Clone Name	rbast69d07
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BT009046.1| Triticum aestivum clone wdk9n.pk001.j17:fis, full...	527	e-147
2	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	293	2e-76
3	dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic D...	293	2e-76
4	ref|NM_184296.1| Oryza sativa (japonica cultivar-group), mRNA	289	4e-75
5	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	226	5e-56
6	dbj|AK105075.1| Oryza sativa (japonica cultivar-group) cDNA clon...	226	5e-56
7	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	226	5e-56
8	emb|AL928755.5|CNS08CBS Oryza sativa chromosome 12, . BAC OSJNBb...	226	5e-56
9	gb|BT017384.1| Zea mays clone EL01N0326F04.c mRNA sequence	212	7e-52
10	gb|AY103965.1| Zea mays PCO145463 mRNA sequence	206	4e-50
11	gb|AC120307.3| Oryza sativa (japonica cultivar-group) chromosome...	202	7e-49
12	gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosom...	202	7e-49
13	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	202	7e-49
14	dbj|AK121546.1| Oryza sativa (japonica cultivar-group) cDNA clon...	202	7e-49
15	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	202	7e-49
16	gb|AF093540.1|AF093540 Zea mays ribosomal protein L26 mRNA, part...	125	1e-25
17	gb|DQ214871.1| Taeniopygia guttata clone 0058P0019E02 ribosomal ...	78	3e-11
18	gb|DQ214869.1| Taeniopygia guttata clone 0061P0024E01 ribosomal ...	78	3e-11
19	gb|DQ214868.1| Taeniopygia guttata clone 0058P0030E07 ribosomal ...	78	3e-11
20	gb|DQ214867.1| Taeniopygia guttata clone 0058P0003F10 ribosomal ...	78	3e-11
21	gb|DQ214865.1| Taeniopygia guttata clone 0061P0014H12 ribosomal ...	78	3e-11
22	gb|DQ214864.1| Taeniopygia guttata clone 0064P0017H07 ribosomal ...	78	3e-11
23	gb|DQ214863.1| Taeniopygia guttata clone 0061P0022H04 ribosomal ...	78	3e-11
24	gb|DQ214862.1| Taeniopygia guttata clone 0063P0003B08 ribosomal ...	78	3e-11
25	gb|DQ214860.1| Taeniopygia guttata clone 0064P0011G04 ribosomal ...	78	3e-11
26	gb|DQ214859.1| Taeniopygia guttata clone 0061P0025F11 ribosomal ...	78	3e-11
27	gb|DQ214857.1| Taeniopygia guttata clone 0061P0006E10 ribosomal ...	78	3e-11
28	gb|DQ214872.1| Taeniopygia guttata clone 0061P0018B10 ribosomal ...	76	1e-10
29	gb|DQ214870.1| Taeniopygia guttata clone 0058P0008D12 ribosomal ...	76	1e-10
30	gb|DQ214866.1| Taeniopygia guttata clone 0058P0040F11 ribosomal ...	76	1e-10
31	gb|DQ214861.1| Taeniopygia guttata clone 0061P0022G09 ribosomal ...	76	1e-10
32	gb|DQ214858.1| Taeniopygia guttata clone 0058P0046C11 ribosomal ...	76	1e-10
33	gb|DQ214856.1| Taeniopygia guttata clone 0058P0048B02 ribosomal ...	76	1e-10
34	gb|DQ214855.1| Taeniopygia guttata clone 0058P0014D08 ribosomal ...	76	1e-10
35	gb|AC109196.12| Mus musculus chromosome 5, clone RP23-313F5, com...	74	4e-10
36	ref|XM_213346.3| PREDICTED: Rattus norvegicus ribosomal protein ...	74	4e-10
37	ref|XM_215658.3| PREDICTED: Rattus norvegicus protein tyrosine p...	74	4e-10
38	ref|XM_574290.1| PREDICTED: Rattus norvegicus similar to 60S rib...	74	4e-10
39	ref|NM_009080.1| Mus musculus ribosomal protein L26 (Rpl26), mRNA	68	3e-08
40	gb|AC026478.5| Mus musculus strain C57BL6/J chromosome 5 clone R...	68	3e-08
41	ref|XM_990793.1| PREDICTED: Mus musculus similar to 60S ribosoma...	68	3e-08
42	ref|XR_005009.1| PREDICTED: Mus musculus similar to 60S ribosoma...	68	3e-08
43	ref|XR_001911.1| PREDICTED: Mus musculus similar to 60S ribosoma...	68	3e-08
44	dbj|AK146116.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length...	68	3e-08
45	gb|AC154807.2| Mus musculus BAC clone RP23-79E7 from chromosome ...	68	3e-08
46	emb|AL935312.10| Mouse DNA sequence from clone RP23-56A7 on chro...	68	3e-08
47	emb|X80699.1|MML26MRN M.musculus L26 mRNA	68	3e-08
48	emb|AL928551.8| Mouse DNA sequence from clone RP23-246P12 on chr...	68	3e-08
49	ref|XM_361491.1| Magnaporthe grisea 70-15 hypothetical protein (...	66	1e-07
50	gb|BC070397.1| Mus musculus ribosomal protein L26, mRNA (cDNA cl...	66	1e-07
51	gb|AC113961.14| Mus musculus chromosome 19, clone RP23-18G1, com...	66	1e-07
52	ref|XM_001002260.1| PREDICTED: Mus musculus similar to 60S ribos...	66	1e-07
53	emb|X14671.1|RRRPL26 Rat liver mRNA for ribosomal protein L26	66	1e-07
54	gb|BC099481.1| Mus musculus ribosomal protein L26, mRNA (cDNA cl...	66	1e-07
55	dbj|AK135286.1| Mus musculus 12 days embryo male wolffian duct i...	66	1e-07
56	dbj|AK146113.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-...	66	1e-07
57	dbj|AK152589.1| Mus musculus bone marrow macrophage cDNA, RIKEN ...	66	1e-07
58	dbj|AK167245.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f...	66	1e-07
59	dbj|AK169131.1| Mus musculus 17 days pregnant adult female amnio...	66	1e-07
60	emb|CR656768.2|CNS0F5QE Tetraodon nigroviridis full-length cDNA	62	2e-06
61	ref|XM_785677.1| PREDICTED: Strongylocentrotus purpuratus simila...	62	2e-06
62	ref|XM_550079.1| Oryza sativa (japonica cultivar-group), mRNA	60	6e-06
63	gb|AC126800.3| Mus musculus BAC clone RP24-447D19 from chromosom...	60	6e-06
64	gb|AY231776.1| Drosophila yakuba clone yak-em_CG6846 mRNA sequence	60	6e-06
65	gb|AC010563.6| Drosophila melanogaster 3L BAC RP98-9M20 (Roswell...	60	6e-06
66	ref|NM_140813.2| Drosophila melanogaster Ribosomal protein L26 C...	60	6e-06
67	gb|AY071133.1| Drosophila melanogaster RE17611 full length cDNA	60	6e-06
68	gb|DQ016993.1| Ipomoea batatas putative L24 ribosomal protein mR...	60	6e-06
69	dbj|AK058868.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
70	gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66...	60	6e-06
71	ref|XM_322822.1| Neurospora crassa OR74A hypothetical protein (N...	58	2e-05
72	ref|XM_951035.1| Neurospora crassa OR74A hypothetical protein (N...	58	2e-05
73	ref|XM_745917.1| Aspergillus fumigatus Af293 ribosomal protein L...	58	2e-05
74	emb|BX284746.1|NCB23I4 Neurospora crassa DNA linkage group II BA...	58	2e-05
75	emb|AL807577.1|AFA12H2 Aspergillus fumigatus BAC AFA12F2	58	2e-05
76	emb|AL669986.1|NCB7N14 Neurospora crassa DNA linkage group II BA...	58	2e-05
77	gb|AC160985.4| Mus musculus BAC clone RP23-333D9 from chromosome...	58	2e-05
78	gb|AC079273.5| Mus musculus strain C57BL/6J chromosome 12 clone ...	58	2e-05
79	ref|XM_226231.3| PREDICTED: Rattus norvegicus similar to 60S rib...	58	2e-05
80	gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, comple...	58	2e-05
81	tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ...	58	2e-05
82	emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus co...	58	2e-05
83	gb|AC125143.4| Mus musculus BAC clone RP24-342H13 from 17, compl...	56	1e-04
84	gb|AC168090.3| Mus musculus BAC clone RP24-272N5 from chromosome...	56	1e-04
85	gb|DQ214873.1| Taeniopygia guttata clone 0065P0006F04 ribosomal ...	54	4e-04
86	emb|CR734278.2|CNS0GTCL Tetraodon nigroviridis full-length cDNA	54	4e-04
87	emb|CR727400.2|CNS0GO7I Tetraodon nigroviridis full-length cDNA	54	4e-04
88	emb|CR722268.2|CNS0GK8Y Tetraodon nigroviridis full-length cDNA	54	4e-04
89	emb|CR721252.2|CNS0GJGQ Tetraodon nigroviridis full-length cDNA	54	4e-04
90	emb|CR719224.2|CNS0GHWE Tetraodon nigroviridis full-length cDNA	54	4e-04
91	emb|CR717811.2|CNS0GGT5 Tetraodon nigroviridis full-length cDNA	54	4e-04
92	emb|CR717151.2|CNS0GGAW Tetraodon nigroviridis full-length cDNA	54	4e-04
93	emb|CR715926.2|CNS0GFCY Tetraodon nigroviridis full-length cDNA	54	4e-04
94	emb|CR715491.2|CNS0GF0V Tetraodon nigroviridis full-length cDNA	54	4e-04
95	emb|CR713914.2|CNS0GDT2 Tetraodon nigroviridis full-length cDNA	54	4e-04
96	emb|CR713617.2|CNS0GDKT Tetraodon nigroviridis full-length cDNA	54	4e-04
97	emb|CR713613.2|CNS0GDKP Tetraodon nigroviridis full-length cDNA	54	4e-04
98	emb|CR712581.2|CNS0GCS1 Tetraodon nigroviridis full-length cDNA	54	4e-04
99	emb|CR709848.2|CNS0GAO4 Tetraodon nigroviridis full-length cDNA	54	4e-04
100	emb|CR709512.2|CNS0GAES Tetraodon nigroviridis full-length cDNA	54	4e-04
101	emb|CR709445.2|CNS0GACX Tetraodon nigroviridis full-length cDNA	54	4e-04
102	emb|CR708874.2|CNS0G9X2 Tetraodon nigroviridis full-length cDNA	54	4e-04
103	emb|CR708847.2|CNS0G9WB Tetraodon nigroviridis full-length cDNA	54	4e-04
104	emb|CR709150.2|CNS0GA4Q Tetraodon nigroviridis full-length cDNA	54	4e-04
105	emb|CR708771.2|CNS0G9U7 Tetraodon nigroviridis full-length cDNA	54	4e-04
106	emb|CR708071.2|CNS0G9AR Tetraodon nigroviridis full-length cDNA	54	4e-04
107	emb|CR707257.2|CNS0G8O5 Tetraodon nigroviridis full-length cDNA	54	4e-04
108	emb|CR707183.2|CNS0G8M3 Tetraodon nigroviridis full-length cDNA	54	4e-04
109	emb|CR706350.2|CNS0G7YY Tetraodon nigroviridis full-length cDNA	54	4e-04
110	emb|CR706307.2|CNS0G7XR Tetraodon nigroviridis full-length cDNA	54	4e-04
111	emb|CR706271.2|CNS0G7WR Tetraodon nigroviridis full-length cDNA	54	4e-04
112	emb|CR705468.2|CNS0G7AG Tetraodon nigroviridis full-length cDNA	54	4e-04
113	emb|CR705102.2|CNS0G70A Tetraodon nigroviridis full-length cDNA	54	4e-04
114	emb|CR704827.2|CNS0G6SN Tetraodon nigroviridis full-length cDNA	54	4e-04
115	emb|CR704087.2|CNS0G683 Tetraodon nigroviridis full-length cDNA	54	4e-04
116	emb|CR701210.2|CNS0G406 Tetraodon nigroviridis full-length cDNA	54	4e-04
117	emb|CR699151.2|CNS0G2EZ Tetraodon nigroviridis full-length cDNA	54	4e-04
118	emb|CR698971.2|CNS0G29Z Tetraodon nigroviridis full-length cDNA	54	4e-04
119	emb|CR697641.2|CNS0G191 Tetraodon nigroviridis full-length cDNA	54	4e-04
120	emb|CR696598.2|CNS0G0G2 Tetraodon nigroviridis full-length cDNA	54	4e-04
121	emb|CR696265.2|CNS0G06T Tetraodon nigroviridis full-length cDNA	54	4e-04
122	emb|CR695617.2|CNS0FZOT Tetraodon nigroviridis full-length cDNA	54	4e-04
123	emb|CR695829.2|CNS0FZUP Tetraodon nigroviridis full-length cDNA	54	4e-04
124	emb|CR694165.2|CNS0FYKH Tetraodon nigroviridis full-length cDNA	54	4e-04
125	emb|CR693552.2|CNS0FY3G Tetraodon nigroviridis full-length cDNA	54	4e-04
126	emb|CR688368.2|CNS0FU3G Tetraodon nigroviridis full-length cDNA	54	4e-04
127	emb|CR688529.2|CNS0FU7X Tetraodon nigroviridis full-length cDNA	54	4e-04
128	emb|CR687983.2|CNS0FTSR Tetraodon nigroviridis full-length cDNA	54	4e-04
129	emb|CR679451.2|CNS0FN7R Tetraodon nigroviridis full-length cDNA	54	4e-04
130	emb|CR678843.2|CNS0FMQV Tetraodon nigroviridis full-length cDNA	54	4e-04
131	emb|CR678338.2|CNS0FMD0 Tetraodon nigroviridis full-length cDNA	54	4e-04
132	emb|CR677828.2|CNS0FLZ0 Tetraodon nigroviridis full-length cDNA	54	4e-04
133	emb|CR676983.2|CNS0FLBN Tetraodon nigroviridis full-length cDNA	54	4e-04
134	emb|CR675560.2|CNS0FK8E Tetraodon nigroviridis full-length cDNA	54	4e-04
135	emb|CR670125.2|CNS0FG1F Tetraodon nigroviridis full-length cDNA	54	4e-04
136	emb|CR669494.2|CNS0FFJW Tetraodon nigroviridis full-length cDNA	54	4e-04
137	emb|CR664760.2|CNS0FBWE Tetraodon nigroviridis full-length cDNA	54	4e-04
138	emb|CR664215.2|CNS0FBH9 Tetraodon nigroviridis full-length cDNA	54	4e-04
139	emb|CR658223.2|CNS0F6UT Tetraodon nigroviridis full-length cDNA	54	4e-04
140	emb|CR657395.2|CNS0F67T Tetraodon nigroviridis full-length cDNA	54	4e-04
141	emb|CR656781.2|CNS0F5QR Tetraodon nigroviridis full-length cDNA	54	4e-04
142	emb|CR655153.2|CNS0F4HJ Tetraodon nigroviridis full-length cDNA	54	4e-04
143	emb|CR653644.2|CNS0F3BM Tetraodon nigroviridis full-length cDNA	54	4e-04
144	emb|CR653632.2|CNS0F3BA Tetraodon nigroviridis full-length cDNA	54	4e-04
145	emb|CR652898.2|CNS0F2QW Tetraodon nigroviridis full-length cDNA	54	4e-04
146	emb|CR652258.2|CNS0F294 Tetraodon nigroviridis full-length cDNA	54	4e-04
147	emb|CR652236.2|CNS0F28I Tetraodon nigroviridis full-length cDNA	54	4e-04
148	emb|CR652521.2|CNS0F2GF Tetraodon nigroviridis full-length cDNA	54	4e-04
149	emb|CR650658.2|CNS0F10O Tetraodon nigroviridis full-length cDNA	54	4e-04
150	emb|CR650105.2|CNS0F0LB Tetraodon nigroviridis full-length cDNA	54	4e-04
151	emb|CR649217.2|CNS0EZWN Tetraodon nigroviridis full-length cDNA	54	4e-04
152	emb|CR647589.2|CNS0EYNF Tetraodon nigroviridis full-length cDNA	54	4e-04
153	emb|CR647557.2|CNS0EYMJ Tetraodon nigroviridis full-length cDNA	54	4e-04
154	emb|CR646889.2|CNS0EY3Z Tetraodon nigroviridis full-length cDNA	54	4e-04
155	emb|CR646010.2|CNS0EXFK Tetraodon nigroviridis full-length cDNA	54	4e-04
156	emb|CR645764.2|CNS0EX8Q Tetraodon nigroviridis full-length cDNA	54	4e-04
157	emb|CR645395.2|CNS0EWYH Tetraodon nigroviridis full-length cDNA	54	4e-04
158	emb|CR644649.2|CNS0EWDR Tetraodon nigroviridis full-length cDNA	54	4e-04
159	emb|CR644529.2|CNS0EWAF Tetraodon nigroviridis full-length cDNA	54	4e-04
160	emb|CR644937.2|CNS0EWLR Tetraodon nigroviridis full-length cDNA	54	4e-04
161	emb|CR644844.2|CNS0EWJ6 Tetraodon nigroviridis full-length cDNA	54	4e-04
162	emb|CR642799.2|CNS0EUYD Tetraodon nigroviridis full-length cDNA	54	4e-04
163	emb|CR642099.2|CNS0EUEX Tetraodon nigroviridis full-length cDNA	54	4e-04
164	emb|CR641153.2|CNS0ETON Tetraodon nigroviridis full-length cDNA	54	4e-04
