>ref|XM_470116.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1005

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Minus

                                                                       
Query: 225 tccctgatgattttctccaacggagtgaactgcaggcccagcgccatcagcttcttcggc 284
           ||||||||||| |||||||  ||| |||||||||  |||||||| ||||||||||||| |
Sbjct: 965 tccctgatgatcttctccatgggactgaactgcaaacccagcgcgatcagcttcttcgac 906

                                                                       
Query: 285 acaccctccgctctcaccagcccaggctgcgtgtccttggggaacttggggaccttgtaa 344
            || |||| ||||||||||||||||||||||| |||||||| || || || || ||||| 
Sbjct: 905 gcagcctctgctctcaccagcccaggctgcgtttccttgggtaattttggcactttgtac 846

                                                        
Query: 345 ttggggtagagctcggcaactttcgacgcgaaatcgctccagtga 389
           | ||||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 845 tcggggtagagctcggcgactttggaagcgaaatcgctccagtga 801

>dbj|AK058641.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-018-E01, full
            insert sequence
          Length = 1248

 Score =  153 bits (77), Expect = 5e-34
 Identities = 143/165 (86%)
 Strand = Plus / Minus

                                                                        
Query: 225  tccctgatgattttctccaacggagtgaactgcaggcccagcgccatcagcttcttcggc 284
            ||||||||||| |||||||  ||| |||||||||  |||||||| ||||||||||||| |
Sbjct: 1022 tccctgatgatcttctccatgggactgaactgcaaacccagcgcgatcagcttcttcgac 963

                                                                        
Query: 285  acaccctccgctctcaccagcccaggctgcgtgtccttggggaacttggggaccttgtaa 344
             || |||| ||||||||||||||||||||||| |||||||| || || || || ||||| 
Sbjct: 962  gcagcctctgctctcaccagcccaggctgcgtttccttgggtaattttggcactttgtac 903

                                                         
Query: 345  ttggggtagagctcggcaactttcgacgcgaaatcgctccagtga 389
            | ||||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 902  tcggggtagagctcggcgactttggaagcgaaatcgctccagtga 858

>gb|AY106466.1| Zea mays PCO095673 mRNA sequence
          Length = 813

 Score =  117 bits (59), Expect = 3e-23
 Identities = 149/179 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 aggctctccacggcgtccctgatgattttctccaacggagtgaactgcaggcccagcgcc 269
           |||||||| ||||| ||||||||||| |||||||  || |||| ||| || |||||||| 
Sbjct: 595 aggctctcgacggcatccctgatgatcttctccatgggggtgatctgaagccccagcgcg 536

                                                                       
Query: 270 atcagcttcttcggcacaccctccgctctcaccagcccaggctgcgtgtccttggggaac 329
            | |||||||| | | |  |||||  |||||||||||||||||| |||||| ||||||||
Sbjct: 535 gtgagcttcttggaccccacctcctgtctcaccagcccaggctgggtgtccatggggaac 476

                                                                      
Query: 330 ttggggaccttgtaattggggtagagctcggcaactttcgacgcgaaatcgctccagtg 388
           ||||| || ||||| | ||||||||||||||| ||||| |  ||||| |||||||||||
Sbjct: 475 ttgggcactttgtagtcggggtagagctcggcgactttggcggcgaagtcgctccagtg 417

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                            
Query: 225      tccctgatgattttctccaacggagtgaactgcaggcccagcgccatcagcttcttcggc 284
                ||||||||||| |||||||  ||| |||||||||  |||||||| ||||||||||||| |
Sbjct: 34039099 tccctgatgatcttctccatgggactgaactgcaaacccagcgcgatcagcttcttcgac 34039040

                                                         
Query: 285      acaccctccgctctcaccagcccaggctgcgtgtccttggg 325
                 || |||| ||||||||||||||||||||||| ||||||||
Sbjct: 34039039 gcagcctctgctctcaccagcccaggctgcgtttccttggg 34038999



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                           
Query: 347      ggggtagagctcggcaactttcgacgcgaaatcgctccagtga 389
                ||||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 34038743 ggggtagagctcggcgactttggaagcgaaatcgctccagtga 34038701

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                            
Query: 225      tccctgatgattttctccaacggagtgaactgcaggcccagcgccatcagcttcttcggc 284
                ||||||||||| |||||||  ||| |||||||||  |||||||| ||||||||||||| |
Sbjct: 34129571 tccctgatgatcttctccatgggactgaactgcaaacccagcgcgatcagcttcttcgac 34129512

                                                         
Query: 285      acaccctccgctctcaccagcccaggctgcgtgtccttggg 325
                 || |||| ||||||||||||||||||||||| ||||||||
Sbjct: 34129511 gcagcctctgctctcaccagcccaggctgcgtttccttggg 34129471



