                            
Query: 351      gagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggac 410
                |   ||||||   |||||||| |||||||||||||||||||||||||||||||| || ||
Sbjct: 20748925 ggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgcac 20748866

                                                 
Query: 411      caggcgctggaagggcagcttgcggatcagcag 443
                ||| |||||||| || ||||| |||||||||||
Sbjct: 20748865 cagccgctggaacgggagcttccggatcagcag 20748833



 Score =  129 bits (65), Expect = 8e-27
 Identities = 101/113 (89%)
 Strand = Plus / Minus

                                                                            
Query: 244      agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtg 303
                ||||| |||||||||||||||||||| || |||||||| ||||||||||| |||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                                                     
Query: 304      tcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcac 356
                |||||||| || ||||| |||||||||||||| || ||||| ||||| |||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctcggcagcttcctgaagggcaagcac 22438249



 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 324      gtacgcctcggcggcctcct 343
                ||||||||||||||||||||
Sbjct: 25160884 gtacgcctcggcggcctcct 25160865



to top

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  264 bits (133), Expect = 2e-67
 Identities = 193/213 (90%)
 Strand = Plus / Minus

                                                                         
Query: 231   gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95196 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 95137

                                                                         
Query: 291   gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
             ||| ||||||||||||||||| || || |||||||| ||||||||||||||||| || ||
Sbjct: 95136 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 95077

                                                                         
Query: 351   gagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggac 410
             |   ||||||   |||||||| |||||||||||||||||||||||||||||||| || ||
Sbjct: 95076 ggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgcac 95017

                                              
Query: 411   caggcgctggaagggcagcttgcggatcagcag 443
             ||| |||||||| || ||||| |||||||||||
Sbjct: 95016 cagccgctggaacgggagcttccggatcagcag 94984



to top

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  262 bits (132), Expect = 9e-67
 Identities = 201/224 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||
Sbjct: 458 gcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcc 399

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||||||||||||||||||||||
Sbjct: 398 tcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 339

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 338 atctcgcgcaccagccgctggaacggcagcttgcggatcagcag 295



to top

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  262 bits (132), Expect = 9e-67
 Identities = 201/224 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           |||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||
Sbjct: 458 gcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcc 399

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||||||||||||||||||||||
Sbjct: 398 tcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 339

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 338 atctcgcgcaccagccgctggaacggcagcttgcggatcagcag 295



to top

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  262 bits (132), Expect = 9e-67
 Identities = 183/200 (91%)
 Strand = Plus / Minus

                                                                       
Query: 244 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtg 303
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                                       
Query: 304 tcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgg 363
           |||||||| |||||    ||||| |||||||| |||||||||||||| ||||||||||||
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggagggccagcacggcgtgg 375

                                                                       
Query: 364 gactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaag 423
           |||||||| | |||||| |||||||||||||| |||||||| |  |||||||||||||| 
Sbjct: 374 gactggaacctgaggtcggtcttgaagtcctgagcgatctccctcaccaggcgctggaac 315

                               
Query: 424 ggcagcttgcggatcagcag 443
           ||||||||||||||||||||
Sbjct: 314 ggcagcttgcggatcagcag 295



to top

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 542 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 483

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 482 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 423

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 422 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 363

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 362 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 316



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 1679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1620

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 1619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 1560

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 1559 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 1513



to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 1679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1620

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 1619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 1560

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 1559 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 1513



to top

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            |||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||
Sbjct: 2762 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 2703

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||   
Sbjct: 2702 ttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctc 2643

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 2642 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2583

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 2582 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 2536



to top

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Plus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1191 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1250

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 1251 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1310

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 1311 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 1370

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 1371 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 1417



to top

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 987 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 928

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 927 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 868

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 867 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 808

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 807 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 761



to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 2722 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2663

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 2662 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2603

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 2602 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2543

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 2542 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 2496



to top

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 728

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  260 bits (131), Expect = 3e-66
 Identities = 206/231 (89%)
 Strand = Plus / Plus

                                                                          
Query: 213    ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 272
              |||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 102348 ctaggctcgctccccgcggatgcggcgggccagctggatgtctttgggcatgatggtgac 102407

                                                                          
Query: 273    gcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctc 332
               |||||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 102408 ccgcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctc 102467

                                                                          
Query: 333    ggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtc 392
              |  || |||||| ||||| |  ||||||  |  ||||||||| ||||| |||||||||||
Sbjct: 102468 gctggactcctgcagggccatgacggcggagctctggaagcgcaggtcggtcttgaagtc 102527

                                                                 
Query: 393    ctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||||||||| || || ||||||||||||||||||||||||||||||||
Sbjct: 102528 ctgcgcgatctcccgcacgaggcgctggaagggcagcttgcggatcagcag 102578



to top

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 608 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 549

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 548 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 489

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 488 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 429

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 428 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 382



to top

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 728

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1
           (LOC310679), mRNA
          Length = 573

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||||||||||||||| ||||| | |||||||||||||||||||||||||||||||
Sbjct: 569 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 510

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||   
Sbjct: 509 ttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctc 450

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 449 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 390

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 389 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 343



to top

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 728

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 1093 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1034

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 1033 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 974

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 973  gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 914

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 913  gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 867



to top

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Plus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 514 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 573

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 574 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 633

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 634 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 693

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 694 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 740



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 93739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 93680

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 93679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 93620

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 93619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 93560

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 93559 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 93513



 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 71931 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 71872

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 71871 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 71812

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 71811 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 71752

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 71751 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 71705



 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Plus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 63174 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 63233

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 63234 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 63293

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 63294 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 63353

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 63354 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 63400



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 37519 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 37460

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 37459 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 37400

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 37399 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 37340

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 37339 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 37293



 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Plus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 28762 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 28821

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 28822 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 28881

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 28882 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 28941

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 28942 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 28988



 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Plus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 6954 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 7013

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 7014 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 7073

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 7074 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 7133

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 7134 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 7180



to top

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  260 bits (131), Expect = 3e-66
 Identities = 203/227 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 746 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 687

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 686 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 627

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 626 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 567

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 566 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 520



to top

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| |||||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||| ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccagccgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 462 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 403

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 402 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 343

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 342 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 283

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 282 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 241



to top

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 391

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 390 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 331

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 330 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 271

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 270 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 229



to top

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 495 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 436

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 435 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 376

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 375 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 316

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 315 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 274



to top

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  258 bits (130), Expect = 1e-65
 Identities = 199/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted)
           (Hist2h3c2_predicted), mRNA
          Length = 411

 Score =  258 bits (130), Expect = 1e-65
 Identities = 205/230 (89%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||
Sbjct: 410 taggcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           || ||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 350 cgtttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcg 291

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
              |||||||| || || |  |||||   |  ||||||||| ||||||||||||||||||
Sbjct: 290 ctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcc 231

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 230 tgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>gb|U16725.1|CRU16725 Chlamydomonas reinhardtii histone H3 (ch3-III), histone H4
           (ch4-III), histone H2B (ch2b-III) and histone H2A
           (ch2a-III) genes, complete cds
          Length = 4582

 Score =  258 bits (130), Expect = 1e-65
 Identities = 205/230 (89%)
 Strand = Plus / Plus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||| || |||||||||||||| |||||||||||||||||||||||||| || 
Sbjct: 465 taggcacgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 524

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||| 
Sbjct: 525 cgcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctca 584

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
           ||||||||||| || || |||||||| |||  ||||||||| ||||| ||||||||||||
Sbjct: 585 gcggcctcctgcagcgccagcacggcctggctctggaagcgcaggtcggtcttgaagtcc 644

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || || ||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 645 tgggcaatctcacggaccaggcgctggaacggcagcttgcggatgagcag 694



to top

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  256 bits (129), Expect = 5e-65
 Identities = 192/213 (90%)
 Strand = Plus / Plus

                                                                       
Query: 231 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
           |||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||
Sbjct: 168 gatgcggcgggcgagctggatgtccttgggcatgatggtgaccctcttggcgtggatggc 227

                                                                       
Query: 291 gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
           ||| ||||||||||||||||| |||||||| ||||||||||| ||||||||||| || ||
Sbjct: 228 gcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcggcctcctgcagcgc 287

                                                                       
Query: 351 gagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggac 410
              ||| ||    |||||||| || |||||||||||||||||||||||||||||||| ||
Sbjct: 288 cgccaccgccgacgactggaaccgcaggtccgtcttgaagtcctgcgcgatctcgcgaac 347

                                            
Query: 411 caggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||||| ||||||||||| |||||
Sbjct: 348 caggcgctggaaggggagcttgcggatgagcag 380



to top

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  256 bits (129), Expect = 5e-65
 Identities = 198/221 (89%)
 Strand = Plus / Minus

                                                                       
Query: 223 tccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcg 282
           ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 401 tccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcg 342

                                                                       
Query: 283 tggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcc 342
           ||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   ||||||
Sbjct: 341 tggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcc 282

                                                                       
Query: 343 tggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatc 402
           || || || |  |||||   |  ||||||||| ||||| |||||||||||||||||||||
Sbjct: 281 tgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatc 222

                                                    
Query: 403 tcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 221 tcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>gb|U16825.1|CRU16825 Chlamydomonas reinhardtii histone H3 (ch3-I) and histone H4 (ch4-I)
           genes, complete cds
          Length = 1338

 Score =  254 bits (128), Expect = 2e-64
 Identities = 200/224 (89%)
 Strand = Plus / Plus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||||||||| || |||||||||||||| |||||||||||||||||||||||||| || 
Sbjct: 201 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 260

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| ||||| ||||||||||| || ||||| ||||| ||||| 
Sbjct: 261 cgcttggcgtggatggcgcacaggttcgtgtcctcgaacaggcccaccaggtaggcctca 320

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
           ||||||||||| || || |||||||| |||  ||||||||| ||||| ||||||||||||
Sbjct: 321 gcggcctcctgcagcgccagcacggcctggctctggaagcgcaggtcggtcttgaagtcc 380

                                                       
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
           || || ||||| ||||||||||||||||| ||||||||||||||
Sbjct: 381 tgggcaatctcacggaccaggcgctggaacggcagcttgcggat 424



to top

>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559
           IMAGE:4240748), complete cds
          Length = 1124

 Score =  252 bits (127), Expect = 8e-64
 Identities = 202/227 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| || || ||||||   
Sbjct: 533 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctc 474

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 473 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 414

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 413 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 367



to top

>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA
          Length = 1124

 Score =  252 bits (127), Expect = 8e-64
 Identities = 202/227 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| |||||||| || || ||||||   
Sbjct: 533 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctc 474

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 473 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 414

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 413 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 367



to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  252 bits (127), Expect = 8e-64
 Identities = 202/227 (88%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            |||||||| || |||||||||||| | | |||||||||||||||||||||||||||||||
Sbjct: 2548 gcgcgctcaccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgc 2489

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 2488 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2429

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 2428 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2369

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 2368 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 2322



to top

>ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476), mRNA
          Length = 576

 Score =  250 bits (126), Expect = 3e-63
 Identities = 204/230 (88%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 575 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 516

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||| ||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||
Sbjct: 515 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 456

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||||||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||
Sbjct: 455 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 396

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 395 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag 346



to top

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  250 bits (126), Expect = 3e-63
 Identities = 194/214 (90%), Gaps = 2/214 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 453 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 394

                                                                       
Query: 291 gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
           ||| ||| | |||||||| || |||||||||||||| ||||||||||||||||| || ||
Sbjct: 393 gcacagggtagtgtcctcaaagagccccacgaggtaggcctcggcggcctcctgcagcgc 334

