ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbast69h02
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AY555186.1| Anchomanes difformis voucher Barabe and Archambau... 36 3.3
2gb|AY555179.1| Aglaonema crispum voucher Barabe and Archambault ... 36 3.3
3gb|AY555174.1| Calla palustris voucher Barabe and Archambault 17... 36 3.3
4gb|AY555172.1| Schismatoglottis calyptrata voucher Barabe and Ar... 36 3.3
5gb|AY555171.1| Schismatoglottis americana voucher Barabe 82 (MT)... 36 3.3
6gb|AY290846.1| Schismatoglottis mutata trnL-trnF intergenic spac... 36 3.3
7gb|AY290843.1| Aglaonema rotunda trnL-trnF intergenic spacer, pa... 36 3.3
8gb|AY290842.1| Nephthytis poissonii trnL-trnF intergenic spacer,... 36 3.3
9gb|AY290841.1| Asterostigma lividum trnL-trnF intergenic spacer,... 36 3.3
10gb|AY290840.1| Callopsis volkensii trnL-trnF intergenic spacer, ... 36 3.3
11gb|AY290837.1| Calla palustris trnL-trnF intergenic spacer, part... 36 3.3
12emb|AL354827.5| Human DNA sequence from clone RP11-280J7 on chro... 36 3.3
13gb|AY054715.1| Spathicarpa sagittifolia chloroplast tRNA-Leu (tr... 36 3.3
14gb|AY054714.1| Dieffenbachia pittieri chloroplast tRNA-Leu (trnL... 36 3.3
15gb|AY054702.1| Nephthytis afzelii chloroplast tRNA-Leu (trnL) ge... 36 3.3
16gb|AY054701.1| Cercestis stigmaticus chloroplast tRNA-Leu (trnL)... 36 3.3
17gb|AY054700.1| Aglaonema modestum chloroplast tRNA-Leu (trnL) ge... 36 3.3
18emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, ... 36 3.3
19gb|AC147836.2| Xenopus tropicalis clone CH216-26D18, complete se... 36 3.3
20gb|DQ400874.1| Calla palustris voucher Wen 7299 tRNA-Leu (trnL) ... 36 3.3
21gb|AC092757.2| Homo sapiens chromosome 15 clone RP11-59H7 map 15... 36 3.3
22gb|AC150478.3| Monodelphis domestica clone VMRC6-508P4, complete... 36 3.3
23gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold 36 3.3 
>gb|AY555186.1| Anchomanes difformis voucher Barabe and Archambault 191 (MT)
           tRNA-Leu (tnrL) gene, partial sequence; trnL-trnF
           intergenic spacer, complete sequence; and tRNA-Phe
           (trnF) gene, partial sequence; chloroplast
          Length = 968

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 678 gggctaaactaaacataaaacg 657
to top
>gb|AY555179.1| Aglaonema crispum voucher Barabe and Archambault 198 (MT) tRNA-Leu
           (tnrL) gene, partial sequence; trnL-trnF intergenic
           spacer, complete sequence; and tRNA-Phe (trnF) gene,
           partial sequence; chloroplast
          Length = 971

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 667 gggctaaactaaacataaaacg 646
to top
>gb|AY555174.1| Calla palustris voucher Barabe and Archambault 174 (MT) tRNA-Leu
           (tnrL) gene, partial sequence; trnL-trnF intergenic
           spacer, complete sequence; and tRNA-Phe (trnF) gene,
           partial sequence; chloroplast
          Length = 964

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 677 gggctaaactaaacataaaacg 656
to top
>gb|AY555172.1| Schismatoglottis calyptrata voucher Barabe and Archambault 194 (MT)
           tRNA-Leu (tnrL) gene, partial sequence; trnL-trnF
           intergenic spacer, complete sequence; and tRNA-Phe
           (trnF) gene, partial sequence; chloroplast
          Length = 1008

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 700 gggctaaactaaacataaaacg 679
to top
>gb|AY555171.1| Schismatoglottis americana voucher Barabe 82 (MT) tRNA-Leu (tnrL)
           gene, partial sequence; trnL-trnF intergenic spacer,
           complete sequence; and tRNA-Phe (trnF) gene, partial
           sequence; chloroplast
          Length = 1175

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 863 gggctaaactaaacataaaacg 842
to top
>gb|AY290846.1| Schismatoglottis mutata trnL-trnF intergenic spacer, partial
          sequence; chloroplast
          Length = 396

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                
Query: 1  gggctaaactatacataaaacg 22
          ||||||||||| ||||||||||
Sbjct: 81 gggctaaactaaacataaaacg 60
to top
>gb|AY290843.1| Aglaonema rotunda trnL-trnF intergenic spacer, partial sequence;
          chloroplast
          Length = 397

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                
Query: 1  gggctaaactatacataaaacg 22
          ||||||||||| ||||||||||
Sbjct: 92 gggctaaactaaacataaaacg 71
to top
>gb|AY290842.1| Nephthytis poissonii trnL-trnF intergenic spacer, partial
          sequence; chloroplast
          Length = 386