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                           
Query: 347      ggggtagagctcggcaactttcgacgcgaaatcgctccagtga 389
                ||||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 34129215 ggggtagagctcggcgactttggaagcgaaatcgctccagtga 34129173

>gb|AC104433.8| Oryza sativa chromosome 3 BAC OJ1754_E06 genomic sequence, complete
            sequence
          Length = 163828

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Minus

                                                                        
Query: 225  tccctgatgattttctccaacggagtgaactgcaggcccagcgccatcagcttcttcggc 284
            ||||||||||| |||||||  ||| |||||||||  |||||||| ||||||||||||| |
Sbjct: 2911 tccctgatgatcttctccatgggactgaactgcaaacccagcgcgatcagcttcttcgac 2852

                                                     
Query: 285  acaccctccgctctcaccagcccaggctgcgtgtccttggg 325
             || |||| ||||||||||||||||||||||| ||||||||
Sbjct: 2851 gcagcctctgctctcaccagcccaggctgcgtttccttggg 2811



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                       
Query: 347  ggggtagagctcggcaactttcgacgcgaaatcgctccagtga 389
            ||||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 2555 ggggtagagctcggcgactttggaagcgaaatcgctccagtga 2513

>gb|AC133007.4| Oryza sativa chromosome 3 BAC OSJNBa0094J08 genomic sequence, complete
             sequence
          Length = 172337

 Score =  105 bits (53), Expect = 1e-19
 Identities = 89/101 (88%)
 Strand = Plus / Plus

                                                                         
Query: 225   tccctgatgattttctccaacggagtgaactgcaggcccagcgccatcagcttcttcggc 284
             ||||||||||| |||||||  ||| |||||||||  |||||||| ||||||||||||| |
Sbjct: 18592 tccctgatgatcttctccatgggactgaactgcaaacccagcgcgatcagcttcttcgac 18651

                                                      
Query: 285   acaccctccgctctcaccagcccaggctgcgtgtccttggg 325
              || |||| ||||||||||||||||||||||| ||||||||
Sbjct: 18652 gcagcctctgctctcaccagcccaggctgcgtttccttggg 18692



 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                        
Query: 347   ggggtagagctcggcaactttcgacgcgaaatcgctccagtga 389
             ||||||||||||||| ||||| || ||||||||||||||||||
Sbjct: 18948 ggggtagagctcggcgactttggaagcgaaatcgctccagtga 18990

>gb|AY108886.1| Zea mays PCO075085 mRNA sequence
          Length = 668

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 78/90 (86%)
 Strand = Plus / Plus

                                                                       
Query: 299 caccagcccaggctgcgtgtccttggggaacttggggaccttgtaattggggtagagctc 358
           ||||||||||||||| || ||||||||||||||||| |||||||| |  ||||| |||||
Sbjct: 292 caccagcccaggctgggtatccttggggaacttgggcaccttgtactcagggtacagctc 351

                                         
Query: 359 ggcaactttcgacgcgaaatcgctccagtg 388
           ||| || || | |||||| |||||||||||
Sbjct: 352 ggcgaccttggccgcgaagtcgctccagtg 381



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 215 ctccacggcgtccctgatgattttctcca 243
           |||||| |||||||||||||| |||||||
Sbjct: 202 ctccacagcgtccctgatgatcttctcca 230

>ref|NM_125235.2| Arabidopsis thaliana cinnamoyl-CoA reductase AT5G58490 mRNA,
           complete cds
          Length = 1164

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 327 aacttggggaccttgtaattggggtagagctcggcaacttt 367
           ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 879 aacttggggacattgtaattgggatagagctcagcaacttt 839

>gb|AY070387.1| Arabidopsis thaliana At5g58490 mRNA sequence
          Length = 1176

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 327 aacttggggaccttgtaattggggtagagctcggcaacttt 367
           ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 874 aacttggggacattgtaattgggatagagctcagcaacttt 834

>emb|BX829945.1|CNS0A05K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB48ZH08 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1291

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 327  aacttggggaccttgtaattggggtagagctcggcaacttt 367
            ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 1096 aacttggggacattgtaattgggatagagctcagcaacttt 1056

>emb|BX832502.1|CNS09ZKK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH77ZF02 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1082

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 327 aacttggggaccttgtaattggggtagagctcggcaacttt 367
           ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 850 aacttggggacattgtaattgggatagagctcagcaacttt 810

>emb|BX833752.1|CNS09Z4X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL75ZC10 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1042

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 327 aacttggggaccttgtaattggggtagagctcggcaacttt 367
           ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 825 aacttggggacattgtaattgggatagagctcagcaacttt 785