                                                                       
Query: 351 -gagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgga 409
            ||| ||||||  ||||||||||||||| || ||||||||| ||||||||||||| ||||
Sbjct: 333 agag-acggcggaggactggaagcggagatcggtcttgaagccctgcgcgatctcacgga 275

                                             
Query: 410 ccaggcgctggaagggcagcttgcggatcagcag 443
           | |||||||||||||||| ||||||||| |||||
Sbjct: 274 cgaggcgctggaagggcaacttgcggatgagcag 241



to top

>ref|XM_871261.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618948), mRNA
          Length = 484

 Score =  250 bits (126), Expect = 3e-63
 Identities = 198/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| |||||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||| ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccagccgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_591827.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC540148), mRNA
          Length = 484

 Score =  250 bits (126), Expect = 3e-63
 Identities = 198/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcgaatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| |||||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||| ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccagccgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_601510.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC523214), mRNA
          Length = 1459

 Score =  250 bits (126), Expect = 3e-63
 Identities = 195/218 (89%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 918 ccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 859

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           ||||| |||||||||||||||||||| |||||||| ||||| ||||||   |||||||| 
Sbjct: 858 atggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcctgc 799

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || | ||| ||   |  ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 798 agcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 739

                                                 
Query: 406 cggaccaggcgctggaagggcagcttgcggatcagcag 443
           || ||||| |||||||| ||||||||||||||||||||
Sbjct: 738 cgcaccagccgctggaacggcagcttgcggatcagcag 701



to top

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  250 bits (126), Expect = 3e-63
 Identities = 198/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 433 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 374

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 373 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 314

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 313 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 254

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 253 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 212



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
             (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
             IgG, high affinity Ia, receptor for (CD64), a novel gene
             similar to histone 2, H2be (HIST2H2BE), a novel gene
             similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
             histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
             HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
             pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
             (HIST2H2BC), a novel gene similar to histone 2, H2aa
             (HIST2H2AA), a novel gene similar to histone 2, H3c
             (HIST2H3C), a novel gene similar to histone 1, H4
             (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
             HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
             histone 2, H2ab, a novel protein similar to histone 2, a
             novel gene, the SV2A gene for synaptic vesicle
             glycoprotein 2A, the 3' end of the SF3B4 gene for splicing
             factor 3b, subunit 4, 49kDa and five CpG islands, complete
             sequence
          Length = 188956

 Score =  250 bits (126), Expect = 3e-63
 Identities = 204/230 (88%)
 Strand = Plus / Plus

                                                                         
Query: 214   taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
             ||||| ||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046

                                                                         
Query: 274   cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
             |||||||| ||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||
Sbjct: 75047 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 75106

                                                                         
Query: 334   gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
               ||||||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||
Sbjct: 75107 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 75166

                                                               
Query: 394   tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 75167 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag 75216



 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                          
Query: 220    cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
              ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 114780 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 114721

                                                                          
Query: 280    gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
              |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 114720 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 114661

                                                                          
Query: 340    tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
              ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 114660 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 114601

                                                          
Query: 400    atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 114600 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 114557



 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Plus

                                                                          
Query: 220    cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
              ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 102486 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 102545

                                                                          
Query: 280    gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
              |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 102546 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 102605

                                                                          
Query: 340    tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
              ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 102606 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 102665

                                                          
Query: 400    atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 102666 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 102709



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  250 bits (126), Expect = 3e-63
 Identities = 198/222 (89%)
 Strand = Plus / Minus

                                                                          
Query: 222    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
              ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 139050 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 138991

                                                                          
Query: 282    gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
              |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 138990 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 138931

                                                                          
Query: 342    ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
              ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 138930 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 138871

                                                        
Query: 402    ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 138870 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 138829



 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Plus

                                                                          
Query: 222    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
              ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 203959 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 204018

                                                                          
Query: 282    gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
              |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 204019 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 204078

                                                                          
Query: 342    ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
              ||| || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 204079 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 204138

                                                        
Query: 402    ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 204139 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 204180



to top

>ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, family 2 isoform 2
           (LOC653604), mRNA
          Length = 543

 Score =  250 bits (126), Expect = 3e-63
 Identities = 204/230 (88%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 542 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 483

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||| ||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||
Sbjct: 482 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 423

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||||||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||
Sbjct: 422 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 363

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 362 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag 313



to top

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  250 bits (126), Expect = 3e-63
 Identities = 198/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 783

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  250 bits (126), Expect = 3e-63
 Identities = 198/222 (89%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 740 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 681

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 680 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 621

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 620 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 561

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 560 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 519



to top

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  250 bits (126), Expect = 3e-63
 Identities = 194/214 (90%), Gaps = 2/214 (0%)
 Strand = Plus / Minus

                                                                       
Query: 231 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 290
           ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||
Sbjct: 918 gatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatggc 859

                                                                       
Query: 291 gcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggc 350
           ||| ||||| |||||||| || |||||||| ||||| ||||||||||||||||| || ||
Sbjct: 858 gcagaggttagtgtcctcaaagagccccacaaggtaggcctcggcggcctcctgcagcgc 799

                                                                       
Query: 351 gagc-acggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgga 409
            ||| ||||||  ||||||||||||||| || ||||||||||||||||||||||| ||||
Sbjct: 798 -agcgacggcggaggactggaagcggagatcggtcttgaagtcctgcgcgatctcacgga 740

                                             
Query: 410 ccaggcgctggaagggcagcttgcggatcagcag 443
           | |||||||||||||||| ||||||||| |||||
Sbjct: 739 cgaggcgctggaagggcaacttgcggatgagcag 706



to top

>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence
          Length = 188026

 Score =  246 bits (124), Expect = 5e-62
 Identities = 205/232 (88%)
 Strand = Plus / Plus

                                                                          
Query: 212    cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 271
              ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 183192 cctaggcccgctccccgcggatgcggcgggccagctggatgtccttgggcatgatagtca 183251

                                                                          
Query: 272    cgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcct 331
              |||||||||||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||
Sbjct: 183252 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 183311

                                                                          
Query: 332    cggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagt 391
              ||  ||||||||| || || | ||||||   |  ||||||||| ||||||||||| ||||
Sbjct: 183312 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 183371

                                                                  
Query: 392    cctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              ||||||| |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 183372 cctgcgctatctcgcgcaccagtcgctggaaaggcagcttgcggatcagcag 183423



to top

>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1,
           mRNA
          Length = 411

 Score =  244 bits (123), Expect = 2e-61
 Identities = 201/227 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           |||||||| |||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 347 ttggcgtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||| |||| ||||||||| ||||||||||||||||||||
Sbjct: 227 gcgatctcgcgcaccaagcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_870218.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC617888), mRNA
          Length = 714

 Score =  244 bits (123), Expect = 2e-61
 Identities = 204/231 (88%)
 Strand = Plus / Minus

                                                                       
Query: 213 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 272
           |||||| | ||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 714 ctaggccctctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgac 655

                                                                       
Query: 273 gcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctc 332
           |||||||||||||||||| || ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 654 gcgcttggcgtggatggcacacaggttggtgtcctcgaagagtcccaccaggtaggcctc 595

                                                                       
Query: 333 ggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtc 392
           |   |||||||| || || | ||| ||   |  ||||||||| ||||| |||||||||||
Sbjct: 594 gcacgcctcctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtc 535

                                                              
Query: 393 ctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 534 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcag 484



to top

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score =  244 bits (123), Expect = 2e-61
 Identities = 201/227 (88%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| 
Sbjct: 2579 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2520

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            |||||||| |||||||| ||||||||||||||||| |||||||| ||||| ||||||   
Sbjct: 2519 ttggcgtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2460

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || |  |||||   |  ||||||||| |||||||||||||||||||||
Sbjct: 2459 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2400

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| |||| ||||||||| ||||||||||||||||||||
Sbjct: 2399 gcgatctcgcgcaccaagcgctggaacggcagcttgcggatcagcag 2353



to top

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score =  242 bits (122), Expect = 8e-61
 Identities = 197/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 430 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 370 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 311

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 310 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 251

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 250 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 209



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  242 bits (122), Expect = 8e-61
 Identities = 197/222 (88%)
 Strand = Plus / Plus

                                                                         
Query: 222   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
             ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 99531 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 99590

                                                                         
Query: 282   gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
             |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 99591 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 99650

                                                                         
Query: 342   ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
             ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 99651 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 99710

                                                       
Query: 402   ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 99711 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 99752



 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                         
Query: 220   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
             ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 73416 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 73357

                                                                         
Query: 280   gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
             |||||||||||||| |||||||||||||| || || ||||||||||| ||||||   |||
Sbjct: 73356 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 73297

                                                                         
Query: 340   tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
             ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 73296 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 73237

                                                         
Query: 400   atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 73236 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 73193



 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Plus

                                                                         
Query: 220   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
             ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 90490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 90549

                                                                         
Query: 280   gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
             |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 90550 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 90609

                                                                         
Query: 340   tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
             ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 90610 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 90669

                                                         
Query: 400   atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 90670 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 90713



 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Plus

                                                                         
Query: 222   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
             |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 59175 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 59234

                                                                         
Query: 282   gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
             ||||||||| || |||||||||||||| || || ||||||||||| ||||||   |||||
Sbjct: 59235 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 59294

                                                                         
Query: 342   ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
             ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 59295 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 59354

                                                       
Query: 402   ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 59355 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 59396



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  242 bits (122), Expect = 8e-61
 Identities = 197/222 (88%)
 Strand = Plus / Minus

                                                                         
Query: 222   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
             ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 16449 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 16390

                                                                         
Query: 282   gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
             |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 16389 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 16330

                                                                         
Query: 342   ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
             ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 16329 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 16270

                                                       
Query: 402   ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 16269 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 16228



 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Plus

                                                                         
Query: 220   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
             ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 42568 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 42627

                                                                         
Query: 280   gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
             |||||||||||||| |||||||||||||| || || ||||||||||| ||||||   |||
Sbjct: 42628 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 42687

                                                                         
Query: 340   tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
             ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 42688 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 42747

                                                         
Query: 400   atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 42748 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 42791



 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                         
Query: 220   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
             ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 25490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 25431

                                                                         
Query: 280   gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
             |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 25430 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 25371

                                                                         
Query: 340   tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
             ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 25370 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 25311

                                                         
Query: 400   atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 25310 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 25267



 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Minus

                                                                         
Query: 222   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
             |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 56809 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 56750

                                                                         
Query: 282   gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
             ||||||||| || |||||||||||||| || || ||||||||||| ||||||   |||||
Sbjct: 56749 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 56690

                                                                         
Query: 342   ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
             ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 56689 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 56630

                                                       
Query: 402   ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 56629 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 56588



to top

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score =  242 bits (122), Expect = 8e-61
 Identities = 197/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 899 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 840

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 839 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 780

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 779 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 720

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 719 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 678



to top

>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II),
           histone H2B (ch2b-II) and histone H2A (ch2a-II) genes,
           complete cds
          Length = 3777

 Score =  242 bits (122), Expect = 8e-61
 Identities = 203/230 (88%)
 Strand = Plus / Plus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||| || |||||||||||||| ||||||||||||||||||||||| || || 
Sbjct: 245 taggcacgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtcaca 304

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||
Sbjct: 305 cgcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctcg 364

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
           ||||||||||| || || |||||||| |||   ||||| || ||||| ||||||||||||
Sbjct: 365 gcggcctcctgtagcgccagcacggcctggctttggaaacgcaggtcggtcttgaagtcc 424

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || || ||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 425 tgggcaatctcacggaccaggcgctggaacggcagcttgcggatgagcag 474



to top

>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3
          Length = 1244

 Score =  242 bits (122), Expect = 8e-61
 Identities = 197/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 694 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 635

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 634 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 575