165	emb|CR641040.2|CNS0ETLI Tetraodon nigroviridis full-length cDNA	54	4e-04
166	emb|CR640281.2|CNS0ET0F Tetraodon nigroviridis full-length cDNA	54	4e-04
167	emb|CR638365.2|CNS0ERJ7 Tetraodon nigroviridis full-length cDNA	54	4e-04
168	emb|CR638016.2|CNS0ER9I Tetraodon nigroviridis full-length cDNA	54	4e-04
169	emb|CR637867.2|CNS0ER5D Tetraodon nigroviridis full-length cDNA	54	4e-04
170	emb|CR634998.2|CNS0EOXO Tetraodon nigroviridis full-length cDNA	54	4e-04
171	emb|CR635636.2|CNS0EPFE Tetraodon nigroviridis full-length cDNA	54	4e-04
172	emb|CR634517.2|CNS0EOKB Tetraodon nigroviridis full-length cDNA	54	4e-04
173	emb|CR632705.2|CNS0EN5Z Tetraodon nigroviridis full-length cDNA	54	4e-04
174	emb|CR634207.2|CNS0EOBP Tetraodon nigroviridis full-length cDNA	54	4e-04
175	emb|CR633451.2|CNS0ENQP Tetraodon nigroviridis full-length cDNA	54	4e-04
176	emb|CR633449.2|CNS0ENQN Tetraodon nigroviridis full-length cDNA	54	4e-04
177	emb|CR633433.2|CNS0ENQ7 Tetraodon nigroviridis full-length cDNA	54	4e-04
178	emb|CR633152.2|CNS0ENIE Tetraodon nigroviridis full-length cDNA	54	4e-04
179	emb|CR632536.2|CNS0EN1A Tetraodon nigroviridis full-length cDNA	54	4e-04
180	emb|CR632500.2|CNS0EN0A Tetraodon nigroviridis full-length cDNA	54	4e-04
181	emb|CR631260.2|CNS0EM1T Tetraodon nigroviridis full-length cDNA	54	4e-04
182	emb|CR632409.2|CNS0EMXR Tetraodon nigroviridis full-length cDNA	54	4e-04
183	emb|CR632185.2|CNS0EMRJ Tetraodon nigroviridis full-length cDNA	54	4e-04
184	emb|CR632097.2|CNS0EMP3 Tetraodon nigroviridis full-length cDNA	54	4e-04
185	emb|CR631883.2|CNS0EMJ5 Tetraodon nigroviridis full-length cDNA	54	4e-04
186	emb|CR631475.2|CNS0EM7S Tetraodon nigroviridis full-length cDNA	54	4e-04
187	emb|CR631326.2|CNS0EM3N Tetraodon nigroviridis full-length cDNA	54	4e-04
188	emb|CR631540.2|CNS0EM9M Tetraodon nigroviridis full-length cDNA	54	4e-04
189	gb|AC163019.5| Mus musculus chromosome 19, clone RP24-290E5, com...	52	0.002
190	dbj|AK171767.1| Mus musculus activated spleen cDNA, RIKEN full-l...	52	0.002
191	gb|AC104201.12| Mus musculus chromosome 19, clone RP24-531I1, co...	52	0.002
192	ref|NM_126151.1| Arabidopsis thaliana structural constituent of ...	50	0.006
193	gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome ...	50	0.006
194	emb|AL845475.12| Mouse DNA sequence from clone RP23-403E20 on ch...	50	0.006
195	gb|AY081628.1| Arabidopsis thaliana 60S ribosomal protein L26 (A...	50	0.006
196	gb|AY065109.1| Arabidopsis thaliana 60S ribosomal protein L26 (A...	50	0.006
197	emb|BX824404.1|CNS0A5SJ Arabidopsis thaliana Full-length cDNA Co...	50	0.006
198	gb|AF401580.1| Ictalurus punctatus ribosomal protein L26 mRNA, c...	50	0.006
199	gb|AY086530.1| Arabidopsis thaliana clone 2561 mRNA, complete se...	50	0.006
200	dbj|AB013390.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	50	0.006
201	dbj|AK108325.1| Oryza sativa (japonica cultivar-group) cDNA clon...	50	0.006
202	gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, co...	48	0.024
203	ref|XM_653082.1| Aspergillus nidulans FGSC A4 hypothetical prote...	48	0.024
204	ref|XM_391021.1| Gibberella zeae PH-1 chromosome 3 conserved hyp...	48	0.024
205	gb|AC151267.3| Mus musculus BAC clone RP24-296E22 from chromosom...	48	0.024
206	emb|AL603662.11| Mouse DNA sequence from clone RP23-396M19 on ch...	48	0.024
207	ref|NM_213113.1| Danio rerio ribosomal protein L26 (rpl26), mRNA	48	0.024
208	dbj|AB093679.1| Macaca fascicularis RPL26 mRNA for ribosomal pro...	48	0.024
209	gb|BC055538.1| Danio rerio ribosomal protein L26, mRNA (cDNA clo...	48	0.024
210	gb|CP000089.1| Dechloromonas aromatica RCB, complete genome	46	0.093
211	emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on ch...	46	0.093
212	gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome...	44	0.37
213	gb|AC123067.4| Mus musculus BAC clone RP23-20M6 from chromosome ...	44	0.37
214	ref|XM_984209.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.37
215	ref|XM_138109.3| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.37
216	ref|XM_915843.2| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.37
217	ref|XR_003659.1| PREDICTED: Mus musculus similar to 60S ribosoma...	44	0.37
218	ref|XM_785606.1| PREDICTED: Strongylocentrotus purpuratus simila...	44	0.37
219	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	44	0.37
220	dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co...	44	0.37
221	gb|AF159097.1|AF159097 Rattus norvegicus SVS-protein F mRNA, par...	44	0.37
222	gb|AC173346.1| Mus musculus BAC clone RP23-42N8 from chromosome ...	44	0.37
223	ref|NM_000987.3| Homo sapiens ribosomal protein L26 (RPL26), mRNA	42	1.5
224	ref|XM_511853.1| PREDICTED: Pan troglodytes similar to 60S ribos...	42	1.5
225	ref|XM_509238.1| PREDICTED: Pan troglodytes similar to 60S ribos...	42	1.5
226	gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, co...	42	1.5
227	gb|AC165380.3| Colobus guereza clone CH272-85C5, complete sequence	42	1.5
228	gb|AC145494.3| Gorilla gorilla gorilla clone CH255-100P16, compl...	42	1.5
229	gb|AC087214.4| Papio anubis clone RP41-150K7, complete sequence	42	1.5
230	ref|NM_001015512.2| Bos taurus ribosomal protein L26 (RPL26), mRNA	42	1.5
231	gb|BC066316.1| Homo sapiens cDNA clone MGC:87181 IMAGE:5277258, ...	42	1.5
232	ref|XM_990754.1| PREDICTED: Mus musculus similar to 60S ribosoma...	42	1.5
233	ref|XM_912297.2| PREDICTED: Mus musculus similar to 60S ribosoma...	42	1.5
234	ref|XM_484573.4| PREDICTED: Mus musculus similar to 60S ribosoma...	42	1.5
235	gb|AC002543.1| Homo sapiens BAC clone CTA-300C3 from 7, complete...	42	1.5
236	gb|AC145398.2| Rattus norvegicus chromosome 1 clone RP32-604H24 ...	42	1.5
237	ref|XR_002078.1| PREDICTED: Mus musculus similar to 60S ribosoma...	42	1.5
238	ref|XR_002265.1| PREDICTED: Mus musculus similar to 60S ribosoma...	42	1.5
239	gb|BC021073.1| Homo sapiens cDNA clone IMAGE:3010311, **** WARNI...	42	1.5
240	emb|AL121871.8|HSB258O15 Human DNA sequence from clone RP13-258O...	42	1.5
241	emb|X15351.1|MMMCEA1 Mouse mRNA fragment for carcinoembryonic an...	42	1.5
242	ref|XM_967673.1| PREDICTED: Tribolium castaneum similar to CG648...	42	1.5
243	emb|X67279.1|MMBGPD M.musculus Bgpd mRNA for biliary glycoprotein	42	1.5
244	emb|X67278.1|MMBGPC M.musculus Bgpc mRNA for biliary glycoprotein	42	1.5
245	emb|X69392.1|HSRP26AA H.sapiens mRNA for ribosomal protein L26	42	1.5
246	emb|CR625206.1| full-length cDNA clone CS0DI020YA05 of Placenta ...	42	1.5
247	emb|CR614577.1| full-length cDNA clone CS0DC027YL23 of Neuroblas...	42	1.5
248	emb|CR598792.1| full-length cDNA clone CS0DK001YN13 of HeLa cell...	42	1.5
249	gb|BC102057.1| Bos taurus ribosomal protein L26, mRNA (cDNA clon...	42	1.5
250	gb|CP000249.1| Frankia sp. CcI3, complete genome	42	1.5
251	emb|CR456828.1| Homo sapiens full open reading frame cDNA clone ...	42	1.5
252	gb|DP000005.1| Macaca mulatta target 1 genomic scaffold	42	1.5
253	gb|DP000025.1| Gorilla gorilla gorilla target 1 genomic scaffold	42	1.5
254	gb|DP000029.1| Cercopithecus aethiops target 1 genomic scaffold	42	1.5
255	gb|AC017078.8| Homo sapiens BAC clone RP11-457N9 from 2, complet...	42	1.5
256	gb|AC130184.4| Macaca mulatta clone CH250-513J21, complete sequence	42	1.5
257	gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome	42	1.5
258	gb|AC079044.21| Mus musculus strain C57BL/6J chromosome 16 clone...	42	1.5
259	gb|AY911370.1| Bos taurus clone IMAGE:7961509 ribosomal protein ...	42	1.5
260	dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome	42	1.5
261	dbj|AB098945.1| Bos taurus mRNA for similar to ribosomal protein...	42	1.5
262	dbj|AB098829.1| Bos taurus mRNA for similar to ribosomal protein...	42	1.5
263	gb|BC071664.1| Homo sapiens ribosomal protein L26, mRNA (cDNA cl...	42	1.5
264	gb|AC087802.13| Mus musculus strain C57BL/6J chromosome 16 clone...	42	1.5
265	gb|AC138724.3| Cercopithecus aethiops clone CH252-200P12, comple...	42	1.5
266	emb|X67282.1|MMBGPG M.musculus Bgpg mRNA for biliary glycoprotein	42	1.5
267	gb|L07287.1|HUMRPL26X Human ribosomal protein L26 (RPL26) gene e...	42	1.5
268	emb|AL606904.12| Mouse DNA sequence from clone RP23-182D20 on ch...	42	1.5
269	emb|AL731790.10| Mouse DNA sequence from clone RP23-104P2 on chr...	42	1.5
270	ref|NM_114851.1| Arabidopsis thaliana structural constituent of ...	40	5.7
271	gb|AC105981.10| Mus musculus chromosome 8, clone RP24-210I22, co...	40	5.7
272	gb|CP000110.1| Synechococcus sp. CC9605, complete genome	40	5.7
273	ref|NM_195202.1| Oryza sativa (japonica cultivar-group) hypothet...	40	5.7
274	gb|AC132491.2| Oryza sativa (japonica cultivar-group) chromosome...	40	5.7
275	gb|AC024776.1| Caenorhabditis elegans cosmid Y41D4B, complete se...	40	5.7
276	gb|AC130611.2| Oryza sativa (japonica cultivar-group) chromosome...	40	5.7
277	gb|BC075124.1| Xenopus laevis cDNA clone MGC:81816 IMAGE:7007960...	40	5.7
278	gb|DQ178997.1| Streptomyces clavuligerus glyceraldehyde-3-phosph...	40	5.7
279	gb|AC004540.1| Homo sapiens PAC clone RP5-1066K24 from 7, comple...	40	5.7
280	emb|CT009510.7| Mouse DNA sequence from clone RP23-47H16 on chro...	40	5.7
281	emb|AL162378.16| Human DNA sequence from clone RP11-394C23 on ch...	40	5.7
282	emb|AL591790.1|SME591790 Sinorhizobium meliloti 1021 complete ch...	40	5.7
283	gb|AC102819.5| Mus musculus chromosome 8, clone RP23-117H21, com...	40	5.7
284	emb|CR721026.2|CNS0GJAG Tetraodon nigroviridis full-length cDNA	40	5.7
285	emb|CR710677.2|CNS0GBB5 Tetraodon nigroviridis full-length cDNA	40	5.7
286	emb|CR702268.2|CNS0G4TK Tetraodon nigroviridis full-length cDNA	40	5.7
287	emb|CR694449.2|CNS0FYSD Tetraodon nigroviridis full-length cDNA	40	5.7
288	emb|CR671662.2|CNS0FH84 Tetraodon nigroviridis full-length cDNA	40	5.7
289	emb|CR666176.2|CNS0FCZQ Tetraodon nigroviridis full-length cDNA	40	5.7
290	emb|CR643187.2|CNS0EV95 Tetraodon nigroviridis full-length cDNA	40	5.7
291	emb|CR642626.2|CNS0EUTK Tetraodon nigroviridis full-length cDNA	40	5.7
292	emb|CR640237.2|CNS0ESZ7 Tetraodon nigroviridis full-length cDNA	40	5.7
293	gb|AC146142.1| Pan troglodytes BAC clone RP43-23M11 from 7, comp...	40	5.7
294	gb|AC116842.6| Mus musculus, clone RP24-390P7, complete sequence	40	5.7
295	emb|AL353685.23| Human DNA sequence from clone RP11-31J20 on chr...	40	5.7
296	gb|BT000681.1| Arabidopsis thaliana clone RAFL04-10-H14 (R09662)...	40	5.7
297	emb|X94149.1|CRATPAMI C.reinhardtii mRNA for mitochondrial ATP s...	40	5.7
298	gb|AY059101.1| Arabidopsis thaliana putative 60S ribosomal prote...	40	5.7
299	gb|AF370158.1| Arabidopsis thaliana putative 60S ribosomal prote...	40	5.7
300	emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segmen...	40	5.7
301	gb|AC154318.3| Mus musculus BAC clone RP23-316D19 from chromosom...	40	5.7
302	emb|AL645802.11| Mouse DNA sequence from clone RP23-128D9 on chr...	40	5.7
303	emb|AL662903.10| Mouse DNA sequence from clone RP23-419P16 on ch...	40	5.7
304	emb|AL132965.1|ATT16K5 Arabidopsis thaliana DNA chromosome 3, BA...	40	5.7
305	emb|AL132978.1|ATF3A4 Arabidopsis thaliana DNA chromosome 3, BAC...	40	5.7
306	gb|AC027575.13| Homo sapiens chromosome 18, clone RP11-162A12, c...	40	5.7
307	gb|AC122146.1| Oryza sativa (japonica cultivar-group) chromosome...	40	5.7
308	dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ...	40	5.7
309	gb|AC093568.2| Oryza sativa chromosome 10 clone OSJNBa0029P16, c...	40	5.7
310	ref|NM_067712.3| Caenorhabditis elegans Y41D4B.6 (Y41D4B.6) mRNA...	40	5.7
311	gb|AF287262.1|AF287262 Homo sapiens ATP-binding cassette 1 sub-f...	40	5.7
312	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.7
313	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.7
314	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.7
315	emb|BX822500.1|CNS0A66A Arabidopsis thaliana Full-length cDNA Co...	40	5.7
316	emb|BX824403.1|CNS0A5SI Arabidopsis thaliana Full-length cDNA Co...	40	5.7
317	emb|BX822573.1|CNS0A5WS Arabidopsis thaliana Full-length cDNA Co...	40	5.7
318	gb|AC154337.2| Mus musculus BAC clone RP23-254P20 from chromosom...	40	5.7
319	dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromo...	40	5.7
320	gb|AF275948.1|AF275948 Homo sapiens ABCA1 (ABCA1) gene, complete...	40	5.7
321	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	5.7
322	dbj|AP005460.3| Oryza sativa (japonica cultivar-group) genomic D...	40	5.7
323	gb|AC151283.2| Mus musculus BAC clone RP23-463A14 from 17, compl...	40	5.7
324	gb|AC154783.2| Mus musculus BAC clone RP24-466C8 from 12, comple...	40	5.7
325	emb|AL357614.5|HS367B10 Homo sapiens chromosome 9 BAC RP11-367B1...	40	5.7
326	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	40	5.7
327	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	40	5.7
328	emb|AL357615.7|HS373D10 Homo sapiens chromosome 9 BAC RP11-373D1...	40	5.7
329	gb|AC140305.3| Mus musculus BAC clone RP23-425A11 from 6, comple...	40	5.7
330	emb|AL732552.8| Mouse DNA sequence from clone RP23-145O14 on chr...	40	5.7