>gb|AY086975.1| Arabidopsis thaliana clone 30064 mRNA, complete sequence
          Length = 1150

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 327 aacttggggaccttgtaattggggtagagctcggcaacttt 367
           ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 879 aacttggggacattgtaattgggatagagctcagcaacttt 839

>gb|BT002742.1| Arabidopsis thaliana clone C105311 putative cinnamoyl-CoA reductase
           (At5g58490) mRNA, complete cds
          Length = 1006

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 327 aacttggggaccttgtaattggggtagagctcggcaacttt 367
           ||||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 833 aacttggggacattgtaattgggatagagctcagcaacttt 793

>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score = 56.0 bits (28), Expect = 9e-05
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                     
Query: 328   acttggggaccttgtaattggggtagagctcggcaacttt 367
             |||||||||| ||||||||||| |||||||| ||||||||
Sbjct: 30268 acttggggacattgtaattgggatagagctcagcaacttt 30229

>gb|AC096626.31| Mus musculus strain C57BL/6J clone rp23-423p15 map 1, complete sequence
          Length = 208247

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 234   attttctccaacggagtgaact 255
             ||||||||||||||||||||||
Sbjct: 78577 attttctccaacggagtgaact 78556

>gb|AC009869.7| Homo sapiens chromosome 11, clone RP11-222N13, complete sequence
          Length = 192696

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 96    gggctgggcacaacacatctct 117
             ||||||||||||||||||||||
Sbjct: 26236 gggctgggcacaacacatctct 26257

>gb|AC160530.8| Mus musculus chromosome 1, clone RP24-225F15, complete sequence
          Length = 170817

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 234    attttctccaacggagtgaact 255
              ||||||||||||||||||||||
Sbjct: 109840 attttctccaacggagtgaact 109819

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 268    ccatcagcttcttcggcacac 288
              |||||||||||||||||||||
Sbjct: 782621 ccatcagcttcttcggcacac 782601

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 268    ccatcagcttcttcggcacac 288
              |||||||||||||||||||||
Sbjct: 838246 ccatcagcttcttcggcacac 838266

>emb|AL670004.1|NC5E6 Neurospora crassa DNA linkage group V Cosmid contig 5E6
          Length = 119882

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 274   gcttcttcggcacaccctcc 293
             ||||||||||||||||||||
Sbjct: 94991 gcttcttcggcacaccctcc 95010

>gb|AC013562.6| Homo sapiens chromosome 8, clone RP11-313C15, complete sequence
          Length = 188755

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   acaacagaagggaaggaata 161
             ||||||||||||||||||||
Sbjct: 83713 acaacagaagggaaggaata 83694

>gb|AC026970.7| Homo sapiens chromosome 11, clone RP11-472K20, complete sequence
          Length = 132987

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctagcactgggctgggcaca 107
             ||||||||||||||||||||
Sbjct: 85233 ctagcactgggctgggcaca 85214

>gb|AC022858.8| Homo sapiens chromosome 8, clone RP11-326E22, complete sequence
          Length = 187340

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctagcactgggctgggcaca 107
             ||||||||||||||||||||
Sbjct: 44117 ctagcactgggctgggcaca 44098

>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII,
              complete sequence
          Length = 1476513

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 263    cagcgccatcagcttcttcg 282
              ||||||||||||||||||||
Sbjct: 856015 cagcgccatcagcttcttcg 856034

>emb|AJ230710.1|MMAJ0710 Meles meles DNA, microsatellite marker, clone B26D10
          Length = 750

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 225 tccctgatgattttctccaa 244
           ||||||||||||||||||||
Sbjct: 50  tccctgatgattttctccaa 31

>ref|NM_211801.1| Eremothecium gossypii AGR074Cp (AGR074C), mRNA
          Length = 14700

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   cagcgccatcagcttcttcg 282
             ||||||||||||||||||||
Sbjct: 13003 cagcgccatcagcttcttcg 12984

>emb|AL671935.30| Mouse DNA sequence from clone RP23-421J13 on chromosome X, complete
              sequence
          Length = 194258

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 168    acctaataatccagccatca 187
              ||||||||||||||||||||
Sbjct: 175133 acctaataatccagccatca 175152

>gb|AC090692.9| Homo sapiens chromosome 11, clone RP11-698N11, complete sequence
          Length = 179494

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ctagcactgggctgggcaca 107
             ||||||||||||||||||||
Sbjct: 16616 ctagcactgggctgggcaca 16597


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,179,588
Number of Sequences: 3902068
Number of extensions: 3179588
Number of successful extensions: 54645
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 54558
Number of HSP's gapped (non-prelim): 86
length of query: 407
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 385
effective length of database: 17,147,199,772
effective search space: 6601671912220
effective search space used: 6601671912220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)