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 574 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 533



to top

>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds
          Length = 1125

 Score =  242 bits (122), Expect = 8e-61
 Identities = 197/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 694 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 635

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 634 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 575

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 574 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 533



to top

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 402 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 343

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||
Sbjct: 342 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcc 283

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 282 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 223

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 179



to top

>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA
          Length = 507

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 380 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 321

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 320 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 261

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 260 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 217



to top

>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds
          Length = 1227

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 753 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 694

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 693 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 634

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 633 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 590



to top

>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA
          Length = 411

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 404 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||||||||| ||||||   |||
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 285

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 284 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 225

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 224 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone
           ****
          Length = 1047

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 417 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 358

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 357 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 298

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 297 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 238

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 237 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 194



to top

>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365)
          Length = 1672

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 380 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 321

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 320 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 261

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 260 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 217



to top

>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA
          Length = 824

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 693 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 634

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 633 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 574

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 573 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 514

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 513 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 470



to top

>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds
          Length = 1100

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 890 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 831

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||||||||| ||||||   |||
Sbjct: 830 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 771

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 770 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 711

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 710 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 667



to top

>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1
          Length = 1323

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 867 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 808

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 807 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 748

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 747 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 704



to top

>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA
          Length = 411

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 404 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 345

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 344 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 285

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 284 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 225

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 224 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 181



to top

>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509),
           partial cds
          Length = 481

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 432 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 373

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 372 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 313

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 312 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 253

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 252 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 209



to top

>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds
          Length = 1227

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 753 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 694

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 693 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 634

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 633 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 590



to top

>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence
          Length = 1323

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||||||||| ||||| |||||||||
Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||||  ||||
Sbjct: 867 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 808

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||| ||||||||||||
Sbjct: 807 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 748

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 747 atctcgcgtaccagccgctggaagggcagcttgcggatcagcag 704



to top

>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds
          Length = 1408

 Score =  238 bits (120), Expect = 1e-59
 Identities = 198/224 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 904 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 845

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||||||||| ||||||   |||
Sbjct: 844 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 785

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 784 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 725

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 724 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>emb|X06964.1|VCHIS34A Volvox carteri H3-II and H4-II genes for histones H3 and H4
          Length = 1504

 Score =  236 bits (119), Expect = 5e-59
 Identities = 200/227 (88%)
 Strand = Plus / Minus

                                                                        
Query: 217  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
            |||||||| || |||||||| ||||| |||||||||||||||||||||||||||||||||
Sbjct: 1157 gcgcgctcgccacggatgcgacgggccagctggatgtccttgggcatgatggtgacgcgc 1098

                                                                        
Query: 277  ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
            ||||||||||||||||||||||| ||||||||||| |  ||||| ||||| ||||| || 
Sbjct: 1097 ttggcgtggatggcgcaaaggttagtgtcctcgaacaagcccaccaggtaggcctcagca 1038

                                                                        
Query: 337  gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
            |||||||| || || ||||| || |||  ||||||||| || || |||||||||||||| 
Sbjct: 1037 gcctcctgcagcgccagcaccgcctggctctggaagcgcagatcggtcttgaagtcctga 978

                                                           
Query: 397  gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||||||||| ||||| ||||||||||| ||||||||||| |||||
Sbjct: 977  gcgatctcgcgcaccagccgctggaaggggagcttgcggatgagcag 931



to top

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|NM_175653.1| Mus musculus histone1, H3c (Hist1h3c), mRNA
          Length = 480

 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 422 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 363

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           |||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||||| 
Sbjct: 362 atggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgc 303

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 302 agagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 243

                                                 
Query: 406 cggaccaggcgctggaagggcagcttgcggatcagcag 443
           || |||||||||||||| ||||||||||||||||||||
Sbjct: 242 cgcaccaggcgctggaacggcagcttgcggatcagcag 205



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Plus

                                                                        
Query: 222  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
            ||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 2135 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 2194

                                                                        
Query: 282  gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
            |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 2195 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 2254

                                                                        
Query: 342  ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
            ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 2255 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 2314

                                                      
Query: 402  ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 2315 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 2356



to top

>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143
          Length = 3210

 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Minus

                                                                        
Query: 226  ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
            ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 3032 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 2973

                                                                        
Query: 286  atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
            |||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||||| 
Sbjct: 2972 atggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgc 2913

                                                                        
Query: 346  agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
            || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 2912 agagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 2853

                                                  
Query: 406  cggaccaggcgctggaagggcagcttgcggatcagcag 443
            || |||||||||||||| ||||||||||||||||||||
Sbjct: 2852 cgcaccaggcgctggaacggcagcttgcggatcagcag 2815



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Minus

                                                                          
Query: 226    ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 143278 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 143219

                                                                          
Query: 286    atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
              |||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||||| 
Sbjct: 143218 atggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgc 143159

                                                                          
Query: 346    agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
              || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 143158 agagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 143099

                                                    
Query: 406    cggaccaggcgctggaagggcagcttgcggatcagcag 443
              || |||||||||||||| ||||||||||||||||||||
Sbjct: 143098 cgcaccaggcgctggaacggcagcttgcggatcagcag 143061



 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Plus

                                                                          
Query: 222    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
              |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 135597 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 135656

                                                                          
Query: 282    gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
              |||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||
Sbjct: 135657 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctc 135716

                                                                          
Query: 342    ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
              ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 135717 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 135776

                                                        
Query: 402    ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 135777 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 135818



 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                          
Query: 222    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
              ||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 126426 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 126367

                                                                          
Query: 282    gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
              |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 126366 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 126307

                                                                          
Query: 342    ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
              ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 126306 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 126247

                                                        
Query: 402    ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 126246 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 126205



to top

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 415 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 356

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 355 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 296

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 295 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 236

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 235 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 194



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 753 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 694

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 693 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 634

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 633 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 574

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 573 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 532



to top

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 783

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  234 bits (118), Expect = 2e-58
 Identities = 196/222 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 902 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctc 783

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>gb|AY158950.1| Mus musculus histone protein Hist1h3c gene, complete cds
          Length = 1408

 Score =  234 bits (118), Expect = 2e-58
 Identities = 193/218 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 898 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 839

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           |||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||||| 
Sbjct: 838 atggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgc 779

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 778 agagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 719

                                                 
Query: 406 cggaccaggcgctggaagggcagcttgcggatcagcag 443
           || |||||||||||||| ||||||||||||||||||||
Sbjct: 718 cgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and
           histone H2A genes, complete cds
          Length = 4358

 Score =  234 bits (118), Expect = 2e-58
 Identities = 202/230 (87%)
 Strand = Plus / Plus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||||||||| || |||||||||||||| |||||||||||||||||||||||||| || 
Sbjct: 267 taggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatggtcaca 326

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||  ||||||||| ||||||||||||||||| || ||||| ||||| ||||| 
Sbjct: 327 cgcttggcggtgatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctca 386

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
           ||||||||||| || || |  ||||| |||  ||||||||| ||||| ||||||||||||
Sbjct: 387 gcggcctcctgcagcgccacgacggcctggctctggaagcgcaggtcggtcttgaagtcc 446

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || || ||||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 447 tgggcaatctcacggaccaggcgctggaacggcagcttgcggatgagcag 496



to top

>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene
          Length = 921

 Score =  232 bits (117), Expect = 8e-58
 Identities = 201/229 (87%)
 Strand = Plus / Minus

                                                                       
Query: 215 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 274
           ||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 749 aggcgcgctccccgcggatgcggcgggtgagctggatgtccttgggcatgatggagacgc 690

                                                                       
Query: 275 gcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcgg 334
           ||||||| ||||||||||| |||||||||||||| || |||||||| ||||| |||||| 
Sbjct: 689 gcttggcatggatggcgcagaggttggtgtcctcaaagagccccaccaggtaggcctcgc 630

                                                                       
Query: 335 cggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcct 394
            ||||||||| || || | ||||||      ||||||||| || || |||||||||||||
Sbjct: 629 tggcctcctgcagtgccatcacggctgaactctggaagcgcagatcggtcttgaagtcct 570

                                                            
Query: 395 gcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           | || |||||||| ||||| ||||||||||||||||||| |||||||||
Sbjct: 569 gtgcaatctcgcgcaccagccgctggaagggcagcttgcagatcagcag 521



to top

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 864 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 805

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 804 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 745

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 744 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 701



to top

>ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC619165), partial mRNA
          Length = 552

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           |||||||||||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 469 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 410

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| || || |||||||| ||||| ||||||   |||
Sbjct: 409 gcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctcgcc 350

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||||||||||||||||
Sbjct: 349 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 290

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 289 atctcgcgcaccagccgctggaacggcagcttgcggatcagcag 246



to top

>ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC619141), partial mRNA
          Length = 552

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           |||||||||||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 469 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 410

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| || || |||||||| ||||| ||||||   |||
Sbjct: 409 gcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctcgcc 350

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||||||||||||||||
Sbjct: 349 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 290

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 289 atctcgcgcaccagccgctggaacggcagcttgcggatcagcag 246



to top

>ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
            (LOC615056), mRNA
          Length = 1029

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                        
Query: 220  cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
            |||||||||||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 1022 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 963

                                                                        
Query: 280  gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
            |||||||||||||| ||||| ||||| || || |||||||| ||||| ||||||   |||
Sbjct: 962  gcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctcgcc 903

                                                                        
Query: 340  tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
            ||||| || || | ||||||   |  ||||||||| ||||||||||||||||||||||||
Sbjct: 902  tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 843

                                                        
Query: 400  atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 842  atctcgcgcaccagccgctggaacggcagcttgcggatcagcag 799



to top

>ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, family 2 isoform 2
           (LOC615006), mRNA
          Length = 886

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           |||||||||||||||||||| || ||||||||||| |||||||||||||| |||||||||
Sbjct: 803 cgctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtcacgcgcttg 744

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||| || || |||||||| ||||| ||||||   |||
Sbjct: 743 gcgtggatggcgcacaggttcgtgtcttcaaacagccccaccaggtaggcctcgctcgcc 684

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || | ||||||   |  ||||||||| ||||||||||||||||||||||||
Sbjct: 683 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 624

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 623 atctcgcgcaccagccgctggaacggcagcttgcggatcagcag 580



to top

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 614



to top

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  230 bits (116), Expect = 3e-57
 Identities = 170/188 (90%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || |||||||| |||||||  |||||||| || || |  ||||||  |  |||||||
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 248 cggaggtcggtcttgaagtcctgggcgatctcgcggaccaggcgctggaagggcagcttg 189

                   
Query: 433 cggatcag 440
           ||||||||
Sbjct: 188 cggatcag 181



to top

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 426 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 367

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 366 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 307

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 306 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 247

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 246 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 203



to top

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 864 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 805

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 804 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 745

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 744 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 701



to top

>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923
           IMAGE:40044769), complete cds
          Length = 1004

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 614



to top

>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922
           IMAGE:40044765), complete cds
          Length = 1004

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 614



to top

>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924
           IMAGE:40044770), complete cds
          Length = 1004

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 614



to top

>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds
          Length = 982

 Score =  230 bits (116), Expect = 3e-57
 Identities = 197/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 812 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 753

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 752 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 693

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 692 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 633

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 632 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 589



to top

>emb|CR716243.2|CNS0GFLO Tetraodon nigroviridis full-length cDNA
          Length = 844

 Score =  228 bits (115), Expect = 1e-56
 Identities = 202/231 (87%)
 Strand = Plus / Minus

                                                                       
Query: 213 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 272
           |||||| | |||||||||||||||||| || ||||||||||| |||||||||||||||||
Sbjct: 648 ctaggccctctccccgcggatgcggcgagccagctggatgtctttgggcatgatggtgac 589