---

>gb|BT009046.1| Triticum aestivum clone wdk9n.pk001.j17:fis, full insert mRNA
            sequence
          Length = 1682

 Score =  527 bits (266), Expect = e-147
 Identities = 396/435 (91%), Gaps = 17/435 (3%)
 Strand = Plus / Minus

                                                                        
Query: 4    taaacatgtaatgaagtcttcatatcaaaatccagggcacaggcacatgatagatgcaca 63
            ||||||| |||||||||||||||||||||||||| ||||||| | ||| | |||||||||
Sbjct: 1657 taaacatataatgaagtcttcatatcaaaatccaaggcacagacccataa-agatgcaca 1599

                                                                        
Query: 64   ttaaaggttccaaaacgctcatccacggacatcttacgaataataaagcagcagttttca 123
            |||||||||  |||||||||||||||| ||||| |||||||||||||||||   | ||||
Sbjct: 1598 ttaaaggtttgaaaacgctcatccacg-acatcatacgaataataaagcag---tcttca 1543

                                                                        
Query: 124  gatagcatatcctaacagaacaggtgattggtaa-aaaactaggatagcaagagcagtat 182
            ||||||||||||||||||||| |||||| ||||| |||||||||||| ||||||||||||
Sbjct: 1542 gatagcatatcctaacagaactggtgat-ggtaataaaactaggatatcaagagcagtat 1484

                                                                        
Query: 183  ggcaaccg----------agcttaatcaatctcctggagcgaggcgccggtggccgtggc 232
            ||||||||          ||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 1483 ggcaaccggcagatcccaagcttaatcgatctcctggagcgaggcaccggtggccgtggc 1424

                                                                        
Query: 233  gccaccagctgcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagc 292
            ||| ||||| ||||||||||||||||| || |||||||| ||||||||||||||||||||
Sbjct: 1423 gcccccagcggcggcggcgacgtcctccgccgtgaactttcccttggccttgtcagcagc 1364

                                                                        
Query: 293  gcggccacgagccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggt 352
            |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1363 gcggccgcgagccttgcggtcgaggagggccttgcggtccttgtcgagcttgagcttggt 1304

                                                                        
Query: 353  gacgatcaccttgctggggtggatgccgacgttgaccgtggatccattcaccttctccct 412
            ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||
Sbjct: 1303 gacgatcaccttgctggggtggatgccgacgttcaccgtggatccattgaccttctccct 1244

                           
Query: 413  ggtgatccgctccac 427
            |||||||||||||||
Sbjct: 1243 ggtgatccgctccac 1229

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  293 bits (148), Expect = 2e-76
 Identities = 214/236 (90%)
 Strand = Plus / Minus

                                                                           
Query: 189     cgagcttaatcaatctcctggagcgaggcgccggtggccgtggcgccaccagctgcggcg 248
               ||||| ||||| |||||||||||||||||||||||||| | ||| || || || ||||||
Sbjct: 2137336 cgagcctaatcgatctcctggagcgaggcgccggtggcggcggcacccccggcggcggcg 2137277

                                                                           
Query: 249     gcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacgagccttg 308
               |||||||| ||||||||||||||||||||||||||||| || |||||||| || ||||||
Sbjct: 2137276 gcgacgtcgtcggcggtgaacttgcccttggccttgtcggcggcgcggccgcgcgccttg 2137217

                                                                           
Query: 309     cggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctg 368
               |||||||||| |||||||||||||||||| |||||||||||||||||||  ||||||  |
Sbjct: 2137216 cggtcgaggatggccttgcggtccttgtcgagcttgagcttggtgacgacgaccttggag 2137157

                                                                       
Query: 369     gggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgctc 424
               |||||||||||||||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 2137156 gggtggatgccgacgttgacggtggagccgttcaccttctccctggtgatccgctc 2137101

