>emb|AL662779.10| Mouse DNA sequence from clone RP23-177A4 on chromosome 11 Contains the
             Kif2b gene for kinesin family member 28, complete sequence
          Length = 231926

 Score = 44.1 bits (22), Expect = 0.32
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 3     aagacaattattaacagaaact 24
             ||||||||||||||||||||||
Sbjct: 65922 aagacaattattaacagaaact 65901

>gb|AC018541.7| Homo sapiens chromosome 8, clone RP11-108E14, complete sequence
          Length = 156674

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 113   acaggaacagacaatagcaaa 133
             |||||||||||||||||||||
Sbjct: 69154 acaggaacagacaatagcaaa 69134

>gb|CP000317.1| Polaromonas sp. JS666 plasmid 1, complete sequence
          Length = 360405

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 282  agccagcgcaagcttccctgt 302
            |||||||||||||||||||||
Sbjct: 8227 agccagcgcaagcttccctgt 8207

>emb|AL139352.16| Human DNA sequence from clone RP11-445H22 on chromosome 20 Contains the
             5' end of the ADA gene for adenosine deaminase, a novel
             gene, the 3' end of a novel gene, the WISP2 gene for WNT1
             inducible signaling pathway protein 2 and a CpG island,
             complete sequence
          Length = 107260

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 192   atgtttctgtgccaggcaccg 212
             |||||||||||||||||||||
Sbjct: 18523 atgtttctgtgccaggcaccg 18503

>gb|AC021955.11| Homo sapiens chromosome 8, clone RP11-238G17, complete sequence
          Length = 192139

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 113    acaggaacagacaatagcaaa 133
              |||||||||||||||||||||
Sbjct: 180351 acaggaacagacaatagcaaa 180371

>gb|AE007287.1| Sinorhizobium meliloti 1021 plasmid pSymA section 93 of 121 of the
             complete plasmid sequence
          Length = 11403

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 262   gaggaaaccttcggtcccgt 281
             ||||||||||||||||||||
Sbjct: 10940 gaggaaaccttcggtcccgt 10959

>emb|AL691484.14| Mouse DNA sequence from clone RP23-230C2 on chromosome 4 Contains the
             Atp6v1g1 gene for 13kD lysosomal H+ transporting ATPase V1
             subunit G variant 1, four novel genes (including
             1700018C11Rik), a ribosomal protein L35a (Rpl35a)
             pseudogene and two CpG islands, complete sequence
          Length = 116289

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 149   tgagctcttcttactggccg 168
             ||||||||||||||||||||
Sbjct: 51405 tgagctcttcttactggccg 51386

>gb|AC114738.4| Homo sapiens BAC clone CTD-2192M1 from 4, complete sequence
          Length = 134697

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 130   caaatgcacagacacagaat 149
             ||||||||||||||||||||
Sbjct: 52111 caaatgcacagacacagaat 52092


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,822,196
Number of Sequences: 3902068
Number of extensions: 2822196
Number of successful extensions: 51995
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51976
Number of HSP's gapped (non-prelim): 19
length of query: 372
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 350
effective length of database: 17,147,199,772
effective search space: 6001519920200
effective search space used: 6001519920200
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)