                                                                       
Query: 273 gcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctc 332
            | |||||||||||||||||| ||||||||||||||||| || ||||| ||||| |||||
Sbjct: 588 cctcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaggcctc 529

                                                                       
Query: 333 ggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtc 392
           |   |||||||| ||||| | ||| ||   |  ||||||||| |||||||||||||||||
Sbjct: 528 gctcgcctcctgcagggccatcacagccgagctctggaagcgcaggtccgtcttgaagtc 469

                                                              
Query: 393 ctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||| |  ||||||||||||||||||||||||||||| |||||
Sbjct: 468 ctgcgcgatctccctcaccaggcgctggaagggcagcttgcggatgagcag 418



to top

>gb|AF361949.1| Eimeria tenella histone 3 (H3) mRNA, complete cds
          Length = 411

 Score =  228 bits (115), Expect = 1e-56
 Identities = 184/207 (88%)
 Strand = Plus / Minus

                                                                       
Query: 237 gcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaag 296
           |||||| || ||||||||||| |||||||| ||||||||||| |||||||||||||| | 
Sbjct: 387 gcgggccagttggatgtcctttggcatgattgtgacgcgctttgcgtggatggcgcacaa 328

                                                                       
Query: 297 gttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcac 356
           ||| ||||| |||||||| ||||||||||||||||| || |||||||| || ||||||||
Sbjct: 327 gtttgtgtcttcgaaaagacccacgaggtacgcctccgcagcctcctgcagcgcgagcac 268

                                                                       
Query: 357 ggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcg 416
            |||  ||||||||| || | |||||||||||||||||||||||||||||||||||| ||
Sbjct: 267 cgcggaggactggaaacgcaagtccgtcttgaagtcctgcgcgatctcgcggaccagccg 208

                                      
Query: 417 ctggaagggcagcttgcggatcagcag 443
           |||||| ||||||||||| ||||||||
Sbjct: 207 ctggaaaggcagcttgcgaatcagcag 181



to top

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  228 bits (115), Expect = 1e-56
 Identities = 190/215 (88%)
 Strand = Plus / Plus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 129 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 188

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           |||||||| ||||||||||||||||| || || |||||||| ||||||  ||||||||||
Sbjct: 189 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 248

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || |  ||||||  |  ||||||||| ||||| |||||||||||||| |||||||| 
Sbjct: 249 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 308

                                              
Query: 406 cggaccaggcgctggaagggcagcttgcggatcag 440
           |||||||| ||||||||||||||||||||||||||
Sbjct: 309 cggaccagacgctggaagggcagcttgcggatcag 343



to top

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  228 bits (115), Expect = 1e-56
 Identities = 190/215 (88%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 389 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 330

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           |||||||| ||||||||||||||||| || || |||||||| ||||||  ||||||||||
Sbjct: 329 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 270

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || |  ||||||  |  ||||||||| ||||| |||||||||||||| |||||||| 
Sbjct: 269 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 210

                                              
Query: 406 cggaccaggcgctggaagggcagcttgcggatcag 440
           |||||||| ||||||||||||||||||||||||||
Sbjct: 209 cggaccagacgctggaagggcagcttgcggatcag 175



to top

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  228 bits (115), Expect = 1e-56
 Identities = 190/215 (88%)
 Strand = Plus / Plus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 50  ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 109

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           |||||||| ||||||||||||||||| || || |||||||| ||||||  ||||||||||
Sbjct: 110 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 169

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || |  ||||||  |  ||||||||| ||||| |||||||||||||| |||||||| 
Sbjct: 170 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 229

                                              
Query: 406 cggaccaggcgctggaagggcagcttgcggatcag 440
           |||||||| ||||||||||||||||||||||||||
Sbjct: 230 cggaccagacgctggaagggcagcttgcggatcag 264



to top

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  228 bits (115), Expect = 1e-56
 Identities = 190/215 (88%)
 Strand = Plus / Plus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 103 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 162

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           |||||||| ||||||||||||||||| || || |||||||| ||||||  ||||||||||
Sbjct: 163 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 222

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || |  ||||||  |  ||||||||| ||||| |||||||||||||| |||||||| 
Sbjct: 223 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 282

                                              
Query: 406 cggaccaggcgctggaagggcagcttgcggatcag 440
           |||||||| ||||||||||||||||||||||||||
Sbjct: 283 cggaccagacgctggaagggcagcttgcggatcag 317



to top

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  228 bits (115), Expect = 1e-56
 Identities = 198/227 (87%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 479 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgc 420

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| |||||||| || ||||| ||||  ||||||||  | ||||||
Sbjct: 419 ttggcgtggatggcgcagaggttggtntcntcgaagagccngacgaggtagccttcggcg 360

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           || || ||||| |||   ||||||  |  |||||| ||||||||||| | |||||| |||
Sbjct: 359 gcttcttggagcgcggcgacggcggagctctggaaccggaggtccgtntagaagtcatgc 300

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| ||||| || ||||||||||| |||||||||||||||||
Sbjct: 299 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcag 253



to top

>gb|AY749701.1| Paraleptophlebia vaciva histone H3 (H3) gene, partial cds
          Length = 375

 Score =  228 bits (115), Expect = 1e-56
 Identities = 172/191 (90%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcatggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || ||||| ||||| ||||||  ||||||||| || || | |||||||  |  |||||||
Sbjct: 311 agacccaccaggtaggcctcgctggcctcctgcagagccatcacggcgctgctctggaag 252

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           |||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgagcgatctcacggaccaggcgctggaagggcagcttg 192

                      
Query: 433 cggatcagcag 443
           |||||||||||
Sbjct: 191 cggatcagcag 181



to top

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 376 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 317

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| |  || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 316 ctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 257

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 256 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 215



to top

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 398 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 339

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 338 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 279

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 278 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 219

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 218 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 177



to top

>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616819), mRNA
          Length = 411

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| || ||||||||||| ||||| |||||||| || || ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatcacggccgagctctggaagcgcaggtcagtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgtaccagccgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611340), mRNA
          Length = 573

 Score =  226 bits (114), Expect = 5e-56
 Identities = 177/198 (89%)
 Strand = Plus / Minus

                                                                       
Query: 246 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtc 305
           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 450 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 391

                                                                       
Query: 306 ctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtggga 365
           |||||| |||||||| ||||| ||||||   |||||||| || || |  |||||   |  
Sbjct: 390 ctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcgccatgacggccgagct 331

                                                                       
Query: 366 ctggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaaggg 425
           ||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||| ||
Sbjct: 330 ctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgcaccaggcgctggaacgg 271

                             
Query: 426 cagcttgcggatcagcag 443
           ||||||||||||||||||
Sbjct: 270 cagcttgcggatcagcag 253



to top

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||
Sbjct: 842 ctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgacacgcttggc 783

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 782 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 723

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| |||||||||||||| |||||
Sbjct: 722 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgtgcgat 663

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 662 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 621



to top

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 583 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 524

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 523 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 464

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 463 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 404

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| || || |||||||| ||||||||||||||||||||
Sbjct: 403 ctcgcgcactagccgctggaacggcagcttgcggatcagcag 362



to top

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 430 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 370 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 311

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 310 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 251

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 250 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 209



to top

>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds
          Length = 727

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 548 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 489

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 488 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 429

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 428 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 369

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 368 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 327



to top

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||
Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| |||||   ||||||
Sbjct: 376 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 317

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| |  || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 316 ctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 257

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 256 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 215



to top

>gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, complete cds
          Length = 1408

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 902 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 783

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 681



to top

>ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA
          Length = 483

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 429 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 370

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||||||||| |||||   ||||||
Sbjct: 369 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 310

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 309 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 250

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 249 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 208



to top

>gb|M33989.1|MUSH2AX1X Mouse histone H3.2 gene, complete cds
          Length = 693

 Score =  226 bits (114), Expect = 5e-56
 Identities = 195/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 552 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 493

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||||
Sbjct: 492 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctc 433

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  || ||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 432 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 373

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 372 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 331



to top

>emb|X06963.1|VCHIS34 Volvox carteri H3-I and H4-I genes for histones H3 and H4
          Length = 1898

 Score =  222 bits (112), Expect = 7e-55
 Identities = 187/212 (88%)
 Strand = Plus / Minus

                                                                        
Query: 232  atgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 291
            |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1495 atgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcg 1436

                                                                        
Query: 292  caaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcg 351
            || |||||||| |||||||| || ||||| ||||| |||||||| |||||||| || || 
Sbjct: 1435 cacaggttggtatcctcgaacaggcccaccaggtaggcctcggcagcctcctgcagcgcc 1376

                                                                        
Query: 352  agcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggacc 411
            |||||||| |||  ||||||||| || ||||||||||||||||| || |||||||| |||
Sbjct: 1375 agcacggcctggctctggaagcgcagatccgtcttgaagtcctgggcaatctcgcgcacc 1316

                                            
Query: 412  aggcgctggaagggcagcttgcggatcagcag 443
            || |||||||| || |||||||| || |||||
Sbjct: 1315 agccgctggaaaggaagcttgcgaataagcag 1284



to top

>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3
          Length = 702

 Score =  222 bits (112), Expect = 7e-55
 Identities = 196/224 (87%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 555 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 496

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| |||||||||||||| || || ||||| ||||| ||||||   |||
Sbjct: 495 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 436

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||
Sbjct: 435 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 376

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||| |||| ||||||||| ||||||||||||||||||||
Sbjct: 375 atctcgcgcaccaagcgctggaacggcagcttgcggatcagcag 332



to top

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  220 bits (111), Expect = 3e-54
 Identities = 189/215 (87%)
 Strand = Plus / Minus

                                                                       
Query: 229 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
           |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 440 cggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 381

                                                                       
Query: 289 gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
           ||||| |||||||||||||| || || ||||| ||||| ||||||   |||||||| || 
Sbjct: 380 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 321

                                                                       
Query: 349 gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
           || |  |||||   |  ||||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 320 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 261

                                              
Query: 409 accaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||| ||||||||||||||||||||
Sbjct: 260 accagccgctggaacggcagcttgcggatcagcag 226



to top

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  220 bits (111), Expect = 3e-54
 Identities = 189/215 (87%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           |||||||| | ||| || ||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 388 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 329

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           |||||||| |||||||||||||||||  | || |||||||| ||||||  ||||||||||
Sbjct: 328 atggcgcacaggttggtgtcctcgaagggaccgacgaggtaagcctcgctggcctcctgg 269

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || |  ||||||  |  ||||||||| ||||| |||||||||||||| |||||||| 
Sbjct: 268 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 209

                                              
Query: 406 cggaccaggcgctggaagggcagcttgcggatcag 440
           |||||||| ||||||||||||||||||||||||||
Sbjct: 208 cggaccagacgctggaagggcagcttgcggatcag 174



to top

>gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  220 bits (111), Expect = 3e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaac 312

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || |||||||| ||||||  ||||||||| || || |  |||||   |  |||||||
Sbjct: 311 agaccgacgaggtaagcctcgctggcctcctgcagcgccatgacggcagagctctggaag 252

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || |||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||||
Sbjct: 251 cgcaggtccgtcttgaagtcctgggcgatctcgcgcaccagccgctggaagggcagcttg 192

                      
Query: 433 cggatcagcag 443
           |||||||||||
Sbjct: 191 cggatcagcag 181



to top

>ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 402 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| || |||||||||||||| || || ||||||||||| ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 181



to top

>ref|XM_871299.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618987), partial mRNA
          Length = 521

 Score =  218 bits (110), Expect = 1e-53
 Identities = 192/218 (88%), Gaps = 1/218 (0%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 401 ccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 342