---

>dbj|AP002913.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0480E02
          Length = 141862

 Score =  293 bits (148), Expect = 2e-76
 Identities = 214/236 (90%)
 Strand = Plus / Minus

                                                                         
Query: 189   cgagcttaatcaatctcctggagcgaggcgccggtggccgtggcgccaccagctgcggcg 248
             ||||| ||||| |||||||||||||||||||||||||| | ||| || || || ||||||
Sbjct: 58448 cgagcctaatcgatctcctggagcgaggcgccggtggcggcggcacccccggcggcggcg 58389

                                                                         
Query: 249   gcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacgagccttg 308
             |||||||| ||||||||||||||||||||||||||||| || |||||||| || ||||||
Sbjct: 58388 gcgacgtcgtcggcggtgaacttgcccttggccttgtcggcggcgcggccgcgcgccttg 58329

                                                                         
Query: 309   cggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctg 368
             |||||||||| |||||||||||||||||| |||||||||||||||||||  ||||||  |
Sbjct: 58328 cggtcgaggatggccttgcggtccttgtcgagcttgagcttggtgacgacgaccttggag 58269

                                                                     
Query: 369   gggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgctc 424
             |||||||||||||||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 58268 gggtggatgccgacgttgacggtggagccgttcaccttctccctggtgatccgctc 58213

---

>ref|NM_184296.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 474

 Score =  289 bits (146), Expect = 4e-75
 Identities = 209/230 (90%)
 Strand = Plus / Minus

                                                                       
Query: 195 taatcaatctcctggagcgaggcgccggtggccgtggcgccaccagctgcggcggcgacg 254
           ||||| |||||||||||||||||||||||||| | ||| || || || ||||||||||||
Sbjct: 473 taatcgatctcctggagcgaggcgccggtggcggcggcacccccggcggcggcggcgacg 414

                                                                       
Query: 255 tcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacgagccttgcggtcg 314
           || ||||||||||||||||||||||||||||| || |||||||| || ||||||||||||
Sbjct: 413 tcgtcggcggtgaacttgcccttggccttgtcggcggcgcggccgcgcgccttgcggtcg 354

                                                                       
Query: 315 aggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtgg 374
           |||| |||||||||||||||||| |||||||||||||||||||  ||||||  |||||||
Sbjct: 353 aggatggccttgcggtccttgtcgagcttgagcttggtgacgacgaccttggaggggtgg 294

                                                             
Query: 375 atgccgacgttgaccgtggatccattcaccttctccctggtgatccgctc 424
           |||||||||||||| ||||| || ||||||||||||||||||||||||||
Sbjct: 293 atgccgacgttgacggtggagccgttcaccttctccctggtgatccgctc 244

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score =  226 bits (114), Expect = 5e-56
 Identities = 165/182 (90%)
 Strand = Plus / Plus

                                                                           
Query: 243     gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
               |||||||| ||||||||||||||||||||||||||||||||||| || |||||||| |  
Sbjct: 2459882 gcggcggccacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcggccgctc 2459941

                                                                           
Query: 303     gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
               |||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 2459942 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagcttggtgacgaccacc 2460001

                                                                           
Query: 363     ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
               |||  ||||||||| ||||||||||| ||||| || |||||||||||||| ||||| |||
Sbjct: 2460002 ttggaggggtggatcccgacgttgacggtggacccgttcaccttctccctcgtgatgcgc 2460061

                 
Query: 423     tc 424
               ||
Sbjct: 2460062 tc 2460063



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 195     taatcaatctcctggagcgaggcgccgg 222
               ||||| ||||||||||||||||||||||
Sbjct: 2459855 taatcgatctcctggagcgaggcgccgg 2459882

---

>dbj|AK105075.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-F01, full
           insert sequence
          Length = 672

 Score =  226 bits (114), Expect = 5e-56
 Identities = 165/182 (90%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
           |||||||| ||||||||||||||||||||||||||||||||||| || |||||||| |  
Sbjct: 478 gcggcggccacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcggccgctc 419

                                                                       
Query: 303 gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
           |||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 418 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagcttggtgacgaccacc 359

                                                                       
Query: 363 ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
           |||  ||||||||| ||||||||||| ||||| || |||||||||||||| ||||| |||
Sbjct: 358 ttggaggggtggatcccgacgttgacggtggacccgttcaccttctccctcgtgatgcgc 299

             
Query: 423 tc 424
           ||
Sbjct: 298 tc 297



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 195 taatcaatctcctggagcgaggcgccgg 222
           ||||| ||||||||||||||||||||||
Sbjct: 505 taatcgatctcctggagcgaggcgccgg 478

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  226 bits (114), Expect = 5e-56
 Identities = 165/182 (90%)
 Strand = Plus / Plus

                                                                           
Query: 243     gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
               |||||||| ||||||||||||||||||||||||||||||||||| || |||||||| |  
Sbjct: 2459826 gcggcggccacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcggccgctc 2459885

                                                                           
Query: 303     gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
               |||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 2459886 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagcttggtgacgaccacc 2459945

                                                                           
Query: 363     ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
               |||  ||||||||| ||||||||||| ||||| || |||||||||||||| ||||| |||
Sbjct: 2459946 ttggaggggtggatcccgacgttgacggtggacccgttcaccttctccctcgtgatgcgc 2460005

                 
Query: 423     tc 424
               ||
Sbjct: 2460006 tc 2460007



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 195     taatcaatctcctggagcgaggcgccgg 222
               ||||| ||||||||||||||||||||||
Sbjct: 2459799 taatcgatctcctggagcgaggcgccgg 2459826

---

>emb|AL928755.5|CNS08CBS Oryza sativa chromosome 12, . BAC OSJNBb0050K10 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 122901

 Score =  226 bits (114), Expect = 5e-56
 Identities = 165/182 (90%)
 Strand = Plus / Minus

                                                                         
Query: 243   gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
             |||||||| ||||||||||||||||||||||||||||||||||| || |||||||| |  
Sbjct: 83610 gcggcggccacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcggccgctc 83551

                                                                         
Query: 303   gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
             |||||||||||||||| |||||||||||||||||| ||||||||||||||||||| ||||
Sbjct: 83550 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagcttggtgacgaccacc 83491

                                                                         
Query: 363   ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
             |||  ||||||||| ||||||||||| ||||| || |||||||||||||| ||||| |||
Sbjct: 83490 ttggaggggtggatcccgacgttgacggtggacccgttcaccttctccctcgtgatgcgc 83431

               
Query: 423   tc 424
             ||
Sbjct: 83430 tc 83429



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 195   taatcaatctcctggagcgaggcgccgg 222
             ||||| ||||||||||||||||||||||
Sbjct: 83637 taatcgatctcctggagcgaggcgccgg 83610

---

>gb|BT017384.1| Zea mays clone EL01N0326F04.c mRNA sequence
          Length = 706

 Score =  212 bits (107), Expect = 7e-52
 Identities = 198/227 (87%), Gaps = 6/227 (2%)
 Strand = Plus / Minus

                                                                       
Query: 201 atctcctggagcgaggcgccggtggccgtggcgccaccagctgcggcggc---gacgtcc 257
           ||||||||||| ||||||||||||||   |||||||||||| ||||||||   |||||| 
Sbjct: 456 atctcctggagagaggcgccggtggc---ggcgccaccagcggcggcggcagcgacgtca 400

                                                                       
Query: 258 tcggcggtgaacttgcccttggccttgtcagcagcgcggccacgagccttgcggtcgagg 317
           ||||| || ||||||||||| |||||||| || |||||||| || |||||||||||||||
Sbjct: 399 tcggcagtaaacttgcccttagccttgtcggcggcgcggccccgggccttgcggtcgagg 340

                                                                       
Query: 318 agggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatg 377
           || ||||| ||||||||||| ||||| |||||||||||||||||||||  ||||||||||
Sbjct: 339 agcgccttacggtccttgtcgagcttcagcttggtgacgatcaccttggaggggtggatg 280

                                                          
Query: 378 ccgacgttgaccgtggatccattcaccttctccctggtgatccgctc 424
           || ||||| || ||||| || ||||||||||| | ||||||||||||
Sbjct: 279 cccacgttcacggtggagccgttcaccttctcgcgggtgatccgctc 233

---

>gb|AY103965.1| Zea mays PCO145463 mRNA sequence
          Length = 826

 Score =  206 bits (104), Expect = 4e-50
 Identities = 194/224 (86%)
 Strand = Plus / Minus

                                                                       
Query: 201 atctcctggagcgaggcgccggtggccgtggcgccaccagctgcggcggcgacgtcctcg 260
           ||||||||||| || ||||||||||| | |||||||||||| |||||||||||||| |||
Sbjct: 552 atctcctggagagacgcgccggtggcggcggcgccaccagcagcggcggcgacgtcgtcg 493

                                                                       
Query: 261 gcggtgaacttgcccttggccttgtcagcagcgcggccacgagccttgcggtcgaggagg 320
           || || ||||||||||| |||||||| || |||||||| || ||||||||||||||||| 
Sbjct: 492 gcagtaaacttgcccttagccttgtcggcggcgcggccccgggccttgcggtcgaggagc 433

                                                                       
Query: 321 gccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccg 380
           ||||||||||||||||| ||||| ||||| || || || ||||||   ||||||||||| 
Sbjct: 432 gccttgcggtccttgtcaagcttcagctttgtaaccatgaccttggaagggtggatgccc 373

                                                       
Query: 381 acgttgaccgtggatccattcaccttctccctggtgatccgctc 424
           ||||| || ||||| || ||||||||||| | ||||||||||||
Sbjct: 372 acgttcacggtggagccgttcaccttctcgcgggtgatccgctc 329

---

>gb|AC120307.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0074E19
              map R1938, complete sequence
          Length = 160847

 Score =  202 bits (102), Expect = 7e-49
 Identities = 162/182 (89%)
 Strand = Plus / Plus

                                                                          
Query: 243    gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
              |||||||| ||||||||||||||||||||||||||||||||||| || ||||| || |  
Sbjct: 141529 gcggcggcaacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcgaccgctg 141588

                                                                          
Query: 303    gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
              |||||||||||||||| |||||||||||||||||| |||||||| ||||||||||  |||
Sbjct: 141589 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagtttggtgacgacgacc 141648

                                                                          
Query: 363    ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
              |||   |||||||| ||||||||||| ||||| || |||||||||||||||||||| |||
Sbjct: 141649 ttggatgggtggatcccgacgttgacggtggacccgttcaccttctccctggtgatgcgc 141708

                
Query: 423    tc 424
              ||
Sbjct: 141709 tc 141710



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 188    ccgagcttaatcaatctcctggagcgaggcgccgg 222
              |||||| ||||| ||||||||||||||||| ||||
Sbjct: 141486 ccgagcctaatcgatctcctggagcgaggccccgg 141520

---

>gb|AC116949.11| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0040B10 map R2918, complete sequence
          Length = 149132

 Score =  202 bits (102), Expect = 7e-49
 Identities = 162/182 (89%)
 Strand = Plus / Plus

                                                                         
Query: 243   gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
             |||||||| ||||||||||||||||||||||||||||||||||| || ||||| || |  
Sbjct: 17672 gcggcggcaacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcgaccgctg 17731

                                                                         
Query: 303   gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
             |||||||||||||||| |||||||||||||||||| |||||||| ||||||||||  |||
Sbjct: 17732 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagtttggtgacgacgacc 17791

                                                                         
Query: 363   ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
             |||   |||||||| ||||||||||| ||||| || |||||||||||||||||||| |||
Sbjct: 17792 ttggatgggtggatcccgacgttgacggtggacccgttcaccttctccctggtgatgcgc 17851

               
Query: 423   tc 424
             ||
Sbjct: 17852 tc 17853



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 188   ccgagcttaatcaatctcctggagcgaggcgccgg 222
             |||||| ||||| ||||||||||||||||| ||||
Sbjct: 17629 ccgagcctaatcgatctcctggagcgaggccccgg 17663

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  202 bits (102), Expect = 7e-49
 Identities = 162/182 (89%)
 Strand = Plus / Plus

                                                                           
Query: 243     gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
               |||||||| ||||||||||||||||||||||||||||||||||| || ||||| || |  
Sbjct: 2365530 gcggcggcaacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcgaccgctg 2365589

                                                                           
Query: 303     gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
               |||||||||||||||| |||||||||||||||||| |||||||| ||||||||||  |||
Sbjct: 2365590 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagtttggtgacgacgacc 2365649

                                                                           
Query: 363     ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
               |||   |||||||| ||||||||||| ||||| || |||||||||||||||||||| |||
Sbjct: 2365650 ttggatgggtggatcccgacgttgacggtggacccgttcaccttctccctggtgatgcgc 2365709