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                
Query: 1  gggctaaactatacataaaacg 22
          ||||||||||| ||||||||||
Sbjct: 81 gggctaaactaaacataaaacg 60
to top
>gb|AY290841.1| Asterostigma lividum trnL-trnF intergenic spacer, partial
          sequence; chloroplast
          Length = 437

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                
Query: 1  gggctaaactatacataaaacg 22
          ||||||||||| ||||||||||
Sbjct: 92 gggctaaactaaacataaaacg 71
to top
>gb|AY290840.1| Callopsis volkensii trnL-trnF intergenic spacer, partial
          sequence; chloroplast
          Length = 259

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                
Query: 1  gggctaaactatacataaaacg 22
          ||||||||||| ||||||||||
Sbjct: 49 gggctaaactaaacataaaacg 28
to top
>gb|AY290837.1| Calla palustris trnL-trnF intergenic spacer, partial sequence;
          chloroplast
          Length = 393

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                
Query: 1  gggctaaactatacataaaacg 22
          ||||||||||| ||||||||||
Sbjct: 92 gggctaaactaaacataaaacg 71
to top
>emb|AL354827.5| Human DNA sequence from clone RP11-280J7 on chromosome 13, complete
              sequence
          Length = 127641

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 4      ctaaactatacataaaac 21
              ||||||||||||||||||
Sbjct: 100697 ctaaactatacataaaac 100680
to top
>gb|AY054715.1| Spathicarpa sagittifolia chloroplast tRNA-Leu (trnL) gene, partial
           sequence; trnL-trnF intergenic spacer, complete
           sequence; and tRNA-Phe (trnF) gene, partial sequence
          Length = 992

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 680 gggctaaactaaacataaaacg 659
to top
>gb|AY054714.1| Dieffenbachia pittieri chloroplast tRNA-Leu (trnL) gene, partial
           sequence; trnL-trnF intergenic spacer, complete
           sequence; and tRNA-Phe (trnF) gene, partial sequence
          Length = 1007

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 687 gggctaaactaaacataaaacg 666
to top
>gb|AY054702.1| Nephthytis afzelii chloroplast tRNA-Leu (trnL) gene, partial
           sequence; trnL-trnF intergenic spacer, complete
           sequence; and tRNA-Phe (trnF) gene, partial sequence
          Length = 960

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 683 gggctaaactaaacataaaacg 662
to top
>gb|AY054701.1| Cercestis stigmaticus chloroplast tRNA-Leu (trnL) gene, partial
           sequence; trnL-trnF intergenic spacer, complete
           sequence; and tRNA-Phe (trnF) gene, partial sequence
          Length = 962

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 682 gggctaaactaaacataaaacg 661
to top
>gb|AY054700.1| Aglaonema modestum chloroplast tRNA-Leu (trnL) gene, partial
           sequence; trnL-trnF intergenic spacer, complete
           sequence; and tRNA-Phe (trnF) gene, partial sequence
          Length = 965

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 681 gggctaaactaaacataaaacg 660
to top
>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 10      tatacataaaacgtgcca 27
               ||||||||||||||||||
Sbjct: 1419952 tatacataaaacgtgcca 1419935
to top
>gb|AC147836.2| Xenopus tropicalis clone CH216-26D18, complete sequence
          Length = 157688

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 4      ctaaactatacataaaac 21
              ||||||||||||||||||
Sbjct: 122797 ctaaactatacataaaac 122814
to top
>gb|DQ400874.1| Calla palustris voucher Wen 7299 tRNA-Leu (trnL) gene, partial
           sequence; trnL-trnF intergenic spacer, complete
           sequence; and tRNA-Phe (trnF) gene, partial sequence;
           chloroplast
          Length = 913

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                 
Query: 1   gggctaaactatacataaaacg 22
           ||||||||||| ||||||||||
Sbjct: 658 gggctaaactaaacataaaacg 637
to top
>gb|AC092757.2| Homo sapiens chromosome 15 clone RP11-59H7 map 15q21.3, complete
             sequence
          Length = 171114

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 7     aactatacataaaacgtg 24
             ||||||||||||||||||
Sbjct: 20691 aactatacataaaacgtg 20674
to top
>gb|AC150478.3| Monodelphis domestica clone VMRC6-508P4, complete sequence
          Length = 81497

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 5     taaactatacataaaacgtgcc 26
             |||| |||||||||||||||||
Sbjct: 45331 taaaatatacataaaacgtgcc 45310
to top
>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold
          Length = 1833844

 Score = 36.2 bits (18), Expect = 3.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                     
Query: 5       taaactatacataaaacgtgcc 26
               |||| |||||||||||||||||
Sbjct: 1797678 taaaatatacataaaacgtgcc 1797657


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 193,233
Number of Sequences: 3902068
Number of extensions: 193233
Number of successful extensions: 42077
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42037
Number of HSP's gapped (non-prelim): 40
length of query: 35
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 15
effective length of database: 17,155,003,908
effective search space: 257325058620
effective search space used: 257325058620
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top