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           ||||| || |||||||||||||| || || ||||| ||||| ||||||   |||||||| 
Sbjct: 341 atggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcacgcctcctgc 283

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || | ||| ||   |  ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 282 agcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 223

                                                 
Query: 406 cggaccaggcgctggaagggcagcttgcggatcagcag 443
           || ||||| |||||||| ||||||||||||||||||||
Sbjct: 222 cgcaccagccgctggaacggcagcttgcggatcagcag 185



to top

>ref|XM_865002.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC613840), partial mRNA
          Length = 547

 Score =  218 bits (110), Expect = 1e-53
 Identities = 192/218 (88%), Gaps = 1/218 (0%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 285
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 427 ccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggcgtgg 368

                                                                       
Query: 286 atggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctgg 345
           ||||| || |||||||||||||| || || ||||| ||||| ||||||   |||||||| 
Sbjct: 367 atggcacacaggttggtgtcctc-aagagtcccaccaggtaggcctcgcacgcctcctgc 309

                                                                       
Query: 346 agggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcg 405
           || || | ||| ||   |  ||||||||| ||||| ||||||||||||||||||||||||
Sbjct: 308 agcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 249

                                                 
Query: 406 cggaccaggcgctggaagggcagcttgcggatcagcag 443
           || ||||| |||||||| ||||||||||||||||||||
Sbjct: 248 cgcaccagccgctggaacggcagcttgcggatcagcag 211



to top

>ref|XM_870476.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC618149), mRNA
          Length = 411

 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatccggcgggcaagctggatgtctttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| || ||||||||||||||||| |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||| ||   |  ||||||||| ||||| |||||||||||||| |||||
Sbjct: 282 ctgcagcgccatcaccgcagagctctggaagcgcaggtcggtcttgaagtcctgtgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| ||||| |||||||| || |||||||||||||||||
Sbjct: 222 ctcgcgcaccagccgctggaacggtagcttgcggatcagcag 181



to top

>ref|XM_603864.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC525511), mRNA
          Length = 448

 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| || |||||||||||||| || |||||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcctcaaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||| ||   |  |||||| || | ||| ||||||||||||||||| ||
Sbjct: 282 ctgcagcgccatcaccgcagagctctggaaacgcaagtcggtcttgaagtcctgcgcaat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgcaccagccgctggaacggcagcttgcggatcagcag 181



to top

>emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N21 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme HBUCE1 pseudogene, the FCGR1C
             gene for Fc fragment of IgG high affinity Ic receptor for
             (CD64), two novel genes, the HIST2H2BA gene for histone 2
             H2ba, the gene for a novel protein similar to histone 2
             H3c (HIST2H3C), a novel gene, a ribosomal protein L22
             (RPL22) pseudogene, a novel gene and three CpG islands,
             complete sequence
          Length = 129426

 Score =  218 bits (110), Expect = 1e-53
 Identities = 200/230 (86%)
 Strand = Plus / Plus

                                                                         
Query: 214   taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
             ||||| ||||||||||||||||||| | | | |||||||||||||||||||||||| |||
Sbjct: 69914 taggcccgctccccgcggatgcggctgaccaactggatgtccttgggcatgatggtcacg 69973

                                                                         
Query: 274   cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
             |||||||| ||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||| 
Sbjct: 69974 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctct 70033

                                                                         
Query: 334   gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
               ||||||||| || || | ||||||   |  ||||||||| ||||||||||| || |||
Sbjct: 70034 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaactcc 70093

                                                               
Query: 394   tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 70094 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag 70143



to top

>ref|NM_001025303.1| Homo sapiens similar to histone H2B histone family (LOC440686),
           mRNA
          Length = 411

 Score =  218 bits (110), Expect = 1e-53
 Identities = 200/230 (86%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||||||||||||||||| | | | |||||||||||||||||||||||| |||
Sbjct: 410 taggcccgctccccgcggatgcggctgaccaactggatgtccttgggcatgatggtcacg 351

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||| ||||||||||| ||||| ||||| ||||| |||||||| ||||| ||||| 
Sbjct: 350 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctct 291

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||||||||| || || | ||||||   |  ||||||||| ||||||||||| || |||
Sbjct: 290 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaactcc 231

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 230 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcag 181



to top

>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016
          Length = 2110

 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Minus

                                                                        
Query: 222  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
            |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 2003 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 1944

                                                                        
Query: 282  gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
            ||||||||| || |||||||||||||| || || ||||||||||| ||||||   |||||
Sbjct: 1943 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 1884

                                                                        
Query: 342  ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
            ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 1883 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 1824

                                                      
Query: 402  ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 1823 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 1782



to top

>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108
          Length = 2221

 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Minus

                                                                        
Query: 222  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
            |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 2001 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 1942

                                                                        
Query: 282  gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
            ||||||||| || |||||||||||||| || || ||||||||||| ||||||   |||||
Sbjct: 1941 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 1882

                                                                        
Query: 342  ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
            ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 1881 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 1822

                                                      
Query: 402  ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 1821 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 1780



to top

>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F),
           histone H2b-F (H2b-F) genes, complete cds
          Length = 2822

 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Plus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 96  ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 155

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| || |||||||||||||| || || ||||||||||| ||||||   |||||
Sbjct: 156 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 215

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 216 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 275

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 276 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 317



to top

>gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, complete cds
          Length = 2249

 Score =  218 bits (110), Expect = 1e-53
 Identities = 194/222 (87%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||| || ||||| ||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 941 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 882

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| || |||||||||||||| || || ||||||||||| ||||||   |||||
Sbjct: 881 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 822

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || |  |||||   |  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 821 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 762

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| |||||||||||||| ||||||||||||||||||||
Sbjct: 761 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcag 720



to top

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  212 bits (107), Expect = 7e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || |||||||| ||||||  ||||||||| || || |  ||||||  |  |||||||
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || ||||| |||||||||||||||||||||||||| || |||||||||||||||||||||
Sbjct: 248 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcactaggcgctggaagggcagcttg 189

                      
Query: 433 cggatcagcag 443
           ||||| |||||
Sbjct: 188 cggatgagcag 178



to top

>ref|XM_868913.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616800), mRNA
          Length = 411

 Score =  210 bits (106), Expect = 3e-51
 Identities = 193/222 (86%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           ||||||||| || ||||||||||| ||||| |||||||| || || ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||| ||   |  |||||| || ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatcactgccgagctctggaaacgcaggtcggtcttgaagtcctgcgcgat 223

                                                     
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||| ||||| |||||||| ||||||||||||||||||||
Sbjct: 222 ctcgcgtaccagccgctggaaaggcagcttgcggatcagcag 181



to top

>ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570028), mRNA
          Length = 725

 Score =  210 bits (106), Expect = 3e-51
 Identities = 196/226 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||| |||||||||||||| || || || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggtttgtgtcctcgaaaaggccgaccagataagcctcgctg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           | |||||| ||||| |  ||||||  |  ||||||||| ||||| |||||||||||||| 
Sbjct: 287 gactcctgcagggccatgacggcggagctctggaagcgcaggtcagtcttgaagtcctga 228

                                                         
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagca 442
           ||||| || || ||||| |||||||| |||||||||||||||||||
Sbjct: 227 gcgatttctcgcaccagacgctggaaaggcagcttgcggatcagca 182



to top

>gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, partial cds
          Length = 373

 Score =  208 bits (105), Expect = 1e-50
 Identities = 165/185 (89%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 370 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 311

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || ||||||||||| ||||||  |||||||||||| || |  ||||||  |  |||||||
Sbjct: 310 agacccacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaag 251

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           |||||||| |||||||||||||| |||||||||||||| || |||||||| |||| ||||
Sbjct: 250 cggaggtcggtcttgaagtcctgggcgatctcgcggacgagtcgctggaacggcaacttg 191

                
Query: 433 cggat 437
           |||||
Sbjct: 190 cggat 186



to top

>gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, partial cds
          Length = 361

 Score =  206 bits (104), Expect = 4e-50
 Identities = 164/184 (89%)
 Strand = Plus / Minus

                                                                       
Query: 257 tgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagcc 316
           |||||||||||||||||||||| |||||||| ||||| ||||||||||||||||| || |
Sbjct: 361 tgggcatgatggtgacgcgcttagcgtggattgcgcacaggttggtgtcctcgaagagac 302

                                                                       
Query: 317 ccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaagcgga 376
           | |||||||| ||||||  |||||||||||| || |  ||||||  |  |||||||||||
Sbjct: 301 cgacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaagcgga 242

                                                                       
Query: 377 ggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcgga 436
           |||| |||||||||||||| |||||||||||||| |||||||||||||||||||||||||
Sbjct: 241 ggtcggtcttgaagtcctgagcgatctcgcggacgaggcgctggaagggcagcttgcgga 182

               
Query: 437 tcag 440
           ||||
Sbjct: 181 tcag 178



to top

>ref|XM_590015.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC539875), mRNA
          Length = 411

 Score =  204 bits (103), Expect = 2e-49
 Identities = 190/219 (86%)
 Strand = Plus / Minus

                                                                       
Query: 222 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 281
           |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 282 gtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctc 341
           |||||||||||| || |||||||||||||| || ||||| ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagagattggtgtcctcgaagaggcccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 342 ctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgat 401
           ||| || || | ||| ||   |  ||| ||||| ||||| |||||||||||||| |||||
Sbjct: 282 ctgcagcgccatcaccgccgagctctgaaagcgcaggtcggtcttgaagtcctgagcgat 223

                                                  
Query: 402 ctcgcggaccaggcgctggaagggcagcttgcggatcag 440
           |||||| ||||| |||||||| ||||||||||| |||||
Sbjct: 222 ctcgcgcaccagccgctggaacggcagcttgcgaatcag 184



to top

>gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds
          Length = 372

 Score =  204 bits (103), Expect = 2e-49
 Identities = 169/191 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| 
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaag 309

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || || ||||| ||||||  ||||||||| || || |  ||||||  |  |||||| 
Sbjct: 308 aggccgacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaac 249

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           |||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||
Sbjct: 248 cggaggtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttg 189

                      
Query: 433 cggatcagcag 443
           ||||| |||||
Sbjct: 188 cggatgagcag 178



to top

>ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC559765), mRNA
          Length = 411

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || || || || || ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctt 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  ||||||  |  ||||||||| || ||||||||||||||||| 
Sbjct: 287 gcctcctgaagagccatgacggcggagctctggaagcgcagatccgtcttgaagtcctga 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 227 gcgatttcacggaccagacgctggaagggcagtttgcggatcagcag 181



to top

>emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 in linkage group 25,
              complete sequence
          Length = 167326

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Plus

                                                                          
Query: 217    gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
              |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 116388 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 116447

                                                                          
Query: 277    ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
              ||||||||||||||||| ||||||||||||||||| || || || || || ||||||   
Sbjct: 116448 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctt 116507

                                                                          
Query: 337    gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
              |||||||| || || |  ||||||  |  ||||||||| || ||||||||||||||||| 
Sbjct: 116508 gcctcctgaagagccatgacggcggagctctggaagcgcagatccgtcttgaagtcctga 116567

                                                             
Query: 397    gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
              ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 116568 gcgatttcacggaccagacgctggaagggcagtttgcggatcagcag 116614



 Score =  196 bits (99), Expect = 4e-47
 Identities = 192/223 (86%)
 Strand = Plus / Plus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 79273 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 79332

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| || || || || || ||||||  |
Sbjct: 79333 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 79392

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             | |||||| || || |  ||||||  |  ||||||||| || || |||||||||||||| 
Sbjct: 79393 gactcctgaagagccatgacggcggagctctggaagcgcagatctgtcttgaagtcctga 79452