                 
Query: 423     tc 424
               ||
Sbjct: 2365710 tc 2365711



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 188     ccgagcttaatcaatctcctggagcgaggcgccgg 222
               |||||| ||||| ||||||||||||||||| ||||
Sbjct: 2365487 ccgagcctaatcgatctcctggagcgaggccccgg 2365521

---

>dbj|AK121546.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033032E14, full
           insert sequence
          Length = 788

 Score =  202 bits (102), Expect = 7e-49
 Identities = 162/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 243 gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
           |||||||| ||||||||||||||||||||||||||||||||||| || ||||| || |  
Sbjct: 485 gcggcggcaacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcgaccgctg 426

                                                                       
Query: 303 gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
           |||||||||||||||| |||||||||||||||||| |||||||| ||||||||||  |||
Sbjct: 425 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagtttggtgacgacgacc 366

                                                                       
Query: 363 ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
           |||   |||||||| ||||||||||| ||||| || |||||||||||||||||||| |||
Sbjct: 365 ttggatgggtggatcccgacgttgacggtggacccgttcaccttctccctggtgatgcgc 306

             
Query: 423 tc 424
           ||
Sbjct: 305 tc 304



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 188 ccgagcttaatcaatctcctggagcgaggcgccgg 222
           |||||| ||||| ||||||||||||||||| ||||
Sbjct: 528 ccgagcctaatcgatctcctggagcgaggccccgg 494

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  202 bits (102), Expect = 7e-49
 Identities = 162/182 (89%)
 Strand = Plus / Plus

                                                                           
Query: 243     gcggcggcgacgtcctcggcggtgaacttgcccttggccttgtcagcagcgcggccacga 302
               |||||||| ||||||||||||||||||||||||||||||||||| || ||||| || |  
Sbjct: 2373311 gcggcggcaacgtcctcggcggtgaacttgcccttggccttgtcggcggcgcgaccgctg 2373370

                                                                           
Query: 303     gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
               |||||||||||||||| |||||||||||||||||| |||||||| ||||||||||  |||
Sbjct: 2373371 gccttgcggtcgaggatggccttgcggtccttgtcgagcttgagtttggtgacgacgacc 2373430

                                                                           
Query: 363     ttgctggggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgc 422
               |||   |||||||| ||||||||||| ||||| || |||||||||||||||||||| |||
Sbjct: 2373431 ttggatgggtggatcccgacgttgacggtggacccgttcaccttctccctggtgatgcgc 2373490

                 
Query: 423     tc 424
               ||
Sbjct: 2373491 tc 2373492



 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 188     ccgagcttaatcaatctcctggagcgaggcgccgg 222
               |||||| ||||| ||||||||||||||||| ||||
Sbjct: 2373268 ccgagcctaatcgatctcctggagcgaggccccgg 2373302

---

>gb|AF093540.1|AF093540 Zea mays ribosomal protein L26 mRNA, partial cds
          Length = 417

 Score =  125 bits (63), Expect = 1e-25
 Identities = 102/115 (88%)
 Strand = Plus / Minus

                                                                       
Query: 310 ggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctgg 369
           |||||||||| ||||| ||||||||||| ||||| |||||||||||||||||||||  ||
Sbjct: 412 ggtcgaggagcgccttacggtccttgtcgagcttcagcttggtgacgatcaccttggagg 353

                                                                  
Query: 370 ggtggatgccgacgttgaccgtggatccattcaccttctccctggtgatccgctc 424
           |||||||||| ||||| || ||||| || ||||||||||| | ||||||||||||
Sbjct: 352 ggtggatgcccacgttcacggtggagccgttcaccttctcgcgggtgatccgctc 298

---

>gb|DQ214871.1| Taeniopygia guttata clone 0058P0019E02 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 640

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 377 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 318

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 317 gtgcaccgtgg 307

---

>gb|DQ214869.1| Taeniopygia guttata clone 0061P0024E01 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 512

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 365 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 306

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 305 gtgcaccgtgg 295

---

>gb|DQ214868.1| Taeniopygia guttata clone 0058P0030E07 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 534

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 329

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 328 gtgcaccgtgg 318

---

>gb|DQ214867.1| Taeniopygia guttata clone 0058P0003F10 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 512

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 368 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 309

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 308 gtgcaccgtgg 298

---

>gb|DQ214865.1| Taeniopygia guttata clone 0061P0014H12 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 534

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 329

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 328 gtgcaccgtgg 318

---

>gb|DQ214864.1| Taeniopygia guttata clone 0064P0017H07 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 532

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 329

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 328 gtgcaccgtgg 318

---

>gb|DQ214863.1| Taeniopygia guttata clone 0061P0022H04 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 529

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 383 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 324

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 323 gtgcaccgtgg 313

---

>gb|DQ214862.1| Taeniopygia guttata clone 0063P0003B08 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 532

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 329

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 328 gtgcaccgtgg 318

---

>gb|DQ214860.1| Taeniopygia guttata clone 0064P0011G04 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 515

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 368 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 309

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 308 gtgcaccgtgg 298

---

>gb|DQ214859.1| Taeniopygia guttata clone 0061P0025F11 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 535

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 329

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 328 gtgcaccgtgg 318

---

>gb|DQ214857.1| Taeniopygia guttata clone 0061P0006E10 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 535

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 329

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 328 gtgcaccgtgg 318

---

>gb|DQ214872.1| Taeniopygia guttata clone 0061P0018B10 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 528

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 329

             
Query: 383 gt 384
           ||
Sbjct: 328 gt 327

---

>gb|DQ214870.1| Taeniopygia guttata clone 0058P0008D12 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 524

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 377 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 318

             
Query: 383 gt 384
           ||
Sbjct: 317 gt 316

---

>gb|DQ214866.1| Taeniopygia guttata clone 0058P0040F11 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 457

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 310 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 251

             
Query: 383 gt 384
           ||
Sbjct: 250 gt 249

---

>gb|DQ214861.1| Taeniopygia guttata clone 0061P0022G09 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 549

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 389 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 330

             
Query: 383 gt 384
           ||
Sbjct: 329 gt 328

---

>gb|DQ214858.1| Taeniopygia guttata clone 0058P0046C11 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 524

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 377 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 318

             
Query: 383 gt 384
           ||
Sbjct: 317 gt 316

---

>gb|DQ214856.1| Taeniopygia guttata clone 0058P0048B02 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 524

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 377 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 318

             
Query: 383 gt 384
           ||
Sbjct: 317 gt 316

---

>gb|DQ214855.1| Taeniopygia guttata clone 0058P0014D08 ribosomal protein L26 variant
            1-like mRNA, complete sequence
          Length = 1339

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                        
Query: 323  cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
            ||||||||||||||||||||| ||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 1194 cttgcggtccttgtccagctttagcctggtgatcaccaccttgctggggtggatgcccac 1135

              
Query: 383  gt 384
            ||
Sbjct: 1134 gt 1133

---

>gb|AC109196.12| Mus musculus chromosome 5, clone RP23-313F5, complete sequence
          Length = 205369

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                       
Query: 323    cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
              ||||||||||||||||||||| ||| ||||||  | |||||||||||||||||||||
Sbjct: 144115 cttgcggtccttgtccagctttagcctggtgataaccaccttgctggggtggatgcc 144059

---

>ref|XM_213346.3| PREDICTED: Rattus norvegicus ribosomal protein L26 (predicted)
           (Rpl26_predicted), mRNA
          Length = 672

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  | |||||||||||||||||||||
Sbjct: 543 cttgcggtccttgtccagctttagcctggtgataaccaccttgctggggtggatgcc 487

---

>ref|XM_215658.3| PREDICTED: Rattus norvegicus protein tyrosine phosphatase,
            non-receptor type 8 (predicted) (Ptpn8_predicted), mRNA
          Length = 2872

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                     
Query: 323  cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
            ||||||||||||||||||||| ||| ||||||  | |||||||||||||||||||||
Sbjct: 2758 cttgcggtccttgtccagctttagcctggtgataaccaccttgctggggtggatgcc 2702

---

>ref|XM_574290.1| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L26
           (LOC498998), mRNA
          Length = 575

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  | |||||||||||||||||||||
Sbjct: 377 cttgcggtccttgtccagctttagcctggtgataaccaccttgctggggtggatgcc 321

---

>ref|NM_009080.1| Mus musculus ribosomal protein L26 (Rpl26), mRNA
          Length = 545

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 395 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 336

             
Query: 383 gt 384
           ||
Sbjct: 335 gt 334

---

>gb|AC026478.5| Mus musculus strain C57BL6/J chromosome 5 clone RP23-135F23, complete
              sequence
          Length = 188103

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                          
Query: 323    cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
              ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 121211 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 121270

                
Query: 383    gt 384
              ||
Sbjct: 121271 gt 121272

---

>ref|XM_990793.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC433010),
           mRNA
          Length = 544

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 405 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 346

             
Query: 383 gt 384
           ||
Sbjct: 345 gt 344

---

>ref|XR_005009.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC677088),
           mRNA
          Length = 507

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 381 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 322

             
Query: 383 gt 384
           ||
Sbjct: 321 gt 320

---

>ref|XR_001911.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC666717),
           mRNA
          Length = 507

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 381 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 322

             
Query: 383 gt 384
           ||
Sbjct: 321 gt 320

---

>dbj|AK146116.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730004G08 product:ribosomal protein L26, full
           insert sequence
          Length = 521

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 388 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 329

             
Query: 383 gt 384
           ||
Sbjct: 328 gt 327

---

>gb|AC154807.2| Mus musculus BAC clone RP23-79E7 from chromosome 16, complete sequence
          Length = 256130

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                          
Query: 323    cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
              ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 191399 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 191458

                
Query: 383    gt 384
              ||
Sbjct: 191459 gt 191460

---

>emb|AL935312.10| Mouse DNA sequence from clone RP23-56A7 on chromosome 2, complete
             sequence
          Length = 124236

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                         
Query: 323   cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
             ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 95987 cttgcggtccttgtccagctttagcctggtgataacaaccttgctggggtggatgcccac 96046

               
Query: 383   gt 384
             ||
Sbjct: 96047 gt 96048

---

>emb|X80699.1|MML26MRN M.musculus L26 mRNA
          Length = 545

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 395 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 336

             
Query: 383 gt 384
           ||
Sbjct: 335 gt 334

---

>emb|AL928551.8| Mouse DNA sequence from clone RP23-246P12 on chromosome 4, complete
             sequence
          Length = 215620

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                         
Query: 323   cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
             ||||||||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 17021 cttgcggtccttgtccagctttagcctggtgataacaaccttgctggggtggatgcccac 17080

               
Query: 383   gt 384
             ||
Sbjct: 17081 gt 17082

---

>ref|XM_361491.1| Magnaporthe grisea 70-15 hypothetical protein (MG03965.4) partial
           mRNA
          Length = 528

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 327 cggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||| |||||||||||||||| ||  || |||||||||||||||||
Sbjct: 461 cggtccttgtcgagcttgagcttggtgatgacgacgttgctggggtggatgcc 409

---

>gb|BC070397.1| Mus musculus ribosomal protein L26, mRNA (cDNA clone MGC:99419
           IMAGE:5684553), complete cds
          Length = 628

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 476 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 420

---

>gb|AC113961.14| Mus musculus chromosome 19, clone RP23-18G1, complete sequence
          Length = 256791

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                      
Query: 323   cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
             ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 70964 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 70908

---

>ref|XM_001002260.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC672214),
           mRNA
          Length = 495

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 332 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 276

---

>emb|X14671.1|RRRPL26 Rat liver mRNA for ribosomal protein L26
          Length = 508

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  | ||||||||||||| |||||||
Sbjct: 384 cttgcggtccttgtccagctttagcctggtgataaccaccttgctggggcggatgcc 328

---

>gb|BC099481.1| Mus musculus ribosomal protein L26, mRNA (cDNA clone MGC:117701
           IMAGE:30847108), complete cds
          Length = 542

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 371 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 315

---

>dbj|AK135286.1| Mus musculus 12 days embryo male wolffian duct includes surrounding
           region cDNA, RIKEN full-length enriched library,
           clone:6720454O16 product:ribosomal protein L26, full
           insert sequence
          Length = 517

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 383 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 327

---

>dbj|AK146113.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730001H11 product:ribosomal protein L26,
           full insert sequence
          Length = 531

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 396 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 340

---

>dbj|AK152589.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830080I04 product:ribosomal
           protein L26, full insert sequence
          Length = 522

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 392 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 336

---

>dbj|AK167245.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0045J10 product:ribosomal protein L26,
           full insert sequence
          Length = 521

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 391 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 335