                                                        
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatca 439
             ||||| || |||||||| |||||||||||||| ||||||||||
Sbjct: 79453 gcgatttctcggaccagacgctggaagggcagtttgcggatca 79495



 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Minus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 63682 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 63623

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| || || || || || ||||||  |
Sbjct: 63622 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 63563

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             | |||||| || || |  ||||||  |  ||||||||| || || |||||||| ||||| 
Sbjct: 63562 gactcctgaagagccatgacggcggagctctggaagcgcagatcagtcttgaaatcctga 63503

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 63502 gcgatttctcggaccagacgctggaagggcagtttgcggatcagcag 63456



 Score =  182 bits (92), Expect = 6e-43
 Identities = 191/224 (85%)
 Strand = Plus / Plus

                                                                         
Query: 220   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
             ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||
Sbjct: 99227 cgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttg 99286

                                                                         
Query: 280   gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
             |||||||||||||| ||||| ||||||||||| || || || || || || |||  || |
Sbjct: 99287 gcgtggatggcgcacaggttagtgtcctcgaacagaccgaccagataagcttcgctggac 99346

                                                                         
Query: 340   tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
             ||||| || || |  ||||||  |  ||||||||| || || |||||||||||||| |||
Sbjct: 99347 tcctgaagagccatgacggcggagctctggaagcgcagatcagtcttgaagtcctgagcg 99406

                                                         
Query: 400   atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             || || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 99407 atttcacggaccagacgctggaagggcagtttgcggatcagcag 99450



 Score =  180 bits (91), Expect = 3e-42
 Identities = 193/227 (85%)
 Strand = Plus / Plus

                                                                         
Query: 217   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
             |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 85972 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 86031

                                                                         
Query: 277   ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
             ||||||||||||||||| ||||||||||||||||| || || || || || || |||  |
Sbjct: 86032 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcttcgctg 86091

                                                                         
Query: 337   gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
             | |||||| || || |  ||||||  |  ||||||||| || || |||||||| ||||| 
Sbjct: 86092 gactcctgaagagccatgacggcggagctctggaagcgcagatcagtcttgaaatcctga 86151

                                                            
Query: 397   gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
             ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 86152 gcgatttctcggaccagacgctggaagggcagtttgcggatcagcag 86198



to top

>gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial cds
          Length = 375

 Score =  204 bits (103), Expect = 2e-49
 Identities = 169/191 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || ||||||||||| ||||||  ||||||||| || || | |||||||  |  |||||| 
Sbjct: 311 agacccacgaggtaagcctcgctggcctcctgcagagccatcacggcggagctctggaaa 252

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           |||||||| |||||||||||||| ||||| || || |||||||| ||||||||||| |||
Sbjct: 251 cggaggtcggtcttgaagtcctgtgcgatttcacgcaccaggcgttggaagggcagtttg 192

                      
Query: 433 cggatcagcag 443
           |||||||||||
Sbjct: 191 cggatcagcag 181



to top

>gb|AY555567.1| Heterojapyx sp. GG-2001 histone H3 gene, partial cds
          Length = 327

 Score =  202 bits (102), Expect = 7e-49
 Identities = 153/170 (90%)
 Strand = Plus / Minus

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||||
Sbjct: 326 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccacgaggtaggcctcg 267

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
              |||||||| ||||| | ||||||   |  ||||||||| ||||| ||||||||||||
Sbjct: 266 ctcgcctcctgcagggccatcacggcagagctctggaagcgcaggtcggtcttgaagtcc 207

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           |||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 206 tgcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcag 157



to top

>gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 protein mRNA,
           complete cds
          Length = 610

 Score =  200 bits (101), Expect = 3e-48
 Identities = 198/228 (86%), Gaps = 3/228 (1%)
 Strand = Plus / Minus

                                                                       
Query: 213 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgac 272
           |||||| || || ||||| || ||||| |||||||| |||||||||||||||||||||||
Sbjct: 512 ctaggcacgttcgccgcgaatacggcgtgcgagctgaatgtccttgggcatgatggtgac 453

                                                                       
Query: 273 gcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaag--ccccacg-aggtacgc 329
           ||||||||||||||||||||| | ||||||||||||||| ||  ||||||| ||||| ||
Sbjct: 452 gcgcttggcgtggatggcgcacaagttggtgtcctcgaacagtcccccacgaaggtaggc 393

                                                                       
Query: 330 ctcggcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaa 389
           |||||||||||| || || |||||||||||   |  ||||||||| ||||| | ||||||
Sbjct: 392 ctcggcggcctcttgcagcgcgagcacggccgagctctggaagcgcaggtcggacttgaa 333

                                                           
Query: 390 gtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
           |||||| |||||||| ||||| ||||||||||| || |||||||||||
Sbjct: 332 gtcctgggcgatctcacggacgaggcgctggaacggaagcttgcggat 285



to top

>ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560897), mRNA
          Length = 471

 Score =  196 bits (99), Expect = 4e-47
 Identities = 192/223 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 467 gcgcgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctc 408

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || || || || || ||||||  |
Sbjct: 407 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 348

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           | |||||| || || |  ||||||  |  ||||||||| || || |||||||||||||| 
Sbjct: 347 gactcctgaagagccatgacggcggagctctggaagcgcagatctgtcttgaagtcctga 288

                                                      
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatca 439
           ||||| || |||||||| |||||||||||||| ||||||||||
Sbjct: 287 gcgatttctcggaccagacgctggaagggcagtttgcggatca 245



to top

>ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570644), mRNA
          Length = 411

 Score =  196 bits (99), Expect = 4e-47
 Identities = 195/227 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || || || || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| ||||| |  || |||     ||||||||| || || |||||||||||||| 
Sbjct: 287 gcctcctgcagggccatgacagcggaactctggaagcgcagatctgtcttgaagtcctgg 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 227 gcgatttctcggaccagacgctggaagggcagtttgcggatcagcag 181



to top

>gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds
          Length = 375

 Score =  196 bits (99), Expect = 4e-47
 Identities = 168/191 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || || ||||| ||||||  ||||||||| ||||| | ||||||   |  |||||||
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatcacggccgagctctggaag 252

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || ||||| |||||||||||||| |||||||| || ||||| ||||||||||||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

                      
Query: 433 cggatcagcag 443
           ||||| |||||
Sbjct: 191 cggatgagcag 181



to top

>gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  194 bits (98), Expect = 2e-46
 Identities = 164/186 (88%)
 Strand = Plus / Minus

                                                                       
Query: 258 gggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccc 317
           |||||||||||||||||||||||||||||||||||| ||||||||||| ||||| || ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaagaggcc 295

                                                                       
Query: 318 cacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaagcggag 377
            || ||||| ||||||  ||||||||| || || |  ||||||  |  |||||| |||||
Sbjct: 294 gacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaaccggag 235

                                                                       
Query: 378 gtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
           ||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 234 gtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttgcggat 175

                 
Query: 438 cagcag 443
            |||||
Sbjct: 174 gagcag 169



to top

>ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641
           (ENSANGG00000024840), partial mRNA
          Length = 411

 Score =  194 bits (98), Expect = 2e-46
 Identities = 197/230 (85%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||| ||||| ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctctccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| || || ||||| ||||| || || || ||||||||||||
Sbjct: 350 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccaggtacgcctcg 291

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||| ||||| || || |  |||||   |  |||||||||||| || ||||||||||||
Sbjct: 290 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 231

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || |||||||| || |||| |||||||||||||||||||||||| |||||
Sbjct: 230 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcag 181



to top

>ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005
           (ENSANGG00000013516), partial mRNA
          Length = 411

 Score =  194 bits (98), Expect = 2e-46
 Identities = 197/230 (85%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| || || ||||| ||||| || || || || |||||||||
Sbjct: 350 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcg 291

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||| ||||| || || |  |||||   |  |||||||||||| || ||||||||||||
Sbjct: 290 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 231

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || |||||||| || |||| |||||||||||||||||||||||| |||||
Sbjct: 230 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcag 181



to top

>ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387
           (ENSANGG00000001186), partial mRNA
          Length = 408

 Score =  194 bits (98), Expect = 2e-46
 Identities = 197/230 (85%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 407 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 348

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| || || ||||| ||||| || || || || |||||||||
Sbjct: 347 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcg 288

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||| ||||| || || |  |||||   |  |||||||||||| || ||||||||||||
Sbjct: 287 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 228

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || |||||||| || |||| |||||||||||||||||||||||| |||||
Sbjct: 227 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcag 178



to top

>ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784
           (ENSANGG00000010295), partial mRNA
          Length = 411

 Score =  194 bits (98), Expect = 2e-46
 Identities = 197/230 (85%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           |||||||||||||||||||| || || ||||| ||||| || || || || |||||||||
Sbjct: 350 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcg 291

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||| ||||| || || |  |||||   |  |||||||||||| || ||||||||||||
Sbjct: 290 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 231

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || |||||||| || |||| |||||||||||||||||||||||| |||||
Sbjct: 230 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcag 181



to top

>gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds
          Length = 345

 Score =  194 bits (98), Expect = 2e-46
 Identities = 164/186 (88%)
 Strand = Plus / Minus

                                                                       
Query: 258 gggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccc 317
           |||||||||||||||||||||||||||||||||||| | |||||||||||| || || ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaacagacc 286

                                                                       
Query: 318 cacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaagcggag 377
           ||| ||||| ||||||  || |||||| ||||| |  ||||||  |  ||||||||| ||
Sbjct: 285 caccaggtaggcctcgctggactcctgcagggccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 378 gtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
           ||| |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||
Sbjct: 225 gtcggtcttgaagtcctgggcgatctcgcgaaccaggcgctggaagggcagcttgcggat 166

                 
Query: 438 cagcag 443
           ||||||
Sbjct: 165 cagcag 160



to top

>gb|AY338621.1| Metretopus borealis histone 3 gene, partial cds
          Length = 345

 Score =  194 bits (98), Expect = 2e-46
 Identities = 164/186 (88%)
 Strand = Plus / Minus

                                                                       
Query: 258 gggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccc 317
           |||||||||||||||||||||||||||||||||||| | |||||||||||| || || ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaagagacc 286

                                                                       
Query: 318 cacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaagcggag 377
           ||||||||||||||||  ||||||||| || || | |||||||  |  |||||| || ||
Sbjct: 285 cacgaggtacgcctcgctggcctcctgaagagccatcacggcggagctctggaaacgcag 226

                                                                       
Query: 378 gtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
           ||| |||||||||||||| |||||||| || ||||| |||||||||||||||||||||||
Sbjct: 225 gtcggtcttgaagtcctgagcgatctcacgcaccagacgctggaagggcagcttgcggat 166

                 
Query: 438 cagcag 443
           ||||||
Sbjct: 165 cagcag 160



to top

>gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H3 and H4 genes
          Length = 2133

 Score =  194 bits (98), Expect = 2e-46
 Identities = 188/218 (86%)
 Strand = Plus / Minus

                                                                        
Query: 220  cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
            ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 1917 cgctcgccacggatacggcgggcaagctggatgtccttgggcatgatggtgacacgcttg 1858

                                                                        
Query: 280  gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
            |||||||||||||||||||||||||||||||| || || || | ||| || ||   ||||
Sbjct: 1857 gcgtggatggcgcaaaggttggtgtcctcgaagagaccgaccaagtaagcttccctggcc 1798

                                                                        
Query: 340  tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
            || |||||||| |  ||||||  |  |||||||||||| || || ||||||||||| |||
Sbjct: 1797 tcttggagggccatgacggcggagctctggaagcggagctcggttttgaagtcctgagcg 1738