---

>dbj|AK169131.1| Mus musculus 17 days pregnant adult female amnion cDNA, RIKEN
           full-length enriched library, clone:I920082D03
           product:ribosomal protein L26, full insert sequence
          Length = 520

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 51/57 (89%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||||||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 390 cttgcggtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcc 334

---

>emb|CR656768.2|CNS0F5QE Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||| | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgaccaccaccttgctggggtg 338

---

>ref|XM_785677.1| PREDICTED: Strongylocentrotus purpuratus similar to CG6846-PA
           (LOC585872), mRNA
          Length = 636

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 73/87 (83%)
 Strand = Plus / Minus

                                                                       
Query: 303 gccttgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcacc 362
           ||||||||||| |||| |  ||| ||||||||||||| ||| ||||||||||  |  |||
Sbjct: 389 gccttgcggtccaggatgagcttacggtccttgtccatcttcagcttggtgatcacaacc 330

                                      
Query: 363 ttgctggggtggatgccgacgttgacc 389
           |||||||||||||| || |||| ||||
Sbjct: 329 ttgctggggtggattccaacgtagacc 303

---

>ref|XM_550079.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 499

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 189 cgagcttaatcaatctcctggagcgaggcgccggtggc 226
           ||||| ||||| ||||||||||||||||||||||||||
Sbjct: 296 cgagcctaatcgatctcctggagcgaggcgccggtggc 259

---

>gb|AC126800.3| Mus musculus BAC clone RP24-447D19 from chromosome 8, complete sequence
          Length = 171823

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                         
Query: 323   cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
             ||||| ||||||||||||||| ||| ||||||  |  |||||||||||||||||||| ||
Sbjct: 84764 cttgcagtccttgtccagctttagcctggtgataacgaccttgctggggtggatgcccac 84705

               
Query: 383   gt 384
             ||
Sbjct: 84704 gt 84703

---

>gb|AY231776.1| Drosophila yakuba clone yak-em_CG6846 mRNA sequence
          Length = 384

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 315 aggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtgg 374
           |||| |||||| ||||||||||| ||||| ||||||  ||  | ||||||||||||||||
Sbjct: 293 aggatggccttacggtccttgtcgagcttcagcttgacgatcagcaccttgctggggtgg 234

                     
Query: 375 atgccgacgt 384
           ||||| ||||
Sbjct: 233 atgcccacgt 224

---

>gb|AC010563.6| Drosophila melanogaster 3L BAC RP98-9M20 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 185497

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                         
Query: 315   aggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtgg 374
             |||| |||||||||||||||||| ||||| ||||||  ||  | |||||||||||| |||
Sbjct: 23288 aggatggccttgcggtccttgtcgagcttcagcttgacgatcagcaccttgctgggatgg 23229

                       
Query: 375   atgccgacgt 384
             ||||| ||||
Sbjct: 23228 atgcccacgt 23219

---

>ref|NM_140813.2| Drosophila melanogaster Ribosomal protein L26 CG6846-RA (RpL26),
           mRNA
          Length = 685

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 315 aggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtgg 374
           |||| |||||||||||||||||| ||||| ||||||  ||  | |||||||||||| |||
Sbjct: 436 aggatggccttgcggtccttgtcgagcttcagcttgacgatcagcaccttgctgggatgg 377

                     
Query: 375 atgccgacgt 384
           ||||| ||||
Sbjct: 376 atgcccacgt 367

---

>gb|AY071133.1| Drosophila melanogaster RE17611 full length cDNA
          Length = 691

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                       
Query: 315 aggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtgg 374
           |||| |||||||||||||||||| ||||| ||||||  ||  | |||||||||||| |||
Sbjct: 434 aggatggccttgcggtccttgtcgagcttcagcttgacgatcagcaccttgctgggatgg 375

                     
Query: 375 atgccgacgt 384
           ||||| ||||
Sbjct: 374 atgcccacgt 365

---

>gb|DQ016993.1| Ipomoea batatas putative L24 ribosomal protein mRNA, partial cds
          Length = 669

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 131/164 (79%), Gaps = 6/164 (3%)
 Strand = Plus / Minus

                                                                       
Query: 254 gtcctcggcggtgaacttg---cccttggccttgtca---gcagcgcggccacgagcctt 307
           |||||||||||||||||||   |||||  ||||||||   || ||||||||   | ||||
Sbjct: 452 gtcctcggcggtgaacttggttcccttatccttgtcatgggcggcgcggcccttarcctt 393

                                                                       
Query: 308 gcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgct 367
           ||| ||||  || | ||||||||||||||| ||   |||||||||||  |  ||||||  
Sbjct: 392 gcgatcgataagcgacttgcggtccttgtcgaggcggagcttggtgataacaaccttgga 333

                                                       
Query: 368 ggggtggatgccgacgttgaccgtggatccattcaccttctccc 411
            || ||||||||||||||||| |||||||| || ||||||||||
Sbjct: 332 aggatggatgccgacgttgacagtggatccgttaaccttctccc 289

---

>dbj|AK058868.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-A11, full
           insert sequence
          Length = 499

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 189 cgagcttaatcaatctcctggagcgaggcgccggtggc 226
           ||||| ||||| ||||||||||||||||||||||||||
Sbjct: 296 cgagcctaatcgatctcctggagcgaggcgccggtggc 259

---

>gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66 of 83 of the complete
              sequence
          Length = 294542

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 60/70 (85%)
 Strand = Plus / Minus

                                                                          
Query: 315    aggagggccttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtgg 374
              |||| |||||||||||||||||| ||||| ||||||  ||  | |||||||||||| |||
Sbjct: 273815 aggatggccttgcggtccttgtcgagcttcagcttgacgatcagcaccttgctgggatgg 273756

                        
Query: 375    atgccgacgt 384
              ||||| ||||
Sbjct: 273755 atgcccacgt 273746

---

>ref|XM_322822.1| Neurospora crassa OR74A hypothetical protein (NCU03565.1) partial
           mRNA
          Length = 411

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 327 cggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           ||||||||||| |||||||||||||||| ||  || |||  ||||||||||||||||
Sbjct: 344 cggtccttgtcaagcttgagcttggtgatgacgacgttggaggggtggatgccgacg 288

---

>ref|XM_951035.1| Neurospora crassa OR74A hypothetical protein (NCU03565.1) partial
           mRNA
          Length = 411

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 327 cggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           ||||||||||| |||||||||||||||| ||  || |||  ||||||||||||||||
Sbjct: 344 cggtccttgtcaagcttgagcttggtgatgacgacgttggaggggtggatgccgacg 288

---

>ref|XM_745917.1| Aspergillus fumigatus Af293 ribosomal protein L26 (Afu6g11260)
           partial mRNA
          Length = 801

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 326 gcggtccttgtccagcttgagcttggtga 354
           |||||||||||||||||||||||||||||
Sbjct: 744 gcggtccttgtccagcttgagcttggtga 716

---

>emb|BX284746.1|NCB23I4 Neurospora crassa DNA linkage group II BAC contig B23I4
          Length = 71047

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                      
Query: 327   cggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
             ||||||||||| |||||||||||||||| ||  || |||  ||||||||||||||||
Sbjct: 70256 cggtccttgtcaagcttgagcttggtgatgacgacgttggaggggtggatgccgacg 70312

---

>emb|AL807577.1|AFA12H2 Aspergillus fumigatus BAC AFA12F2
          Length = 79718

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                          
Query: 326   gcggtccttgtccagcttgagcttggtga 354
             |||||||||||||||||||||||||||||
Sbjct: 73440 gcggtccttgtccagcttgagcttggtga 73412

---

>emb|AL669986.1|NCB7N14 Neurospora crassa DNA linkage group II BAC clone B7N14
          Length = 107947

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                     
Query: 327  cggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
            ||||||||||| |||||||||||||||| ||  || |||  ||||||||||||||||
Sbjct: 5793 cggtccttgtcaagcttgagcttggtgatgacgacgttggaggggtggatgccgacg 5849

---

>gb|AC160985.4| Mus musculus BAC clone RP23-333D9 from chromosome 12, complete sequence
          Length = 201990

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                       
Query: 323    cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
              |||| ||||||||| |||||| ||  ||||||  |||||||||||||||||||||||
Sbjct: 162860 cttgtggtccttgttcagctttagtgtggtgataatcaccttgctggggtggatgcc 162804

---

>gb|AC079273.5| Mus musculus strain C57BL/6J chromosome 12 clone RP23-373N04, complete
             sequence
          Length = 175987

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 323   cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
             |||| ||||||||| |||||| ||  ||||||  |||||||||||||||||||||||
Sbjct: 12242 cttgtggtccttgttcagctttagtgtggtgataatcaccttgctggggtggatgcc 12186

---

>ref|XM_226231.3| PREDICTED: Rattus norvegicus similar to 60S ribosomal protein L26
           (LOC307636), mRNA
          Length = 868

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           |||| |||||||||||||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 750 cttgtggtccttgtccagctttagcctggtgataactaccttgctggggtggatgcc 694

---

>gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, complete sequence
          Length = 168604

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 323   cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
             |||| |||| ||||||||||| ||| ||||||  | |||||||||||||||||||||
Sbjct: 72643 cttgtggtctttgtccagctttagcctggtgataaccaccttgctggggtggatgcc 72587

---

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                        
Query: 323     cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
               |||| ||||||||| |||||| ||  ||||||  |||||||||||||||||||||||
Sbjct: 2245578 cttgtggtccttgttcagctttagtgtggtgataatcaccttgctggggtggatgcc 2245634

---

>emb|AJ851868.2| Mus musculus immunoglobulin heavy chain locus constant region and partial
              variable region, strain 129/Sv
          Length = 1382053

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 50/57 (87%)
 Strand = Plus / Plus

                                                                       
Query: 323    cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
              |||| ||||||||| |||||| ||  ||||||  |||||||||||||||||||||||
Sbjct: 457117 cttgtggtccttgttcagctttagtgtggtgataatcaccttgctggggtggatgcc 457173

---

>gb|AC125143.4| Mus musculus BAC clone RP24-342H13 from 17, complete sequence
          Length = 219259

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                              
Query: 332    cttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
              |||||||||||| ||| |||||| |  |||||||||||||||||||||
Sbjct: 148638 cttgtccagctttagcctggtgatgcccaccttgctggggtggatgcc 148685

---

>gb|AC168090.3| Mus musculus BAC clone RP24-272N5 from chromosome 17, complete sequence
          Length = 157940

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                             
Query: 332   cttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
             |||||||||||| ||| |||||| |  |||||||||||||||||||||
Sbjct: 33601 cttgtccagctttagcctggtgatgcccaccttgctggggtggatgcc 33648

---

>gb|DQ214873.1| Taeniopygia guttata clone 0065P0006F04 ribosomal protein L26
           variant 2-like mRNA, complete sequence
          Length = 648

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           |||||||||||||||| |   |||| ||||||  | ||||||||||||||||||||| ||
Sbjct: 385 cttgcggtccttgtccggggggagcctggtgatcaccaccttgctggggtggatgcccac 326

                      
Query: 383 gttgaccgtgg 393
           ||  |||||||
Sbjct: 325 gtgcaccgtgg 315

---

>emb|CR734278.2|CNS0GTCL Tetraodon nigroviridis full-length cDNA
          Length = 455

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 328 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 278

---

>emb|CR727400.2|CNS0GO7I Tetraodon nigroviridis full-length cDNA
          Length = 484

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 356 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 306

---

>emb|CR722268.2|CNS0GK8Y Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR721252.2|CNS0GJGQ Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR719224.2|CNS0GHWE Tetraodon nigroviridis full-length cDNA
          Length = 480

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 353 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 303

---

>emb|CR717811.2|CNS0GGT5 Tetraodon nigroviridis full-length cDNA
          Length = 552

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 425 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 375

---

>emb|CR717151.2|CNS0GGAW Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR715926.2|CNS0GFCY Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR715491.2|CNS0GF0V Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR713914.2|CNS0GDT2 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR713617.2|CNS0GDKT Tetraodon nigroviridis full-length cDNA
          Length = 480

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 353 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 303

---

>emb|CR713613.2|CNS0GDKP Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR712581.2|CNS0GCS1 Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 382 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 332

---

>emb|CR709848.2|CNS0GAO4 Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 382 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 332

---

>emb|CR709512.2|CNS0GAES Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 382 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 332

---

>emb|CR709445.2|CNS0GACX Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR708874.2|CNS0G9X2 Tetraodon nigroviridis full-length cDNA
          Length = 508

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 381 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 331

---

>emb|CR708847.2|CNS0G9WB Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 385 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 335

---

>emb|CR709150.2|CNS0GA4Q Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 389 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 339

---

>emb|CR708771.2|CNS0G9U7 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR708071.2|CNS0G9AR Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR707257.2|CNS0G8O5 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR707183.2|CNS0G8M3 Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 389 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 339

---

>emb|CR706350.2|CNS0G7YY Tetraodon nigroviridis full-length cDNA
          Length = 530

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 404 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 354

---

>emb|CR706307.2|CNS0G7XR Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR706271.2|CNS0G7WR Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR705468.2|CNS0G7AG Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 382 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 332

---

>emb|CR705102.2|CNS0G70A Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR704827.2|CNS0G6SN Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR704087.2|CNS0G683 Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 399 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 349

---

>emb|CR701210.2|CNS0G406 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR699151.2|CNS0G2EZ Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 399 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 349

---

>emb|CR698971.2|CNS0G29Z Tetraodon nigroviridis full-length cDNA
          Length = 480

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 353 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 303

---

>emb|CR697641.2|CNS0G191 Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 385 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 335

---

>emb|CR696598.2|CNS0G0G2 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR696265.2|CNS0G06T Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR695617.2|CNS0FZOT Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR695829.2|CNS0FZUP Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR694165.2|CNS0FYKH Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR693552.2|CNS0FY3G Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR688368.2|CNS0FU3G Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR688529.2|CNS0FU7X Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR687983.2|CNS0FTSR Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR679451.2|CNS0FN7R Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 382 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 332

---

>emb|CR678843.2|CNS0FMQV Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR678338.2|CNS0FMD0 Tetraodon nigroviridis full-length cDNA
          Length = 500

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR677828.2|CNS0FLZ0 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR676983.2|CNS0FLBN Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR675560.2|CNS0FK8E Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR670125.2|CNS0FG1F Tetraodon nigroviridis full-length cDNA
          Length = 509

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 382 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 332

---

>emb|CR669494.2|CNS0FFJW Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR664760.2|CNS0FBWE Tetraodon nigroviridis full-length cDNA
          Length = 478

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 353 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 303

---

>emb|CR664215.2|CNS0FBH9 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR658223.2|CNS0F6UT Tetraodon nigroviridis full-length cDNA
          Length = 526

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 399 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 349

---

>emb|CR657395.2|CNS0F67T Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR656781.2|CNS0F5QR Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR655153.2|CNS0F4HJ Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR653644.2|CNS0F3BM Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR653632.2|CNS0F3BA Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR652898.2|CNS0F2QW Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR652258.2|CNS0F294 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR652236.2|CNS0F28I Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR652521.2|CNS0F2GF Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR650658.2|CNS0F10O Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR650105.2|CNS0F0LB Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR649217.2|CNS0EZWN Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR647589.2|CNS0EYNF Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR647557.2|CNS0EYMJ Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR646889.2|CNS0EY3Z Tetraodon nigroviridis full-length cDNA
          Length = 517

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 390 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 340

---

>emb|CR646010.2|CNS0EXFK Tetraodon nigroviridis full-length cDNA
          Length = 513

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 386 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 336

---

>emb|CR645764.2|CNS0EX8Q Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR645395.2|CNS0EWYH Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR644649.2|CNS0EWDR Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR644529.2|CNS0EWAF Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR644937.2|CNS0EWLR Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 387 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 337

---

>emb|CR644844.2|CNS0EWJ6 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR642799.2|CNS0EUYD Tetraodon nigroviridis full-length cDNA
          Length = 517

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 390 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 340

---

>emb|CR642099.2|CNS0EUEX Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR641153.2|CNS0ETON Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 389 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 339

---

>emb|CR641040.2|CNS0ETLI Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR640281.2|CNS0ET0F Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR638365.2|CNS0ERJ7 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR638016.2|CNS0ER9I Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 347 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 297

---

>emb|CR637867.2|CNS0ER5D Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR634998.2|CNS0EOXO Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR635636.2|CNS0EPFE Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR634517.2|CNS0EOKB Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR632705.2|CNS0EN5Z Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR634207.2|CNS0EOBP Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR633451.2|CNS0ENQP Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR633449.2|CNS0ENQN Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 387 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 337

---

>emb|CR633433.2|CNS0ENQ7 Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 385 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 335

---

>emb|CR633152.2|CNS0ENIE Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 385 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 335

---

>emb|CR632536.2|CNS0EN1A Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 385 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 335

---

>emb|CR632500.2|CNS0EN0A Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR631260.2|CNS0EM1T Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR632409.2|CNS0EMXR Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 385 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 335

---

>emb|CR632185.2|CNS0EMRJ Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR632097.2|CNS0EMP3 Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 387 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 337

---

>emb|CR631883.2|CNS0EMJ5 Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR631475.2|CNS0EM7S Tetraodon nigroviridis full-length cDNA
          Length = 512

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 385 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 335

---

>emb|CR631326.2|CNS0EM3N Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>emb|CR631540.2|CNS0EM9M Tetraodon nigroviridis full-length cDNA
          Length = 515

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 45/51 (88%)
 Strand = Plus / Minus

                                                              
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtg 373
           ||||||||| ||||||||||| ||| ||||||  | |||||||||||||||
Sbjct: 388 cttgcggtctttgtccagctttagcctggtgatcaccaccttgctggggtg 338

---

>gb|AC163019.5| Mus musculus chromosome 19, clone RP24-290E5, complete sequence
          Length = 152969

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 330    tccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
              |||||| ||||||| ||| ||||||  | |||||||||||||||||||||
Sbjct: 123620 tccttgcccagcttcagcctggtgatcaccaccttgctggggtggatgcc 123669

---

>dbj|AK171767.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830009M15 product:hypothetical protein,
            full insert sequence
          Length = 3884

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                              
Query: 330  tccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
            |||||||||||||| ||  ||||||  | |||||||||||||||||||||
Sbjct: 993  tccttgtccagcttcagactggtgatcaccaccttgctggggtggatgcc 1042

---

>gb|AC104201.12| Mus musculus chromosome 19, clone RP24-531I1, complete sequence
          Length = 166165

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                                
Query: 330    tccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
              |||||| ||||||| ||| ||||||  | |||||||||||||||||||||
Sbjct: 153292 tccttgcccagcttcagcctggtgatcaccaccttgctggggtggatgcc 153341

---

>ref|NM_126151.1| Arabidopsis thaliana structural constituent of ribosome AT5G67510
           mRNA, complete cds
          Length = 639

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 378 ccgacgttgaccgtggatccattcaccttctccctggtgat 418
           |||||||||||||||||||| || || |||||||| |||||
Sbjct: 331 ccgacgttgaccgtggatccgttgactttctcccttgtgat 291

---

>gb|AC142111.3| Mus musculus BAC clone RP24-63G9 from chromosome 9, complete sequence
          Length = 185361

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 329   gtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatg 377
             ||||||| ||||||| ||| ||||||  | |||||||||||||||||||
Sbjct: 81125 gtccttgcccagctttagcctggtgataaccaccttgctggggtggatg 81173

---

>emb|AL845475.12| Mouse DNA sequence from clone RP23-403E20 on chromosome 11 Contains a
             novel pseudogene (similar to RIKEN cDNA 4833439L19 gene)
             and a ribosomal protein L26 (Rpl26) pseudogene, complete
             sequence
          Length = 147170

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                              
Query: 331   ccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
             |||||| |||||| ||| |||||| |  |||||||||||||||||||||
Sbjct: 47660 ccttgttcagctttagcctggtgatgcccaccttgctggggtggatgcc 47612

---

>gb|AY081628.1| Arabidopsis thaliana 60S ribosomal protein L26 (At5g67510) mRNA,
           complete cds
          Length = 525

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 378 ccgacgttgaccgtggatccattcaccttctccctggtgat 418
           |||||||||||||||||||| || || |||||||| |||||
Sbjct: 290 ccgacgttgaccgtggatccgttgactttctcccttgtgat 250

---

>gb|AY065109.1| Arabidopsis thaliana 60S ribosomal protein L26 (At5g67510; K9I9.7)
           mRNA, complete cds
          Length = 601

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 378 ccgacgttgaccgtggatccattcaccttctccctggtgat 418
           |||||||||||||||||||| || || |||||||| |||||
Sbjct: 328 ccgacgttgaccgtggatccgttgactttctcccttgtgat 288

---

>emb|BX824404.1|CNS0A5SJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH46ZH07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 627

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 378 ccgacgttgaccgtggatccattcaccttctccctggtgat 418
           |||||||||||||||||||| || || |||||||| |||||
Sbjct: 304 ccgacgttgaccgtggatccgttgactttctcccttgtgat 344

---

>gb|AF401580.1| Ictalurus punctatus ribosomal protein L26 mRNA, complete cds
          Length = 488

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           |||||| |||||||||||||| ||| ||||||  |  |||||||| |||||||||||
Sbjct: 365 cttgcgatccttgtccagctttagcctggtgatcacaaccttgctagggtggatgcc 309

---

>gb|AY086530.1| Arabidopsis thaliana clone 2561 mRNA, complete sequence
          Length = 639

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 378 ccgacgttgaccgtggatccattcaccttctccctggtgat 418
           |||||||||||||||||||| || || |||||||| |||||
Sbjct: 331 ccgacgttgaccgtggatccgttgactttctcccttgtgat 291

---

>dbj|AB013390.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K9I9
          Length = 51860

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 378   ccgacgttgaccgtggatccattcaccttctccctggtgat 418
             |||||||||||||||||||| || || |||||||| |||||
Sbjct: 17287 ccgacgttgaccgtggatccgttgactttctcccttgtgat 17327

---

>dbj|AK108325.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-141-H06, full
           insert sequence
          Length = 649

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 307 tgcggtcgaggagggccttgcggtccttgtccagcttgagcttggtgac 355
           |||| ||||||| ||||| ||||||||||||||  | ||||||||||||
Sbjct: 456 tgcgctcgaggatggcctcgcggtccttgtccatgtggagcttggtgac 408

---

>gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, complete sequence
          Length = 162317

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 323   cttgcggtccttgtccagcttgagcttggtga 354
             ||||| ||||||||||||||| ||||||||||
Sbjct: 24680 cttgcagtccttgtccagctttagcttggtga 24711

---

>ref|XM_653082.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0570.2), mRNA
          Length = 405

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 327 cggtccttgtccagcttgagcttggtga 354
           ||||||||||| ||||||||||||||||
Sbjct: 344 cggtccttgtcgagcttgagcttggtga 317

---

>ref|XM_391021.1| Gibberella zeae PH-1 chromosome 3 conserved hypothetical protein
           (FG10845.1) partial mRNA
          Length = 411

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                       
Query: 327 cggtccttgtccagcttgagcttggtga 354
           ||||||||||| ||||||||||||||||
Sbjct: 344 cggtccttgtcaagcttgagcttggtga 317

---

>gb|AC151267.3| Mus musculus BAC clone RP24-296E22 from chromosome 17, complete
             sequence
          Length = 169816

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Plus

                                                                     
Query: 323   cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgc 378
             |||| ||||||| |||||||| ||| ||||||    ||||||||||||||||||||
Sbjct: 53132 cttgtggtccttctccagctttagcctggtgatacccaccttgctggggtggatgc 53187

---

>emb|AL603662.11| Mouse DNA sequence from clone RP23-396M19 on chromosome 11 Contains the
              3' end of the Myh10 gene for non-muscle myosin heavy chain
              10, the Ndel1 gene for nuclear distribution gene E-like
              homolog 1 (A. nidulans), three genes for novel proteins
              (9930039A11Rik, 1810012H11Rik and D130071N09), the Rpl26
              gene for ribosomal protein L26, gene Oppo1-pending (oppo
              1), gene RAN guanine nucleotide release factor
              (Rangnrf-pending) and three CpG islands, complete sequence
          Length = 201275

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 323    cttgcggtccttgtccagcttgagcttggtga 354
              ||||||||||||||||||||| ||| ||||||
Sbjct: 120913 cttgcggtccttgtccagctttagcctggtga 120882



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 359    caccttgctggggtggatgcc 379
              |||||||||||||||||||||
Sbjct: 119832 caccttgctggggtggatgcc 119812

---

>ref|NM_213113.1| Danio rerio ribosomal protein L26 (rpl26), mRNA
          Length = 538

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||| |||||||| ||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 390 ttgcgatccttgtcgagctttagcctggtgatcacaaccttgctggggtggatgcc 335

---

>dbj|AB093679.1| Macaca fascicularis RPL26 mRNA for ribosomal protein L26, complete
           cds, clone:QbsB-11436
          Length = 541

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 389 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 330

                   
Query: 384 ttgaccgt 391
           | ||||||
Sbjct: 329 tggaccgt 322

---

>gb|BC055538.1| Danio rerio ribosomal protein L26, mRNA (cDNA clone MGC:66190
           IMAGE:5612305), complete cds
          Length = 538

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||| |||||||| ||||| ||| ||||||  |  ||||||||||||||||||||
Sbjct: 390 ttgcgatccttgtcgagctttagcctggtgatcacaaccttgctggggtggatgcc 335