                                                  
Query: 400  atctcgcggaccaggcgctggaagggcagcttgcggat 437
            ||||| |||||||| ||||||||||| |||||||||||
Sbjct: 1737 atctcacggaccagacgctggaaggggagcttgcggat 1700



to top

>emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core histones H2A, H2B, H3 and
            H4
          Length = 6052

 Score =  192 bits (97), Expect = 7e-46
 Identities = 181/209 (86%)
 Strand = Plus / Plus

                                                                        
Query: 229  cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
            ||||| |||||||| | ||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 4159 cggatacggcgggccaactggatgtccttgggcatgatggtgactcgcttggcgtggatg 4218

                                                                        
Query: 289  gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
            ||||| | |||||||||||| || || || || | ||| ||||| | |||||||||||| 
Sbjct: 4219 gcgcacaagttggtgtcctcaaagagaccaaccaagtaagcctcagaggcctcctggaga 4278

                                                                        
Query: 349  gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
            || |  |||||   ||||||||| || ||||| |||||||||||||| |||||||| |||
Sbjct: 4279 gccatgacggcagaggactggaatcgcaggtcggtcttgaagtcctgggcgatctcacgg 4338

                                         
Query: 409  accaggcgctggaagggcagcttgcggat 437
            ||||| |||||||||||||||||||||||
Sbjct: 4339 accagacgctggaagggcagcttgcggat 4367



to top

>emb|CR733515.2|CNS0GSRE Tetraodon nigroviridis full-length cDNA
          Length = 1545

 Score =  190 bits (96), Expect = 3e-45
 Identities = 196/228 (85%), Gaps = 1/228 (0%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||| |||||||||||||| ||||||
Sbjct: 520 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtaacgcgc 461

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcct-cggc 335
           ||||| |||||||| || |||||||||||||| || || ||||| |||||||||| ||  
Sbjct: 460 ttggcatggatggcacacaggttggtgtcctcaaacaggcccaccaggtacgcctgcgct 401

                                                                       
Query: 336 ggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctg 395
           ||||||||| |||||    | ||||  |  |||||| || ||||| ||||||||||||||
Sbjct: 400 ggcctcctgcagggctccaatggcggcgctctggaaacgcaggtcggtcttgaagtcctg 341

                                                           
Query: 396 cgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            |||||||| |  |||||||||||||||||||||||||| ||||||||
Sbjct: 340 ggcgatctctctcaccaggcgctggaagggcagcttgcgaatcagcag 293



to top

>gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  190 bits (96), Expect = 3e-45
 Identities = 165/188 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           |||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacacgcttggcgtggatggcgcacaagttggtgtcctcgaaa 312

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || || ||||| ||||||  ||||||||| ||||| | |||||||  |  |||||| 
Sbjct: 311 aggccgaccaggtaggcctcgctggcctcctgcagggccatcacggcggagctctggaaa 252

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || ||||| |||||||||||||| ||||| || || ||||||||||||||||||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccaggcgctggaagggcagcttg 192

                   
Query: 433 cggatcag 440
           ||||||||
Sbjct: 191 cggatcag 184



to top

>ref|XM_686609.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC563243), mRNA
          Length = 411

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgactctc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||| |||||||| ||||| || || || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttagtgtcctcaaaaagacctaccagataagcctcgctg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| ||||| |  || |||  |  |||||| || || || |||||||||||||| 
Sbjct: 287 gcctcctgcagggccatgacagcggagctctggaaacgcagatcggtcttgaagtcctga 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| || || |||||||||||||||||||| ||||||||||||||
Sbjct: 227 gcgatttcacgaaccaggcgctggaagggcagtttgcggatcagcag 181



to top

>ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC561114), mRNA
          Length = 411

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || || || || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcgctg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           | |||||| || || |  ||||||  |  ||||||||| || || |||||||| ||||| 
Sbjct: 287 gactcctgaagagccatgacggcggagctctggaagcgcagatcagtcttgaaatcctga 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 227 gcgatttctcggaccagacgctggaagggcagtttgcggatcagcag 181



to top

>ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570590), mRNA
          Length = 411

 Score =  188 bits (95), Expect = 1e-44
 Identities = 194/227 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| || |||||||||||||| ||||||||||||||||||||||||||||| | |
Sbjct: 407 gcgcgctctccacggatgcggcgggctagctggatgtccttgggcatgatggtgaccctc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| || |||||||||||||| || || || || || ||||||  |
Sbjct: 347 ttggcgtggatggcgcacagattggtgtcctcgaacagaccgaccagataagcctcgctg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           |||||||| || || |  || |||  |  ||||||||| || || |||||||||||||| 
Sbjct: 287 gcctcctgcagagccatgacagcggagctctggaagcgcagatctgtcttgaagtcctgg 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| || |||||||||||||| |||||||| ||||||||||||||
Sbjct: 227 gcgatttctcggaccaggcgctgaaagggcagtttgcggatcagcag 181



to top

>gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds
          Length = 313

 Score =  188 bits (95), Expect = 1e-44
 Identities = 163/186 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 gggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccc 317
           |||||| ||||||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 313 gggcatnatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagtcc 254

                                                                       
Query: 318 cacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaagcggag 377
            |||||||| ||||||  ||||||||| || || |  ||||||  |  ||||||||| ||
Sbjct: 253 gacgaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaagcgcag 194

                                                                       
Query: 378 gtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
            || |||||||||||||| |||||||||||||| || |||||||||||||||||||||||
Sbjct: 193 atcggtcttgaagtcctgagcgatctcgcggacgagacgctggaagggcagcttgcggat 134

                 
Query: 438 cagcag 443
           ||||||
Sbjct: 133 cagcag 128



to top

>gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds
          Length = 345

 Score =  188 bits (95), Expect = 1e-44
 Identities = 163/186 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 gggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccc 317
           |||||||||||||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagagtcc 286

                                                                       
Query: 318 cacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaagcggag 377
            |||||||| ||||||  ||||||||| || || |  ||||||  |  ||||||||| ||
Sbjct: 285 nacgaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 378 gtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
           ||| |||||||||||||| |||||||| || || ||||||||||||||||||||||||||
Sbjct: 225 gtcagtcttgaagtcctgtgcgatctcacgcacgaggcgctggaagggcagcttgcggat 166

                 
Query: 438 cagcag 443
            |||||
Sbjct: 165 gagcag 160



to top

>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC582332), mRNA
          Length = 411

 Score =  186 bits (94), Expect = 4e-44
 Identities = 187/218 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || ||||| |||||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 404 cgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||||||||||||||| || || || | ||| ||||||  ||||
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtatgcctcgctggcc 285

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  || |||  |  |||||| ||||| || |||||||||||||| |||
Sbjct: 284 tcctgaagagccatgactgcggagctctggaatcggagctcggtcttgaagtcctgagcg 225

                                                 
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggat 437
           ||||| |||||||| ||||||||||| |||||||||||
Sbjct: 224 atctcacggaccagacgctggaaggggagcttgcggat 187



to top

>ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC570618), mRNA
          Length = 411

 Score =  186 bits (94), Expect = 4e-44
 Identities = 196/230 (85%)
 Strand = Plus / Minus

                                                                       
Query: 214 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
           ||||||||||| || ||||||||||| || ||||||||||||||||||||||||||||| 
Sbjct: 410 taggcgcgctctccacggatgcggcgagccagctggatgtccttgggcatgatggtgacc 351

                                                                       
Query: 274 cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
           | |||||||||||||||||| ||||||||||||||||| || || || || || ||||||
Sbjct: 350 ctcttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcctcg 291

                                                                       
Query: 334 gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
             ||||||||| || || |  ||||||  |  |||||| || || || ||||| ||||||
Sbjct: 290 ctggcctcctgcagagccatgacggcggagctctggaaacgcagatcggtcttaaagtcc 231

                                                             
Query: 394 tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 230 tgggcgatttctcggaccagacgctggaagggcagtttgcggatcagcag 181



to top

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score =  186 bits (94), Expect = 4e-44
 Identities = 124/134 (92%)
 Strand = Plus / Minus

                                                                       
Query: 211 gcctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtg 270
           |||||||||||||| || |||||||||||||| ||||||||||||||||||||||| || 
Sbjct: 424 gcctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtc 365

                                                                       
Query: 271 acgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcc 330
           || |||||||||||||||||||| ||||||||||||||||| ||||| |||||||| |||
Sbjct: 364 acacgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtaggcc 305

                         
Query: 331 tcggcggcctcctg 344
           ||||||||||||||
Sbjct: 304 tcggcggcctcctg 291



 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 63/68 (92%)
 Strand = Plus / Minus

                                                                       
Query: 376 aggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcgg 435
           |||||||| ||||||||||| || ||||||||||| ||||||||||||||||||||||||
Sbjct: 259 aggtccgttttgaagtcctgggcaatctcgcggacgaggcgctggaagggcagcttgcgg 200

                   
Query: 436 atcagcag 443
           || |||||
Sbjct: 199 atgagcag 192



to top

>gb|AF093108.1|AF093108 Tortula ruralis histone H3 (rnp49) mRNA, partial cds
          Length = 401

 Score =  186 bits (94), Expect = 4e-44
 Identities = 178/206 (86%)
 Strand = Plus / Minus

                                                                       
Query: 237 gcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaag 296
           |||||| |||||||||||||| ||||||||||| || | ||| ||||||||||| || | 
Sbjct: 331 gcgggccagctggatgtccttcggcatgatggtcaccctcttcgcgtggatggcacacaa 272

                                                                       
Query: 297 gttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcac 356
           ||||||||||||||| || ||||| ||||||||||| || |||||||| || || |||||
Sbjct: 271 gttggtgtcctcgaacagacccaccaggtacgcctccgccgcctcctgcagcgccagcac 212

                                                                       
Query: 357 ggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcg 416
           |||||||  |||||| || || || |||||||||||||| |||||||| || ||||| | 
Sbjct: 211 ggcgtggctctggaaacgcagatcggtcttgaagtcctgggcgatctcacgaaccagcct 152

                                     
Query: 417 ctggaagggcagcttgcggatcagca 442
           ||||||||||||||||||||||||||
Sbjct: 151 ctggaagggcagcttgcggatcagca 126



to top

>gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone 3 (H3) gene,
           partial cds
          Length = 376

 Score =  186 bits (94), Expect = 4e-44
 Identities = 164/188 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||||
Sbjct: 372 tccttgggcatgatggtgacgcgcttggcgtggatsgcgcacaagttggtgtcctcgaaa 313

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || |||||||| || |||  ||||||||| || || |  ||||||  |  |||||||
Sbjct: 312 agaccgacgaggtatgcttcgctggcctcctgcagagccatgacggcggagctctggaag 253

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || ||||| |||||||| ||||| ||||||||||| |||||||||||||| |||||||||
Sbjct: 252 cgcaggtcggtcttgaaatcctgrgcgatctcgcgaaccaggcgctggaaaggcagcttg 193

                   
Query: 433 cggatcag 440
           ||||||||
Sbjct: 192 cggatcag 185



to top

>gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds
          Length = 345

 Score =  186 bits (94), Expect = 4e-44
 Identities = 163/186 (87%)
 Strand = Plus / Minus

                                                                       
Query: 258 gggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccc 317
           |||||||||||||||||||||||||||||||||||| | ||||||||||||||| || ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaagagacc 286

                                                                       
Query: 318 cacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaagcggag 377
            |||||||| ||||||   |||||||| ||||| |  ||||||  |  ||||||||| ||
Sbjct: 285 tacgaggtaagcctcgcttgcctcctgcagggccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 378 gtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
           ||| |||||||||||||| |||||||| || |||||||||||||||||||||||||||||
Sbjct: 225 gtcggtcttgaagtcctgtgcgatctcacgcaccaggcgctggaagggcagcttgcggat 166