---

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 246     gcggcgacgtcctcggcggtgaa 268
               |||||||||||||||||||||||
Sbjct: 2943019 gcggcgacgtcctcggcggtgaa 2942997

---

>emb|AL928960.25| Mouse DNA sequence from clone RP23-413K16 on chromosome 2, complete
              sequence
          Length = 195733

 Score = 46.1 bits (23), Expect = 0.093
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 336    tccagcttgagcttggtgacgatcaccttgctggg 370
              |||||||||| ||||||||  ||||||||||||||
Sbjct: 186894 tccagcttgaccttggtgataatcaccttgctggg 186928

---

>gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome 9, complete sequence
          Length = 182190

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                           
Query: 334   tgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
             |||||||||| ||| |||||| |  |||||||||||||| ||||||
Sbjct: 14203 tgtccagctttagcctggtgatgcccaccttgctggggtagatgcc 14158

---

>gb|AC123067.4| Mus musculus BAC clone RP23-20M6 from chromosome 12, complete sequence
          Length = 200251

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 52/62 (83%)
 Strand = Plus / Plus

                                                                          
Query: 323    cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
              ||||| |||||||||||| || ||| ||||||  | |||||  |||||||||||||| ||
Sbjct: 128955 cttgcagtccttgtccagttttagcctggtgataaccacctcactggggtggatgcccac 129014

                
Query: 383    gt 384
              ||
Sbjct: 129015 gt 129016

---

>ref|XM_984209.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC217600),
           mRNA
          Length = 490

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||| |||||||||||| || ||| ||||||  | |||||  |||||||||||||| ||
Sbjct: 348 cttgcagtccttgtccagttttagcctggtgataaccacctcactggggtggatgcccac 289

             
Query: 383 gt 384
           ||
Sbjct: 288 gt 287

---

>ref|XM_138109.3| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC217600),
           mRNA
          Length = 490

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||| |||||||||||| || ||| ||||||  | |||||  |||||||||||||| ||
Sbjct: 348 cttgcagtccttgtccagttttagcctggtgataaccacctcactggggtggatgcccac 289

             
Query: 383 gt 384
           ||
Sbjct: 288 gt 287

---

>ref|XM_915843.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC217600),
           mRNA
          Length = 490

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgac 382
           ||||| |||||||||||| || ||| ||||||  | |||||  |||||||||||||| ||
Sbjct: 348 cttgcagtccttgtccagttttagcctggtgataaccacctcactggggtggatgcccac 289

             
Query: 383 gt 384
           ||
Sbjct: 288 gt 287

---

>ref|XR_003659.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (LOC628726), mRNA
          Length = 437

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 334 tgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           |||||||||| ||| |||||| |  |||||||||||||| ||||||
Sbjct: 336 tgtccagctttagcctggtgatgcccaccttgctggggtagatgcc 291

---

>ref|XM_785606.1| PREDICTED: Strongylocentrotus purpuratus similar to Tyrosine-protein
            phosphatase 10D precursor (Receptor-linked
            protein-tyrosine phosphatase 10D) (LOC585795), mRNA
          Length = 3381

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 345  agcttggtgacgatcaccttgc 366
            ||||||||||||||||||||||
Sbjct: 2426 agcttggtgacgatcaccttgc 2405

---

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 251    gacgtcctcggcggtgaacttg 272
              ||||||||||||||||||||||
Sbjct: 664705 gacgtcctcggcggtgaacttg 664684

---

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 243     gcggcggcgacgtcctcggcggtgaa 268
               ||||||||||||| ||||||||||||
Sbjct: 2159641 gcggcggcgacgttctcggcggtgaa 2159616

---

>gb|AF159097.1|AF159097 Rattus norvegicus SVS-protein F mRNA, partial cds
          Length = 389

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 397 cattcaccttctccctggtgat 418
           ||||||||||||||||||||||
Sbjct: 38  cattcaccttctccctggtgat 17

---

>gb|AC173346.1| Mus musculus BAC clone RP23-42N8 from chromosome 9, complete sequence
          Length = 219266

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                            
Query: 334    tgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
              |||||||||| ||| |||||| |  |||||||||||||| ||||||
Sbjct: 183925 tgtccagctttagcctggtgatgcccaccttgctggggtagatgcc 183880

---

>ref|NM_000987.3| Homo sapiens ribosomal protein L26 (RPL26), mRNA
          Length = 602

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 443 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 384

            
Query: 384 t 384
           |
Sbjct: 383 t 383

---

>ref|XM_511853.1| PREDICTED: Pan troglodytes similar to 60S ribosomal protein L26
           (LOC455092), mRNA
          Length = 1176

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 992 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 933

            
Query: 384 t 384
           |
Sbjct: 932 t 932

---

>ref|XM_509238.1| PREDICTED: Pan troglodytes similar to 60S ribosomal protein L26
           (LOC452096), mRNA
          Length = 530

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 373 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 314

            
Query: 384 t 384
           |
Sbjct: 313 t 313

---

>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence
          Length = 218917

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 359    caccttgctggggtggatgcc 379
              |||||||||||||||||||||
Sbjct: 133799 caccttgctggggtggatgcc 133819

---

>gb|AC165380.3| Colobus guereza clone CH272-85C5, complete sequence
          Length = 199248

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 43     caggcacatgatagatgcaca 63
              |||||||||||||||||||||
Sbjct: 125105 caggcacatgatagatgcaca 125085

---

>gb|AC145494.3| Gorilla gorilla gorilla clone CH255-100P16, complete sequence
          Length = 187132

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 43     caggcacatgatagatgcaca 63
              |||||||||||||||||||||
Sbjct: 114834 caggcacatgatagatgcaca 114814

---

>gb|AC087214.4| Papio anubis clone RP41-150K7, complete sequence
          Length = 141415

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 43    caggcacatgatagatgcaca 63
             |||||||||||||||||||||
Sbjct: 51722 caggcacatgatagatgcaca 51702

---

>ref|NM_001015512.2| Bos taurus ribosomal protein L26 (RPL26), mRNA
          Length = 629

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||  ||||||  | ||||||||||||||| ||||| |||
Sbjct: 390 ttgcggtctttgtccagttttagtctggtgataaccaccttgctggggtgaatgcccacg 331

            
Query: 384 t 384
           |
Sbjct: 330 t 330

---

>gb|BC066316.1| Homo sapiens cDNA clone MGC:87181 IMAGE:5277258, complete cds
          Length = 533

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 389 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 330

            
Query: 384 t 384
           |
Sbjct: 329 t 329

---

>ref|XM_990754.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26-like 1
           (LOC433050), mRNA
          Length = 525

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||| ||||||||||||||| ||  ||||||  | ||  |||||||||||||||||
Sbjct: 390 cttgctgtccttgtccagctttagtctggtgataaccatgttgctggggtggatgcc 334

---

>ref|XM_912297.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L26-like 1
           (LOC433050), mRNA
          Length = 525

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||| ||||||||||||||| ||  ||||||  | ||  |||||||||||||||||
Sbjct: 390 cttgctgtccttgtccagctttagtctggtgataaccatgttgctggggtggatgcc 334

---

>ref|XM_484573.4| PREDICTED: Mus musculus similar to 60S ribosomal protein L26-like 1
           (LOC433050), mRNA
          Length = 525

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                    
Query: 323 cttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgcc 379
           ||||| ||||||||||||||| ||  ||||||  | ||  |||||||||||||||||
Sbjct: 390 cttgctgtccttgtccagctttagtctggtgataaccatgttgctggggtggatgcc 334

---

>gb|AC002543.1| Homo sapiens BAC clone CTA-300C3 from 7, complete sequence
          Length = 150147

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 43    caggcacatgatagatgcaca 63
             |||||||||||||||||||||
Sbjct: 27115 caggcacatgatagatgcaca 27095

---

>gb|AC145398.2| Rattus norvegicus chromosome 1 clone RP32-604H24 map q35-q36, complete
             sequence
          Length = 165235

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 277   tggccttgtcagcagcgcggccacgagcc 305
             |||||| |||||||||||||||| |||||
Sbjct: 26177 tggcctagtcagcagcgcggccaggagcc 26149

---

>ref|XR_002078.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC667801),
           mRNA
          Length = 436

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 359 caccttgctggggtggatgcc 379
           |||||||||||||||||||||
Sbjct: 312 caccttgctggggtggatgcc 292

---

>ref|XR_002265.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L26
           (Silica-induced gene 20 protein) (SIG-20) (LOC668913),
           mRNA
          Length = 439

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 359 caccttgctggggtggatgcc 379
           |||||||||||||||||||||
Sbjct: 312 caccttgctggggtggatgcc 292

---

>gb|BC021073.1| Homo sapiens cDNA clone IMAGE:3010311, **** WARNING: chimeric clone
           ****
          Length = 2030

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 890 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 949

            
Query: 384 t 384
           |
Sbjct: 950 t 950

---

>emb|AL121871.8|HSB258O15 Human DNA sequence from clone RP13-258O15 on chromosome X Contains a
             ribosomal protein L26 pseudogene, complete sequence
          Length = 183876

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Plus

                                                                         
Query: 324   ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
             |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 52951 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 53010

              
Query: 384   t 384
             |
Sbjct: 53011 t 53011

---

>emb|X15351.1|MMMCEA1 Mouse mRNA fragment for carcinoembryonic antigen (CEA)-like antigen
          Length = 1786

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 cttgcggtccttgtccagctt 343
           |||||||||||||||||||||
Sbjct: 30  cttgcggtccttgtccagctt 10

---

>ref|XM_967673.1| PREDICTED: Tribolium castaneum similar to CG6484-PA (LOC661519),
           mRNA
          Length = 1440

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 318 agggccttgcggtccttgtccagcttgagcttggtga 354
           |||||||||||| ||||||||| ||||  ||||||||
Sbjct: 641 agggccttgcgggccttgtccatcttgttcttggtga 605

---

>emb|X67279.1|MMBGPD M.musculus Bgpd mRNA for biliary glycoprotein
          Length = 2922

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 cttgcggtccttgtccagctt 343
           |||||||||||||||||||||
Sbjct: 30  cttgcggtccttgtccagctt 10

---

>emb|X67278.1|MMBGPC M.musculus Bgpc mRNA for biliary glycoprotein
          Length = 1521

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 cttgcggtccttgtccagctt 343
           |||||||||||||||||||||
Sbjct: 30  cttgcggtccttgtccagctt 10

---

>emb|X69392.1|HSRP26AA H.sapiens mRNA for ribosomal protein L26
          Length = 773

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 353 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 294

            
Query: 384 t 384
           |
Sbjct: 293 t 293

---

>emb|CR625206.1| full-length cDNA clone CS0DI020YA05 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 487

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 353 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 294

            
Query: 384 t 384
           |
Sbjct: 293 t 293

---

>emb|CR614577.1| full-length cDNA clone CS0DC027YL23 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 485

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 353 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 294

            
Query: 384 t 384
           |
Sbjct: 293 t 293

---

>emb|CR598792.1| full-length cDNA clone CS0DK001YN13 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 487

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||| | ||||  | ||||||||||||||| ||||| |||
Sbjct: 353 ttgcggtctttgtccagttttagcctagtgataaccaccttgctggggtgaatgcctacg 294

            
Query: 384 t 384
           |
Sbjct: 293 t 293

---

>gb|BC102057.1| Bos taurus ribosomal protein L26, mRNA (cDNA clone MGC:126994
           IMAGE:7940948), complete cds
          Length = 629

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 324 ttgcggtccttgtccagcttgagcttggtgacgatcaccttgctggggtggatgccgacg 383
           |||||||| |||||||| || ||  ||||||  | ||||||||||||||| ||||| |||
Sbjct: 390 ttgcggtctttgtccagttttagtctggtgataaccaccttgctggggtgaatgcccacg 331

            
Query: 384 t 384
           |
Sbjct: 330 t 330

---

>gb|CP000249.1| Frankia sp. CcI3, complete genome
          Length = 5433628

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 246     gcggcgacgtcctcggcggtg 266
               |||||||||||||||||||||
Sbjct: 3794888 gcggcgacgtcctcggcggtg 3794908


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,436,521
Number of Sequences: 3902068
Number of extensions: 3436521
Number of successful extensions: 104631
Number of sequences better than 10.0: 330
Number of HSP's better than 10.0 without gapping: 324
Number of HSP's successfully gapped in prelim test: 7
Number of HSP's that attempted gapping in prelim test: 102463
Number of HSP's gapped (non-prelim): 2158
length of query: 427
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 405
effective length of database: 17,147,199,772
effective search space: 6944615907660
effective search space used: 6944615907660
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---