                 
Query: 438 cagcag 443
            |||||
Sbjct: 165 gagcag 160



to top

>gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, partial cds
          Length = 355

 Score =  186 bits (94), Expect = 4e-44
 Identities = 166/190 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| 
Sbjct: 351 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaac 292

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || || ||||| ||||||  ||||||||| ||||| |  ||||||  |  |||||| 
Sbjct: 291 agaccaaccaggtaggcctcgctggcctcctgcagggccatgacggcgctgctctggaaa 232

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || ||||| |||||||||||||| |||||||| || ||||||||||||||||||||||||
Sbjct: 231 cgcaggtcggtcttgaagtcctgagcgatctcacgcaccaggcgctggaagggcagcttg 172

                     
Query: 433 cggatcagca 442
           ||||| ||||
Sbjct: 171 cggatgagca 162



to top

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score =  184 bits (93), Expect = 2e-43
 Identities = 180/209 (86%)
 Strand = Plus / Minus

                                                                       
Query: 229 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 288
           ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 395 cggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggcgtggatg 336

                                                                       
Query: 289 gcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagg 348
           ||||| | ||||||||||||||| ||||| |||||||| ||||| ||||| |||||||| 
Sbjct: 335 gcgcacaagttggtgtcctcgaagagcccgacgaggtaagcctcagcggcttcctggaga 276

                                                                       
Query: 349 gcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcgg 408
           || || || |||   |||||||| || || || |||||||||||||| |||||||| || 
Sbjct: 275 gcaaggacagcggacgactggaaacgcagatcggtcttgaagtcctgggcgatctcacgc 216

                                        
Query: 409 accaggcgctggaagggcagcttgcggat 437
           || || | |||||| || |||||||||||
Sbjct: 215 acaagtctctggaaagggagcttgcggat 187



to top

>gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds
          Length = 377

 Score =  184 bits (93), Expect = 2e-43
 Identities = 162/185 (87%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaac 312

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || ||||| ||||| ||||||  ||||||||| || || |  ||||||  |  |||||||
Sbjct: 311 agacccaccaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaag 252

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || ||||| |||||||||||||| |||||||| || ||||| ||||||||||||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

                
Query: 433 cggat 437
           |||||
Sbjct: 191 cggat 187



to top

>gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, partial cds
          Length = 357

 Score =  184 bits (93), Expect = 2e-43
 Identities = 166/191 (86%)
 Strand = Plus / Minus

                                                                       
Query: 253 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaaa 312
           ||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||||| 
Sbjct: 353 tccttgggcatratggtgacacgcttggcgtggatggcgcacaggttggtgtcctcgaac 294

                                                                       
Query: 313 agccccacgaggtacgcctcggcggcctcctggagggcgagcacggcgtgggactggaag 372
           || || || ||||| ||||||  ||||||||| ||||| |  ||||||  |  |||||| 
Sbjct: 293 aggccaaccaggtaggcctcgctggcctcctgcagggccatgacggcggagctctggaaa 234

                                                                       
Query: 373 cggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgctggaagggcagcttg 432
           || ||||| |||||||||||||| ||||| || || ||||||||||||||||||||||||
Sbjct: 233 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccaggcgctggaagggcagcttg 174

                      
Query: 433 cggatcagcag 443
           |||||||||||
Sbjct: 173 cggatcagcag 163



to top

>gb|AY655588.1| Menidia menidia histone H3a gene, partial cds
          Length = 333

 Score =  182 bits (92), Expect = 6e-43
 Identities = 149/168 (88%)
 Strand = Plus / Minus

                                                                       
Query: 276 cttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggc 335
           |||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgct 270

                                                                       
Query: 336 ggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctg 395
           ||||||||| || || |  ||||||  |  ||||||||| ||||| ||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                           
Query: 396 cgcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||||||| | ||||||||||||||||||||||||||||||||||||
Sbjct: 209 cgcgatctccctgaccaggcgctggaagggcagcttgcggatcagcag 162



to top

>ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC579977), mRNA
          Length = 411

 Score =  182 bits (92), Expect = 6e-43
 Identities = 191/224 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||| ||||| ||||||||||||||||||||||||||||| ||||||
Sbjct: 404 cgctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttg 345

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||||||||||||||| || || || | ||| || |||  ||||
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtatgcttcgctggcc 285

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  || |||  |  |||||| ||||| || |||||||||||||| |||
Sbjct: 284 tcctgaagagccatgactgcggagctctggaatcggagctcggtcttgaagtcctgagcg 225

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 224 atctcacggaccagacgctggaaggggagcttgcggatgagcag 181



to top

>emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic H3 and H4 histone genes
          Length = 2506

 Score =  182 bits (92), Expect = 6e-43
 Identities = 191/224 (85%)
 Strand = Plus / Minus

                                                                        
Query: 220  cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
            ||||| || |||||||||||||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 2409 cgctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttg 2350

                                                                        
Query: 280  gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
            ||||||||||||||||||||||||||||||||||| |  || | ||| || |||  ||||
Sbjct: 2349 gcgtggatggcgcaaaggttggtgtcctcgaaaagacggaccaagtaggcttcgctggcc 2290

                                                                        
Query: 340  tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
            ||||| || || |  |||||   |  |||||| ||||| || |||||||||||||| |||
Sbjct: 2289 tcctgaagagccatgacggcagagctctggaaacggagctcggtcttgaagtcctgagcg 2230

                                                        
Query: 400  atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
            ||||| |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 2229 atctcacggaccagacgctggaaggggagcttgcggatgagcag 2186



to top

>emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene
          Length = 2029

 Score =  182 bits (92), Expect = 6e-43
 Identities = 191/224 (85%)
 Strand = Plus / Minus

                                                                        
Query: 214  taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 273
            ||||| ||||| || ||||| |||||||| |||||||||||||| |||||||||||||| 
Sbjct: 1887 taggcacgctcgccacggatacggcgggcaagctggatgtcctttggcatgatggtgaca 1828

                                                                        
Query: 274  cgcttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcg 333
            ||||| ||||||||||| || |||||||||||||||||||| || || | ||| || |||
Sbjct: 1827 cgcttagcgtggatggcacacaggttggtgtcctcgaaaagaccgaccaagtaagcttcg 1768

                                                                        
Query: 334  gcggcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcc 393
              |||||||||||| || |  ||||||  |  |||||||||||| || ||||||||||||
Sbjct: 1767 ctggcctcctggagagccatgacggcggagctctggaagcggagctcggtcttgaagtcc 1708

                                                        
Query: 394  tgcgcgatctcgcggaccaggcgctggaagggcagcttgcggat 437
            || ||||| || |||||||| ||||||||||| |||||||||||
Sbjct: 1707 tgagcgatttcacggaccagacgctggaaggggagcttgcggat 1664



to top

>ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560090), mRNA
          Length = 411

 Score =  182 bits (92), Expect = 6e-43
 Identities = 191/224 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| | ||||
Sbjct: 404 cgctctccgcggatgcggcgggccagctggatgtccttgggcatgatggtgaccctcttg 345

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           |||||||||||||| ||||| ||||||||||| || || || || || || |||  || |
Sbjct: 344 gcgtggatggcgcacaggttagtgtcctcgaacagaccgaccagataagcttcgctggac 285

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  ||||||  |  ||||||||| || || |||||||||||||| |||
Sbjct: 284 tcctgaagagccatgacggcggagctctggaagcgcagatcagtcttgaagtcctgagcg 225

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           || || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 224 atttcacggaccagacgctggaagggcagtttgcggatcagcag 181



to top

>gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, partial cds
          Length = 516

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                       
Query: 238 cgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcaaagg 297
           |||||||||||||||||||||  |  ||||||||| |||||||||||||||||||| |||
Sbjct: 514 cgggcgagctggatgtccttgctctggatggtgacacgcttggcgtggatggcgcagagg 455

                                                                       
Query: 298 ttggtgtcctcgaaaagccccacgaggtacgcctcggcggcctcctggagggcgagcacg 357
           |||||||||||||| |||   |||||||| |||||| ||| |||||| || |||   | |
Sbjct: 454 ttggtgtcctcgaagagcgagacgaggtaggcctcgacggactcctgaagagcgccgatg 395

                                                                       
Query: 358 gcgtgggactggaagcggaggtccgtcttgaagtcctgcgcgatctcgcggaccaggcgc 417
           |||  ||||||||||||||| |||| |||||||||||| |||||||| ||||| || |||
Sbjct: 394 gcggaggactggaagcggagatccgacttgaagtcctgggcgatctcacggacaagacgc 335

                               
Query: 418 tggaagggcagcttgcggat 437
           ||||||||||||||||||||
Sbjct: 334 tggaagggcagcttgcggat 315



to top

>ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic histone H3
           (LOC373340), mRNA
          Length = 411

 Score =  182 bits (92), Expect = 6e-43
 Identities = 191/224 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttg 279
           ||||| || |||||||||||||| |||||||||||||| ||||||||||| || ||||||
Sbjct: 404 cgctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttg 345

                                                                       
Query: 280 gcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcggcc 339
           ||||||||||||||||||||||||||||||||||| |  || | ||| || |||  ||||
Sbjct: 344 gcgtggatggcgcaaaggttggtgtcctcgaaaagacggaccaagtaggcttcgctggcc 285

                                                                       
Query: 340 tcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgcgcg 399
           ||||| || || |  |||||   |  |||||| ||||| || |||||||||||||| |||
Sbjct: 284 tcctgaagagccatgacggcagagctctggaaacggagctcggtcttgaagtcctgagcg 225

                                                       
Query: 400 atctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| |||||||| ||||||||||| ||||||||||| |||||
Sbjct: 224 atctcacggaccagacgctggaaggggagcttgcggatgagcag 181



to top

>ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (LOC560616), mRNA
          Length = 411

 Score =  180 bits (91), Expect = 3e-42
 Identities = 193/227 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 276
           |||||||| ||||||||||||||||| ||||||||||| ||||||||||||||||| | |
Sbjct: 407 gcgcgctctccgcggatgcggcgggccagctggatgtctttgggcatgatggtgaccctc 348

                                                                       
Query: 277 ttggcgtggatggcgcaaaggttggtgtcctcgaaaagccccacgaggtacgcctcggcg 336
           ||||||||||||||||| ||||||||||||||||| || || || || || || |||  |
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagaccgaccagataagcttcgctg 288

                                                                       
Query: 337 gcctcctggagggcgagcacggcgtgggactggaagcggaggtccgtcttgaagtcctgc 396
           | |||||| || || |  ||||||  |  ||||||||| || || |||||||| ||||| 
Sbjct: 287 gactcctgaagagccatgacggcggagctctggaagcgcagatcagtcttgaaatcctga 228

                                                          
Query: 397 gcgatctcgcggaccaggcgctggaagggcagcttgcggatcagcag 443
           ||||| || |||||||| |||||||||||||| ||||||||||||||
Sbjct: 227 gcgatttctcggaccagacgctggaagggcagtttgcggatcagcag 181


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,724,875
Number of Sequences: 3902068
Number of extensions: 2724875
Number of successful extensions: 64376
Number of sequences better than 10.0: 3614
Number of HSP's better than 10.0 without gapping: 3609
Number of HSP's successfully gapped in prelim test: 8
Number of HSP's that attempted gapping in prelim test: 55901
Number of HSP's gapped (non-prelim): 7926
length of query: 443
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 421
effective length of database: 17,147,199,772
effective search space: 7218971104012
effective search space used: 7218971104012
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top